Skip to Main Content
Table 1.

Primers used in this study

Primer nameSequence 5′→3′
miR164A-2 TCAATGCGTTACATATGCTG 
miR164A-3 CCATGCCATAGAGTAGATGC 
miR164B-1 TTTTTGGGTAGCATGTTCAT 
miR164B-2 CGCTAACCGAAACTATGTTC 
STM-1 GTATAATTTGATAAATATTCACTTTGTGTTTCGTC 
STM-2 TCACTAGTATTATTATTCACTTTGGCTTTGCTATA 
CUC1-RT1 AACGCCACGCCATCACCGAC 
CUC1-RT2 TGCATGAGTATCGCCTTGAC 
CUC2-RT1 AGGCCGTAGTAGTAGTAGGG 
CUC2-RT2 TGAAGGCAAATTCTCTTACC 
CUC3-RT1 GAGAGACGACAGGGTTGATT 
CUC3-RT2 TGGCCTCAAGACTAAGTGG 
At5g61430-RT1 AGAACCGGGCTCTGTAGATT 
At5g61430-RT2 TTCTCTGCCCATAACTTGCCG 
At5g07680-RT1 GATTGGAACTCTCGGAAATG 
At5g07680-RT2 GTGATGCATGAGTATAGGCTAGAT 
NAC1-RT1 GGGTTAGGGTTCTTGCATGG 
NAC1-RT2 CGAGGCCGTAAAACCGAT 
APT-RT1 CCTTTCCCTTAAGCTCTG 
APT-RT2 TCCCAGAATCGCTAAGATTGCC 
Primer nameSequence 5′→3′
miR164A-2 TCAATGCGTTACATATGCTG 
miR164A-3 CCATGCCATAGAGTAGATGC 
miR164B-1 TTTTTGGGTAGCATGTTCAT 
miR164B-2 CGCTAACCGAAACTATGTTC 
STM-1 GTATAATTTGATAAATATTCACTTTGTGTTTCGTC 
STM-2 TCACTAGTATTATTATTCACTTTGGCTTTGCTATA 
CUC1-RT1 AACGCCACGCCATCACCGAC 
CUC1-RT2 TGCATGAGTATCGCCTTGAC 
CUC2-RT1 AGGCCGTAGTAGTAGTAGGG 
CUC2-RT2 TGAAGGCAAATTCTCTTACC 
CUC3-RT1 GAGAGACGACAGGGTTGATT 
CUC3-RT2 TGGCCTCAAGACTAAGTGG 
At5g61430-RT1 AGAACCGGGCTCTGTAGATT 
At5g61430-RT2 TTCTCTGCCCATAACTTGCCG 
At5g07680-RT1 GATTGGAACTCTCGGAAATG 
At5g07680-RT2 GTGATGCATGAGTATAGGCTAGAT 
NAC1-RT1 GGGTTAGGGTTCTTGCATGG 
NAC1-RT2 CGAGGCCGTAAAACCGAT 
APT-RT1 CCTTTCCCTTAAGCTCTG 
APT-RT2 TCCCAGAATCGCTAAGATTGCC 
Close Modal

or Create an Account

Close Modal
Close Modal