Skip to Main Content
Table 1.

Primer sequences used for expression, DNA methylation and ChIP analysis

Primer nameSequence (5′ to 3′)
Primers for expression analysis
 
 
Ubq-F AACCAGCTGAGGCCCAAGA 
Ubq-R ACGATTGATTTAACCAGTCCATGA 
Hd3a-F GCTCACTATCATCATCCAGCATG 
Hd3a-R CCTTGCTCAGCTATTTAATTGCATAA 
RFT1-F TGGGTTAGCTGACCTAGATTCAAA 
RFT1-R
 
GCCAACCACAAGAGGATCGT
 
Primers for RNAi constructs
 
 
Hd3a-F CACCTGCTGCATGCTCACTATCATC 
Hd3a-R CATGAGAGACCTTAGCCTTGC 
RFT1-F CACCGGCTAGCTTAACCTTCCTGAACATC 
RFT1-R
 
GCCGGCCATGTCAAATTAATAACC
 
Primers for RFT1::GUS
 
 
RFT1 promoter-F TGATATTCTCGCACCCAGTCTTG 
RFT1 promoter-R
 
CCCACTAACTTATGAAGCTAGCCGG
 
Primers for screening RNAi plants
 
 
Hd3a-F GTCTACTTCAACTGCCAGCGCGAG 
Hd3a-R GAACCTGCAATGTATAGCATGCTGG 
RFT1-F GTCTACTTCAACTGCCAGCGCGAG 
RFT1-R
 
CTTAGCTATAGCTGCTGCATGCATG
 
Primers for OsMADSs expression analysis
 
 
OsMADS14-F CGGTTGCGAGACGAGGAA 
OsMADS14-R GAAAGACGGTGCTGGACGAA 
OsMADS15-F CGTCGTCGGCCAAACAG 
OsMADS15-R TGACTTCAATTCATTCAAGGTTGCT 
OsMADS50-F CAGGCCAGGAATAAGCTGGAT 
OsMADS50-R
 
TTAGGATGGTTTGGTGTCATTGC
 
Primers for ChIP analysis
 
 
Act-F ATGGGGCTCTCGGATGTAG 
Act-R TAGTGCCCTTTTCCCCTCTT 
I-F CAGTTTCAGCACTTCTATCGACATG 
I-R AGCCTTACTATGATGTGCCCAGTAG 
II-F TAGTGTCTTGGGTTGGTACTGCCTA 
II-R CCGTTCAATCCAGAGGATAGATGTC 
III-F CAGGAGATACCTAAGCTAGCTAGCA 
III-R AACCCACTAACTTATGAAGCTAGCC 
IV-F GGATGCAGAGACCCACCAGAAGTTA 
IV-R GGGTCTACCATCACCTGTAGGTAAT 
V-F GTAGGCACCGATCAGATATGTTAGC 
V-R CTCCAGTGGTACCAGGAATATCGGT 
VI-F CGTCAGATTTGAAGGATAGGGCTGT 
VI-R ACATCACCTCTTGCCCTGCATCAAT 
VII-F GTCTACTTCAACTGCCAGCGCGAG 
VII-R
 
CTTAGCTATAGCTGCTGCATGCATG
 
Primers for DNA methylation analysis
 
 
35S M-F AAACCTCCTCGGATTCCATT 
35S M-R AGCCTGTCCTCTCCAAATGA 
RFT1 I M-F GCCATGCATCCATCAAGAAAATTCC 
RFT1 I M-R CAAAGCATGCATGCATATGTGGAGG 
RFT1 II M-F CCTCCACATATGCATGCATGCTTTG 
RFT1 II M-R CGTTCAATCCAGAGGATAGATGTC 
RFT1 III M-F GACATCTATCCTCTGGATTGAACG 
RFT1 III M-R ACTCCCTAAGGTTAGGGTTGCTTGG 
Primer nameSequence (5′ to 3′)
Primers for expression analysis
 
 
Ubq-F AACCAGCTGAGGCCCAAGA 
Ubq-R ACGATTGATTTAACCAGTCCATGA 
Hd3a-F GCTCACTATCATCATCCAGCATG 
Hd3a-R CCTTGCTCAGCTATTTAATTGCATAA 
RFT1-F TGGGTTAGCTGACCTAGATTCAAA 
RFT1-R
 
GCCAACCACAAGAGGATCGT
 
Primers for RNAi constructs
 
 
Hd3a-F CACCTGCTGCATGCTCACTATCATC 
Hd3a-R CATGAGAGACCTTAGCCTTGC 
RFT1-F CACCGGCTAGCTTAACCTTCCTGAACATC 
RFT1-R
 
GCCGGCCATGTCAAATTAATAACC
 
Primers for RFT1::GUS
 
 
RFT1 promoter-F TGATATTCTCGCACCCAGTCTTG 
RFT1 promoter-R
 
CCCACTAACTTATGAAGCTAGCCGG
 
Primers for screening RNAi plants
 
 
Hd3a-F GTCTACTTCAACTGCCAGCGCGAG 
Hd3a-R GAACCTGCAATGTATAGCATGCTGG 
RFT1-F GTCTACTTCAACTGCCAGCGCGAG 
RFT1-R
 
CTTAGCTATAGCTGCTGCATGCATG
 
Primers for OsMADSs expression analysis
 
 
OsMADS14-F CGGTTGCGAGACGAGGAA 
OsMADS14-R GAAAGACGGTGCTGGACGAA 
OsMADS15-F CGTCGTCGGCCAAACAG 
OsMADS15-R TGACTTCAATTCATTCAAGGTTGCT 
OsMADS50-F CAGGCCAGGAATAAGCTGGAT 
OsMADS50-R
 
TTAGGATGGTTTGGTGTCATTGC
 
Primers for ChIP analysis
 
 
Act-F ATGGGGCTCTCGGATGTAG 
Act-R TAGTGCCCTTTTCCCCTCTT 
I-F CAGTTTCAGCACTTCTATCGACATG 
I-R AGCCTTACTATGATGTGCCCAGTAG 
II-F TAGTGTCTTGGGTTGGTACTGCCTA 
II-R CCGTTCAATCCAGAGGATAGATGTC 
III-F CAGGAGATACCTAAGCTAGCTAGCA 
III-R AACCCACTAACTTATGAAGCTAGCC 
IV-F GGATGCAGAGACCCACCAGAAGTTA 
IV-R GGGTCTACCATCACCTGTAGGTAAT 
V-F GTAGGCACCGATCAGATATGTTAGC 
V-R CTCCAGTGGTACCAGGAATATCGGT 
VI-F CGTCAGATTTGAAGGATAGGGCTGT 
VI-R ACATCACCTCTTGCCCTGCATCAAT 
VII-F GTCTACTTCAACTGCCAGCGCGAG 
VII-R
 
CTTAGCTATAGCTGCTGCATGCATG
 
Primers for DNA methylation analysis
 
 
35S M-F AAACCTCCTCGGATTCCATT 
35S M-R AGCCTGTCCTCTCCAAATGA 
RFT1 I M-F GCCATGCATCCATCAAGAAAATTCC 
RFT1 I M-R CAAAGCATGCATGCATATGTGGAGG 
RFT1 II M-F CCTCCACATATGCATGCATGCTTTG 
RFT1 II M-R CGTTCAATCCAGAGGATAGATGTC 
RFT1 III M-F GACATCTATCCTCTGGATTGAACG 
RFT1 III M-R ACTCCCTAAGGTTAGGGTTGCTTGG 
Close Modal

or Create an Account

Close Modal
Close Modal