Skip to Main Content
Table 1.

Sequence of primers used in RT-PCR analyses and genotyping

GeneSense primerAntisense primer
hDBH-Gata3 AGT GAC CAG CTA CAG TCG GA GGA GAG GGG TCG TTT AAT GG 
Gata3 GGT GGA CGT ACT TTT TAA CAT CGA CCC TGA CGG AGT TTC CGT AG 
Th AGT TCT CCC AGG ACA TTG GAC TT ACA CAG CCC AAA CTC CAC AGT 
Dbh GAC CCA CCT TGT GAG AAG CTA TTC GGA GGG CTA CAC AGA GCT GG 
Hand2 CGA GTG CAT CCC CAA CGT CCA GGC GCA GTG TCT TGA T 
Phox2b CGC CAT TAG CGC AAC TGA CGG CTG CGA AGA TTA GGG 
Mash 1 AACCGGGTCAAGTTGGTCAA CGTCTCCACCTTGCTCATCTTC 
Sf1 GTA CGG CAA GGA AGA CAG CAT CCA CCA GGC ACA ATA GCA ACT 
Gapdh CCT GCA CCA CCA ACT GCT TA TCA TGA GCC CTT CCA CAA TG 
GeneSense primerAntisense primer
hDBH-Gata3 AGT GAC CAG CTA CAG TCG GA GGA GAG GGG TCG TTT AAT GG 
Gata3 GGT GGA CGT ACT TTT TAA CAT CGA CCC TGA CGG AGT TTC CGT AG 
Th AGT TCT CCC AGG ACA TTG GAC TT ACA CAG CCC AAA CTC CAC AGT 
Dbh GAC CCA CCT TGT GAG AAG CTA TTC GGA GGG CTA CAC AGA GCT GG 
Hand2 CGA GTG CAT CCC CAA CGT CCA GGC GCA GTG TCT TGA T 
Phox2b CGC CAT TAG CGC AAC TGA CGG CTG CGA AGA TTA GGG 
Mash 1 AACCGGGTCAAGTTGGTCAA CGTCTCCACCTTGCTCATCTTC 
Sf1 GTA CGG CAA GGA AGA CAG CAT CCA CCA GGC ACA ATA GCA ACT 
Gapdh CCT GCA CCA CCA ACT GCT TA TCA TGA GCC CTT CCA CAA TG 
Close Modal

or Create an Account

Close Modal
Close Modal