Skip to Main Content
Table 1.

Details of primers used in RT-PCR

ProteinPrimers (5′→3′)Product length (bp)Tm (°C)GenBank Accession Number
P2Y1 CCTGCGAAGTTATTTCATCTA 319 55 AK036611 
 GTTGAGACTTGCTAGACCTCT    
P2Y2 TCTGCTTCCTGCCTTTCCAC 309 56 NM_008773 
 TCCGTCTTGAGTCGTCACTG    
P2Y4 AGCCCAAGTTCTGGAGATGGTG 492 56 NM_020621 
 GGTGGTTCCATTGGCATTGG    
P2Y6 ATCAGCTTCCTGCCTTTCC 214 56 NM_183168 
 CTGTGAGCCTCTGTAAGAGATCG    
BiP ACACTTGGTATTGAAACTG 560 52 NM_022310 
 GTGGCTTTCCAGCCATTC    
GAPDH AACGACCCCTTCATTGACC 197 55 NM_008084 
 GTAGACTCCACGACATACTCAGC    
NTPDase2 AAGACAGATATGCCAGCACTCC 635 62 NM_009849 
TNAP AAGGGCCAGCTACACCACAACACG 267 54 NM_007431 
 GCCCACGGACTTCCCAGCATC    
ProteinPrimers (5′→3′)Product length (bp)Tm (°C)GenBank Accession Number
P2Y1 CCTGCGAAGTTATTTCATCTA 319 55 AK036611 
 GTTGAGACTTGCTAGACCTCT    
P2Y2 TCTGCTTCCTGCCTTTCCAC 309 56 NM_008773 
 TCCGTCTTGAGTCGTCACTG    
P2Y4 AGCCCAAGTTCTGGAGATGGTG 492 56 NM_020621 
 GGTGGTTCCATTGGCATTGG    
P2Y6 ATCAGCTTCCTGCCTTTCC 214 56 NM_183168 
 CTGTGAGCCTCTGTAAGAGATCG    
BiP ACACTTGGTATTGAAACTG 560 52 NM_022310 
 GTGGCTTTCCAGCCATTC    
GAPDH AACGACCCCTTCATTGACC 197 55 NM_008084 
 GTAGACTCCACGACATACTCAGC    
NTPDase2 AAGACAGATATGCCAGCACTCC 635 62 NM_009849 
TNAP AAGGGCCAGCTACACCACAACACG 267 54 NM_007431 
 GCCCACGGACTTCCCAGCATC    
Close Modal

or Create an Account

Close Modal
Close Modal