Skip to Main Content
Table 1.

Primer pairs used for quantitative real-time PCR

GeneGenBank Accession numberPrimerPrimer sequence (5′→3′)Amplicon size (bp)
Jag1 AF171092 Forward CACTTATTGCTGCGGTTGCA 51 
  Reverse TTTTCAGAGGACGCCTCTGAAC  
Lfng U94351 Forward CCACCCTCTGATGCCCTATC 51 
  Reverse GCTCTGAACCCCACTTGGTGT  
Hes5 D32132 Forward ATTTCAGCAAGTGACTTCTGCG 51 
  Reverse ATAGAACCCCCGGTGGTGAC  
Myosin Vlla U81453 Forward CTGCCACGAGGTCCAGACTC 51 
  Reverse GCAAACCCAGATGCCATAGGT  
COUP-TFI U07625 Forward CAGCCCAGCCGCTTTG 51 
  Reverse TGTGCGAAGAGAGGGCAATC  
COUP-TFII NM_009697 Forward AGAAGGAACTGTGGAATTTATTGGC 51 
  Reverse TTGTGTCTTGGACACATTCCTTG  
Gapdh M32599 Forward AACGACCCCTTCATTGAC 191 
  Reverse TCCACGACATACTCAGCAC  
GeneGenBank Accession numberPrimerPrimer sequence (5′→3′)Amplicon size (bp)
Jag1 AF171092 Forward CACTTATTGCTGCGGTTGCA 51 
  Reverse TTTTCAGAGGACGCCTCTGAAC  
Lfng U94351 Forward CCACCCTCTGATGCCCTATC 51 
  Reverse GCTCTGAACCCCACTTGGTGT  
Hes5 D32132 Forward ATTTCAGCAAGTGACTTCTGCG 51 
  Reverse ATAGAACCCCCGGTGGTGAC  
Myosin Vlla U81453 Forward CTGCCACGAGGTCCAGACTC 51 
  Reverse GCAAACCCAGATGCCATAGGT  
COUP-TFI U07625 Forward CAGCCCAGCCGCTTTG 51 
  Reverse TGTGCGAAGAGAGGGCAATC  
COUP-TFII NM_009697 Forward AGAAGGAACTGTGGAATTTATTGGC 51 
  Reverse TTGTGTCTTGGACACATTCCTTG  
Gapdh M32599 Forward AACGACCCCTTCATTGAC 191 
  Reverse TCCACGACATACTCAGCAC  
Close Modal

or Create an Account

Close Modal
Close Modal