Skip to Main Content
Table 1.

Primers used in this study

Target geneNamePrimer sequence (5′ to 3′) or Qiagen catalog number
Pax6 CCTGGTTGGTATCCCGGGA 
 CCGCTTCAGCTGAAGTCGCA 
Pax6-5a CACAGCGGAGTGAATCAGCTT 
 GCACCTGGACTTTTGCATCTG 
N-CAM ATTGTCATCTTCGTCCTGCTCC 
 TCCTCCATGTCTTTGCCCTTG 
Itga5 GGATTCTGGAGTCCTCACTGTA 
 GTACTCCAGAATCCGGGTGAA 
R-cadherin CTATGGTGCGGCTGCTGGTA 
 GGAGTTCTCGGGAACGTTGAT 
Pxn CCGGCTGTTACTGGAGCTGAA 
 GGAACTCTCCAGTTCATCCAAGA 
Tnc GCAACCAAGGACAATGTGTGTCA 
 CTCCCGAATGGTGGTGGATGT 
18S QT01036875 
  
Itgb3 QT00128849 
  
 JoP6F CCTGGGCAACGTGCTGGTTATTGTGCTG 
 JoP6R CACAACCGTTGGATACCTGCAGAATTCGG 
 JoP65aR GTCGCCACTCTTGGCTTACTCCCTCCG 
Target geneNamePrimer sequence (5′ to 3′) or Qiagen catalog number
Pax6 CCTGGTTGGTATCCCGGGA 
 CCGCTTCAGCTGAAGTCGCA 
Pax6-5a CACAGCGGAGTGAATCAGCTT 
 GCACCTGGACTTTTGCATCTG 
N-CAM ATTGTCATCTTCGTCCTGCTCC 
 TCCTCCATGTCTTTGCCCTTG 
Itga5 GGATTCTGGAGTCCTCACTGTA 
 GTACTCCAGAATCCGGGTGAA 
R-cadherin CTATGGTGCGGCTGCTGGTA 
 GGAGTTCTCGGGAACGTTGAT 
Pxn CCGGCTGTTACTGGAGCTGAA 
 GGAACTCTCCAGTTCATCCAAGA 
Tnc GCAACCAAGGACAATGTGTGTCA 
 CTCCCGAATGGTGGTGGATGT 
18S QT01036875 
  
Itgb3 QT00128849 
  
 JoP6F CCTGGGCAACGTGCTGGTTATTGTGCTG 
 JoP6R CACAACCGTTGGATACCTGCAGAATTCGG 
 JoP65aR GTCGCCACTCTTGGCTTACTCCCTCCG 
Close Modal

or Create an Account

Close Modal
Close Modal