Skip to Main Content
Table 2.

Antisense morpholinos used in this study

Gene/MO nameLocationSequence
fezl/sp1 Intron1-Exon2 AGACCTTTAAAAGAATAGAAACTGC 
fezl/sp3 Exon2-Intron2 TATTTTAACCTACCTGTGTGTGAAT 
otpb/sp2 Intron1-Exon2 TGCAGCATCCTTCATCCCTGTGGAC 
otpa Exon2-Intron2 ATCAGACTGCACCGCACTCACCTGC 
pac1 ATG-Start TCACTGTGGAAGCCATTTTGTCTGG 
pacap1b ATG-Start GCCATGCTATTGCAGAGTAGGTAGA 
Gene/MO nameLocationSequence
fezl/sp1 Intron1-Exon2 AGACCTTTAAAAGAATAGAAACTGC 
fezl/sp3 Exon2-Intron2 TATTTTAACCTACCTGTGTGTGAAT 
otpb/sp2 Intron1-Exon2 TGCAGCATCCTTCATCCCTGTGGAC 
otpa Exon2-Intron2 ATCAGACTGCACCGCACTCACCTGC 
pac1 ATG-Start TCACTGTGGAAGCCATTTTGTCTGG 
pacap1b ATG-Start GCCATGCTATTGCAGAGTAGGTAGA 
Close Modal

or Create an Account

Close Modal
Close Modal