Skip to Main Content
Table 1.

Primers for RT-PCR and probe synthesis

PrimerSequence (5′ to 3′)
Real-time RT-PCR primers   
ERECTA sbr ER F GACTGGACAACTTCACCTTCTTCG 
 sbr ER R GAACAGTCACCAATCTCATCAGG 
ERL1 sbr ERL1 F GAACTGCTTCACTCTTGTCAATCTG 
 sbr ERL1 R CATACCTGGCTGGAGCAAAACG 
ERL2 ERL2 3085 CTGTCTGGCAACAATTTCTCA 
 sbr ERL2 R AACACGTACAGATTGGCAAGAC 
ACTIN sbr actin F ATGTCGCCATCCAAGCTGTTCTC 
 sbr actin r CTCCTTGATGTCTCTTACAATTTCC 
PFS2 pfs2 F ATGGGCTACATCTCCAACAA 
 sbr PFS2 R CTTCTAGCGTCGTGATCTGC 
CYCLIN A2;2 sbr CYCA22 F GAGCTAAAAAAGCCATGGGAA 
 sbr CYCA22 R CACCTGATCCATCTTCTTGTTGC 
CYCLIN A2;3 CYCA23 21 GTCTCGGCCATTCACTCG 
 sbr CYCA23 R TTTGGCCTCAAGTATACCTG 
RT-PCR primers   
CYCLIN A2;1 CYCA21 153 GAAGCGTGTTGCTAGACCG 
 CYCA21 347.rc CTACCAAACCATCTTCTTC 
CYCLIN A2;2 CYCA22 597 GCTAAAAAAGCCATGGGAAGA 
 CYCA22 1103.rc TGCTCAGTAATTTCTTCATCTT 
CYCLIN A2;3 CYCA23 21 GTCTCGGCCATTCACTCG 
 CYCA23 359.RC CCTGCTGTATTTGATGCAAC 
CYCLIN A2;4 CYCA24 (−26) TTGGATCGTGTCAAAGGG 
 CYCA24 518.rc ACTTCTCTCAACTGTCCC 
CDKB1;1 cdkb11 610 CAATGGCCGGGTGTTTCC 
 cdkb11 +69.rc TGTCGGAAAGAAAGATAG 
CDKB1;2 cdkb12 615 CAATGGCCGGGTGTAATG 
 cdkb12 +68.rc GAGCAATAAACTTGACGG 
CDKB2;1 cdkb21 (−40) AGAGAGAGAGAGCGCCG 
 cdkb21 352.rc GAATGTTCTTGCCAGTGCT 
CDKB2;2 cdkb22 (−32) GAGAGAAGAGTTGTCTTG 
 cdkb22 358.rc GAATGTTCTGTCCAGCTTG 
ERECTA ER 2248 AAGAAGTCATTCAAAGATGTGA 
 ER3016.rc AGAATTTCCAGGTTTGGAATCTGT 
ERL1 ERL1 2846 TATCCCACCGATACTTGGCA 
 ERL1 4411.rc CCGGAGAGATTGTTGAAGGA 
ERL2 ERL2 3085 CTGTCTGGCAACAATTTCTCA 
 ERL2 4254.rc AGCCATGTCCATGTGAAGAA 
ACTIN 2 act2-1 GCCATCCAAGCTGTTCTCTC 
 act2-2 GCTCGTAGTCAACAGCAACAA 
PFS2 pfs2 F ATGGGCTACATCTCCAACAA 
 pfs2 R TCAGTTCTTCAGAGGCATGA 
In situ hybridization probe primers   
ERECTA ER 7040 GTAAAGATCTCGGTGTGG 
 ER 7467.rc GAAGACACATATTCACACC 
PrimerSequence (5′ to 3′)
Real-time RT-PCR primers   
ERECTA sbr ER F GACTGGACAACTTCACCTTCTTCG 
 sbr ER R GAACAGTCACCAATCTCATCAGG 
ERL1 sbr ERL1 F GAACTGCTTCACTCTTGTCAATCTG 
 sbr ERL1 R CATACCTGGCTGGAGCAAAACG 
ERL2 ERL2 3085 CTGTCTGGCAACAATTTCTCA 
 sbr ERL2 R AACACGTACAGATTGGCAAGAC 
ACTIN sbr actin F ATGTCGCCATCCAAGCTGTTCTC 
 sbr actin r CTCCTTGATGTCTCTTACAATTTCC 
PFS2 pfs2 F ATGGGCTACATCTCCAACAA 
 sbr PFS2 R CTTCTAGCGTCGTGATCTGC 
CYCLIN A2;2 sbr CYCA22 F GAGCTAAAAAAGCCATGGGAA 
 sbr CYCA22 R CACCTGATCCATCTTCTTGTTGC 
CYCLIN A2;3 CYCA23 21 GTCTCGGCCATTCACTCG 
 sbr CYCA23 R TTTGGCCTCAAGTATACCTG 
RT-PCR primers   
CYCLIN A2;1 CYCA21 153 GAAGCGTGTTGCTAGACCG 
 CYCA21 347.rc CTACCAAACCATCTTCTTC 
CYCLIN A2;2 CYCA22 597 GCTAAAAAAGCCATGGGAAGA 
 CYCA22 1103.rc TGCTCAGTAATTTCTTCATCTT 
CYCLIN A2;3 CYCA23 21 GTCTCGGCCATTCACTCG 
 CYCA23 359.RC CCTGCTGTATTTGATGCAAC 
CYCLIN A2;4 CYCA24 (−26) TTGGATCGTGTCAAAGGG 
 CYCA24 518.rc ACTTCTCTCAACTGTCCC 
CDKB1;1 cdkb11 610 CAATGGCCGGGTGTTTCC 
 cdkb11 +69.rc TGTCGGAAAGAAAGATAG 
CDKB1;2 cdkb12 615 CAATGGCCGGGTGTAATG 
 cdkb12 +68.rc GAGCAATAAACTTGACGG 
CDKB2;1 cdkb21 (−40) AGAGAGAGAGAGCGCCG 
 cdkb21 352.rc GAATGTTCTTGCCAGTGCT 
CDKB2;2 cdkb22 (−32) GAGAGAAGAGTTGTCTTG 
 cdkb22 358.rc GAATGTTCTGTCCAGCTTG 
ERECTA ER 2248 AAGAAGTCATTCAAAGATGTGA 
 ER3016.rc AGAATTTCCAGGTTTGGAATCTGT 
ERL1 ERL1 2846 TATCCCACCGATACTTGGCA 
 ERL1 4411.rc CCGGAGAGATTGTTGAAGGA 
ERL2 ERL2 3085 CTGTCTGGCAACAATTTCTCA 
 ERL2 4254.rc AGCCATGTCCATGTGAAGAA 
ACTIN 2 act2-1 GCCATCCAAGCTGTTCTCTC 
 act2-2 GCTCGTAGTCAACAGCAACAA 
PFS2 pfs2 F ATGGGCTACATCTCCAACAA 
 pfs2 R TCAGTTCTTCAGAGGCATGA 
In situ hybridization probe primers   
ERECTA ER 7040 GTAAAGATCTCGGTGTGG 
 ER 7467.rc GAAGACACATATTCACACC 
Close Modal

or Create an Account

Close Modal
Close Modal