Skip to Main Content
Table 3.

Oligonucleotides for ChIP-PCR analyses

GeneOrientationSequence (5′ to 3′)
Dlx5 -2000 TTTAGAGCAGACCGCAATCA 
Dlx5 -2000 AS CCTACTTGCAGCCTTGGTGT 
Dlx5 R1 AGCTTCCAAGTAGTCGAGG 
Dlx5 R1 AS CAGTTGGACACGCAGCAAGC 
Dlx5 R2 GTGTTGCTCTGCTCCCGAAG 
Dlx5 R2 AS GGGCGGTGGCTGTTCTTCTA 
Dlx6 R1 GCTTCTAAGCACAGGCAACC 
Dlx6 R1 AS TACCTTCCGCAGTTCCAATC 
Dlx6 R2 AGGCCCCGCTCACTATATCT 
Dlx6 R2 AS TGCAGCCACCTTAGCTCTTT 
lkkα CTCAAGTCGGAGAACAAGG 
lkkα AS CTCGAATCCTACCACACTCG 
ΔNp63 AAGTTTTACCTGTCTGTCTCCTGGG 
ΔNp63 AS ATGCTGCTGTCCTTTCTTCTG 
GeneOrientationSequence (5′ to 3′)
Dlx5 -2000 TTTAGAGCAGACCGCAATCA 
Dlx5 -2000 AS CCTACTTGCAGCCTTGGTGT 
Dlx5 R1 AGCTTCCAAGTAGTCGAGG 
Dlx5 R1 AS CAGTTGGACACGCAGCAAGC 
Dlx5 R2 GTGTTGCTCTGCTCCCGAAG 
Dlx5 R2 AS GGGCGGTGGCTGTTCTTCTA 
Dlx6 R1 GCTTCTAAGCACAGGCAACC 
Dlx6 R1 AS TACCTTCCGCAGTTCCAATC 
Dlx6 R2 AGGCCCCGCTCACTATATCT 
Dlx6 R2 AS TGCAGCCACCTTAGCTCTTT 
lkkα CTCAAGTCGGAGAACAAGG 
lkkα AS CTCGAATCCTACCACACTCG 
ΔNp63 AAGTTTTACCTGTCTGTCTCCTGGG 
ΔNp63 AS ATGCTGCTGTCCTTTCTTCTG 

AS, antisense; S, sense.

Close Modal

or Create an Account

Close Modal
Close Modal