Skip to Main Content
Table 1.

List of PCR primers used in the amplification of opsin sequences

PrimerPrimer sequence 5′-3′
VSWS1F TGGGCCTTYTACCTNCARRCNGCCTTYATGGG 
VSWS1R GCTCTTRGAGAARAASGCVGGGATGGTGAC 
5′ RACE adaptor primer GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG 
P.borch SWS1F TTATACAGTCGGAGGTCACGATGGGGAAG 
P.borch SWS1R CATCCTTTAATCAGTCGTCATTTTGTCCCATCG 
D.mawsUVF GCGCGAATTCCACCATGGGGAAGGACTTCCAC 
D.mawsUVR CGGCGTCGACGCAGACACTGAGGACACCTC 
D.mawsGF GCGCGAATTCCACCATGGAGACCAATGGCACAG 
D.mawsGR CGGCGTCGACGCAGACACAGAGGACACTTCTG 
Blue400F YYGTGGTCTCTKGCTGT 
Blue818R CCAGCATACCAAGAAGCC 
T.loen3′I GCAGAGTCTGCCTCCACC 
MZbluestop CTAWGCAGGYSCCYACTTTRG 
T.loenF CGGATGGAGCAGGTAC 
T.loenR GGTGGAGGCAGACTCTGC 
Green1F ATGAAYGGCTGARGGMAA 
Green596R CATATGATTCATTGTTGTAGCC 
Green3′O TCCAGATACATTCCTGAGGG 
Green3′I GCTGGAATTGGTGTTGGGA 
GreenWkO CTAGAAGCTTGAACATGATGGG 
GreenWkI TAAGGACTTCTAACAATCCC 
UNI33 (T)15GTTTGTTGT(G)7TT 
UNI17 TTTTTGTTTGTTGTGGG 
PrimerPrimer sequence 5′-3′
VSWS1F TGGGCCTTYTACCTNCARRCNGCCTTYATGGG 
VSWS1R GCTCTTRGAGAARAASGCVGGGATGGTGAC 
5′ RACE adaptor primer GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG 
P.borch SWS1F TTATACAGTCGGAGGTCACGATGGGGAAG 
P.borch SWS1R CATCCTTTAATCAGTCGTCATTTTGTCCCATCG 
D.mawsUVF GCGCGAATTCCACCATGGGGAAGGACTTCCAC 
D.mawsUVR CGGCGTCGACGCAGACACTGAGGACACCTC 
D.mawsGF GCGCGAATTCCACCATGGAGACCAATGGCACAG 
D.mawsGR CGGCGTCGACGCAGACACAGAGGACACTTCTG 
Blue400F YYGTGGTCTCTKGCTGT 
Blue818R CCAGCATACCAAGAAGCC 
T.loen3′I GCAGAGTCTGCCTCCACC 
MZbluestop CTAWGCAGGYSCCYACTTTRG 
T.loenF CGGATGGAGCAGGTAC 
T.loenR GGTGGAGGCAGACTCTGC 
Green1F ATGAAYGGCTGARGGMAA 
Green596R CATATGATTCATTGTTGTAGCC 
Green3′O TCCAGATACATTCCTGAGGG 
Green3′I GCTGGAATTGGTGTTGGGA 
GreenWkO CTAGAAGCTTGAACATGATGGG 
GreenWkI TAAGGACTTCTAACAATCCC 
UNI33 (T)15GTTTGTTGT(G)7TT 
UNI17 TTTTTGTTTGTTGTGGG 

Underlined bases identify EcoRI and SalI restriction enzyme sites for cloning into the expression vector pMT.

Close Modal

or Create an Account

Close Modal
Close Modal