Skip to Main Content
Table 1.

Probes and real-time PCR primers used in this study

Probe sizePrimersGenBank accession no.Gene
500 bp Forward, CTCCGCAAGCTCTCGGTGTC   
 Reverse, CTGCACTAATGTACAGTCAAGC NM_178291 isotocin (it) 
550 bp Forward, GCAAAGAGAACTTACCCGACG   
 Reverse, CAACATTCTTTCCGATGACAC NM_183070 somatostatin1 (ss1) 
450 bp Forward, AATGCGCCTCTGTCGACATTG   
 Reverse, ACTGCTCACATCCTGTGGTACCG AF025305 hypocretin (hcrt; also known as orexin) 
1325 bp Forward, GGGAGCTGCCCTGGATCCACT   
 Reverse, TCAAACCACCAGCCAGTGATGGAG AF318177 dat 
722 bp Forward, CACTACAAACCTCAAGTATTC   
 Reverse, CCCACTTAACAATCATTG NM_131100 otpb 
307 bp Forward, GACGTGCCGTTTCACCTC   
 Reverse, CGAGTGCACCTTGTTTCT XP_683186 otpa 
1260 bp Forward, ATGGCTTCCACAGTGAGAAAATGTC   
 Reverse, CTGAAAAGACCCAAGACCGAGCTC CR853299 pac1 
400 bp Forward, GAAGTCCTCCATCTCTTACGG   
 Reverse, ATCTTTAGGACTGAATGTACAC NM_214715 pacap1b (also known as adcyap1b
65 bp Forward, AATCGCGAGTGCAGGTCTG   
 Reverse, GGTGGTCTTCTTGCGCTTCTT XM_215445 Otp (rat) 
70 bp Forward, TGACCGAGCGTGGCTACA   
 Reverse, CAGCTTCTCTTTAATGTCACGCA NM_031144 Actb (rat) 
Probe sizePrimersGenBank accession no.Gene
500 bp Forward, CTCCGCAAGCTCTCGGTGTC   
 Reverse, CTGCACTAATGTACAGTCAAGC NM_178291 isotocin (it) 
550 bp Forward, GCAAAGAGAACTTACCCGACG   
 Reverse, CAACATTCTTTCCGATGACAC NM_183070 somatostatin1 (ss1) 
450 bp Forward, AATGCGCCTCTGTCGACATTG   
 Reverse, ACTGCTCACATCCTGTGGTACCG AF025305 hypocretin (hcrt; also known as orexin) 
1325 bp Forward, GGGAGCTGCCCTGGATCCACT   
 Reverse, TCAAACCACCAGCCAGTGATGGAG AF318177 dat 
722 bp Forward, CACTACAAACCTCAAGTATTC   
 Reverse, CCCACTTAACAATCATTG NM_131100 otpb 
307 bp Forward, GACGTGCCGTTTCACCTC   
 Reverse, CGAGTGCACCTTGTTTCT XP_683186 otpa 
1260 bp Forward, ATGGCTTCCACAGTGAGAAAATGTC   
 Reverse, CTGAAAAGACCCAAGACCGAGCTC CR853299 pac1 
400 bp Forward, GAAGTCCTCCATCTCTTACGG   
 Reverse, ATCTTTAGGACTGAATGTACAC NM_214715 pacap1b (also known as adcyap1b
65 bp Forward, AATCGCGAGTGCAGGTCTG   
 Reverse, GGTGGTCTTCTTGCGCTTCTT XM_215445 Otp (rat) 
70 bp Forward, TGACCGAGCGTGGCTACA   
 Reverse, CAGCTTCTCTTTAATGTCACGCA NM_031144 Actb (rat) 
Close Modal

or Create an Account

Close Modal
Close Modal