Skip to Main Content
Table 1.

PCR oligonucleotides

GeneForward primer (5′-3′)Reverse primer (5′-3′)
Foxp1 CAGGCAGATCCCCTATGCAA GGACAGAGGGCCTTCAGCTT 
Foxp4 CAGCCCGCCTCGTCTTT CCGGCCGTCGGTCTTC 
Sp-A (Sftpa1) CTCCAGACCTGTGCCCATATG ACCTCCAGTCATGGCACAGTAA 
SP-B (Sftpb) ACGTCCTCTGGAAGCCTTCA TGTCTTCTTGGAGCCACAACAG 
SP-C (Sftpc) ACCCTGTGTGGAGAGCTACCA TTTGCGGAGGGTCTTTCCT 
CC10 (Scgb1a1) TCCTAACAAGTCCTCTGTGTAAGA AGGAGACACAGGGCAGTGACA 
aquaporin 5 ATGAACCCAGCCCGATCTTT ACGATCGGTCCTACCCAGAAG 
T1alpha (Pdpn) AGGTACAGGAGACGGCATGGT CCAGAGGTGCCTTGCCAGTA 
N-myc (Mycn) ACAAGGCGGTAACCACTTTCA AACACAGCGCTTGAGGATCA 
Hop (Hod) GGAGTACAACTTCAACAAGGTCACA GCGCTGCTTAAACCATTTCTG 
Nkx2.1 (Titf1) TCCAGCCTATCCCATCTGAACT CAAGCGCATCTCACGTCTCA 
T1alpha* ACGTGCCTTGCATGAAGGTTC CACGTGCAGTAAACAGTTCTG 
GeneForward primer (5′-3′)Reverse primer (5′-3′)
Foxp1 CAGGCAGATCCCCTATGCAA GGACAGAGGGCCTTCAGCTT 
Foxp4 CAGCCCGCCTCGTCTTT CCGGCCGTCGGTCTTC 
Sp-A (Sftpa1) CTCCAGACCTGTGCCCATATG ACCTCCAGTCATGGCACAGTAA 
SP-B (Sftpb) ACGTCCTCTGGAAGCCTTCA TGTCTTCTTGGAGCCACAACAG 
SP-C (Sftpc) ACCCTGTGTGGAGAGCTACCA TTTGCGGAGGGTCTTTCCT 
CC10 (Scgb1a1) TCCTAACAAGTCCTCTGTGTAAGA AGGAGACACAGGGCAGTGACA 
aquaporin 5 ATGAACCCAGCCCGATCTTT ACGATCGGTCCTACCCAGAAG 
T1alpha (Pdpn) AGGTACAGGAGACGGCATGGT CCAGAGGTGCCTTGCCAGTA 
N-myc (Mycn) ACAAGGCGGTAACCACTTTCA AACACAGCGCTTGAGGATCA 
Hop (Hod) GGAGTACAACTTCAACAAGGTCACA GCGCTGCTTAAACCATTTCTG 
Nkx2.1 (Titf1) TCCAGCCTATCCCATCTGAACT CAAGCGCATCTCACGTCTCA 
T1alpha* ACGTGCCTTGCATGAAGGTTC CACGTGCAGTAAACAGTTCTG 
*

Used for ChIP (all other primer sets were used for Q-PCR).

Close Modal

or Create an Account

Close Modal
Close Modal