Skip to Main Content
Table 1.

Primers for RT-PCR

GeneOrientationSequence (5′ to 3′)
Mouse
 

 

 
GAPDH TGTCAGCAATGCATCCTGCA 
GAPDH AS TGTATGCAGGGATGATGTTC 
ΔNp63 GTTGTACCTGGAAAACAATGCTCAG 
TAp63 GTGGATGAACCTTCCGAAAA 
p63α AS TGATACGCTGCTGCTTGTTGCG 
p63β AS CTTGCCAAATCCTGACAATGCTGC 
p63γ
 
AS
 
CTCCACAAGCTCATTCCTGAAGC
 
Human
 

 

 
GAPDH TCACCAGGGCTGCTTTTAAC 
GAPDH AS TGGAAGATGGTGATGGGATT 
DLX1 TCCAGCCCCTACATCAGTTCG 
DLX1 AS CTGGAACCTCCGGTTCAAAGC 
DLX2 GCACATGGGTTCCTACCAGT 
DLX2 AS ACTTTCTTTGGCTTCCCGTT 
DLX5 CTACAACCGCGTCCCAAG 
DLX5 AS CACCTGTGTTTGTGTCAATCC 
DLX6 CCTCGGACCATTTATTCCAG 
DLX6 AS TTGTTCTGAAACCATATCTTCACC 
GeneOrientationSequence (5′ to 3′)
Mouse
 

 

 
GAPDH TGTCAGCAATGCATCCTGCA 
GAPDH AS TGTATGCAGGGATGATGTTC 
ΔNp63 GTTGTACCTGGAAAACAATGCTCAG 
TAp63 GTGGATGAACCTTCCGAAAA 
p63α AS TGATACGCTGCTGCTTGTTGCG 
p63β AS CTTGCCAAATCCTGACAATGCTGC 
p63γ
 
AS
 
CTCCACAAGCTCATTCCTGAAGC
 
Human
 

 

 
GAPDH TCACCAGGGCTGCTTTTAAC 
GAPDH AS TGGAAGATGGTGATGGGATT 
DLX1 TCCAGCCCCTACATCAGTTCG 
DLX1 AS CTGGAACCTCCGGTTCAAAGC 
DLX2 GCACATGGGTTCCTACCAGT 
DLX2 AS ACTTTCTTTGGCTTCCCGTT 
DLX5 CTACAACCGCGTCCCAAG 
DLX5 AS CACCTGTGTTTGTGTCAATCC 
DLX6 CCTCGGACCATTTATTCCAG 
DLX6 AS TTGTTCTGAAACCATATCTTCACC 

AS, antisense; S, sense.

Close Modal

or Create an Account

Close Modal
Close Modal