Skip to Main Content
Table 1.

Primers used to generate expression constructs

Primer nameSequence
5′XOtx2 GGGAATTCGATCAAACACGAGCATGATGT 
3′XOtx2 GGGAATTCTTCACAAAACCTGGAATTTC 
5′ClaX2 GGATCGATGATCAAACACGAGCATGATGTC 
3′ClaX2 GGATCGATTCTCACTTTGTTTTGGCCTCC 
5′Cla GGATCGATGATACTTGGTCACTGAAATGAT 
3′Cla CCATCGATTCGAGGCTTAGCTTGTCCAG 
Primer nameSequence
5′XOtx2 GGGAATTCGATCAAACACGAGCATGATGT 
3′XOtx2 GGGAATTCTTCACAAAACCTGGAATTTC 
5′ClaX2 GGATCGATGATCAAACACGAGCATGATGTC 
3′ClaX2 GGATCGATTCTCACTTTGTTTTGGCCTCC 
5′Cla GGATCGATGATACTTGGTCACTGAAATGAT 
3′Cla CCATCGATTCGAGGCTTAGCTTGTCCAG 

Bold letters indicate restriction enzyme sites used for cloning.

Close Modal

or Create an Account

Close Modal
Close Modal