Skip to Main Content
Table 1.

Primers and conditions used for real-time RT-PCR

GeneReferencePrimer sequences (upstream/downstream)Melting temperature (°C)Annealing temperature (°C)/time (seconds)Extension temperature (°C)/time (seconds)Acquisition temperatures (°C)/time (seconds)
Activin B Kofron et al. (1999) 5′ CAACCTGTGGCTGTACCTGAAG 3′ 95 55/5 72/14 86/3 
  5′ GCACTCGAGGCCTCTCTTACGGA 3′     
Cerberus Darras et al. (1997) 5′ GCTTGCAAAACCTTGCCCTT 3′ 95 60/5 72/20 81/3 
  5′ CTGATGGAACAGAGATCTTG 3′     
Chordin Kofron et al. (1999) 5′ AACTGCCAGGACTGGATGGT 3′ 95 55/5 72/12 81/3 
  5′ GGCAGGATTTAGAGTTGCTTC 3′     
Der Sun et al. (1999) 5′ TGGCAGAGTTGTGGCTATCA 3′ 95 55/5 72/18 82/3 
  5′ CTATGGCTGCTATGGTTCCTT 3′     
Gsc This paper 5′ TGGCAAGGAGGGTTCATCTCAGAG 3′ 95 58/5 72/8 78/3 
  5′ ATCCAGCTATCCCAATGTGCAAGT 3′     
ODC Heasman et al. (2000) 5′ GCCATTGTGAAGACTCTCTCCAATC 3′ 95 55/5 72/12 82/3 
  5′ TTCGGGTGATTCCTTGCCAC 3′     
Xbra Kofron et al. (1999) 5′ TTCTGAAGGTGAGCATGTCG 3′ 95 55/5 72/8 75/3 
  5′ GTTTGACTTTGCTAAAAGAGACAGG 3′     
Xhex Chang and Hemmati-Brivanlou(2000) 5′ AACAGCGCATCTAATGGGAC 3′ 95 60/5 72/13 87/3 
  5′ CCTTTCCGCTTGTGCAGAGG 3′     
Xnot This paper 5′ ATACATGGTTGGCACTGA 3′ 95 50/5 72/8 72/3 
  5′ CTCCTACAGTTCCACATC 3′     
Xnr1 Kofron et al. (1999) 5′ TGGCCAGATAGAGTAGAG 3′ 95 55/5 72/12 81/3 
  5′ TCCAACGGTTCTCACTTT 3′     
Xnr2 Kofron et al. (1999) 5′ GTCTTCTATATCCAGCAGCAAT 3′ 95 55/5 72/11 81/3 
  5′ TTGATGGAGATAATACTGGAGC 3′     
Xnr4 Kofron et al. (1999) 5′ ACTTGGCTGCTCTACCTC 3′ 95 55/5 72/12 82/3 
  5′ CAGCAAGTTGATGTTCTTCC 3′     
Xnr5 This paper 5′ TCCATTGTTACTCCAGGTTCC 3′ 95 55/5 72/12 81/3 
  5′ AAGCCGCTTCTTATGATGC 3′     
Xnr6 This paper 5′ CAATGAGTTGAATTTGGCTGAG 3′ 95 55/5 72/12 81/3 
  5′ GTTTGTCTTTAGCGAACACCAC 3′     
Xvent1 This paper 5′ TGGTTCAACAGGGATTCTC 3′ 95 54/5 72/8 80/3 
  5′ CTGCTAAGGAAGGATTTGC 3′     
Xwnt8 Ding et al. (1998) 5′ CTGATGCCTTCAGTTCTGTGG 3′ 95 58/6 72/14 85/3 
  5′ CTACCTGTTTGCATTGCTCGC 3′     
GeneReferencePrimer sequences (upstream/downstream)Melting temperature (°C)Annealing temperature (°C)/time (seconds)Extension temperature (°C)/time (seconds)Acquisition temperatures (°C)/time (seconds)
Activin B Kofron et al. (1999) 5′ CAACCTGTGGCTGTACCTGAAG 3′ 95 55/5 72/14 86/3 
  5′ GCACTCGAGGCCTCTCTTACGGA 3′     
Cerberus Darras et al. (1997) 5′ GCTTGCAAAACCTTGCCCTT 3′ 95 60/5 72/20 81/3 
  5′ CTGATGGAACAGAGATCTTG 3′     
Chordin Kofron et al. (1999) 5′ AACTGCCAGGACTGGATGGT 3′ 95 55/5 72/12 81/3 
  5′ GGCAGGATTTAGAGTTGCTTC 3′     
Der Sun et al. (1999) 5′ TGGCAGAGTTGTGGCTATCA 3′ 95 55/5 72/18 82/3 
  5′ CTATGGCTGCTATGGTTCCTT 3′     
Gsc This paper 5′ TGGCAAGGAGGGTTCATCTCAGAG 3′ 95 58/5 72/8 78/3 
  5′ ATCCAGCTATCCCAATGTGCAAGT 3′     
ODC Heasman et al. (2000) 5′ GCCATTGTGAAGACTCTCTCCAATC 3′ 95 55/5 72/12 82/3 
  5′ TTCGGGTGATTCCTTGCCAC 3′     
Xbra Kofron et al. (1999) 5′ TTCTGAAGGTGAGCATGTCG 3′ 95 55/5 72/8 75/3 
  5′ GTTTGACTTTGCTAAAAGAGACAGG 3′     
Xhex Chang and Hemmati-Brivanlou(2000) 5′ AACAGCGCATCTAATGGGAC 3′ 95 60/5 72/13 87/3 
  5′ CCTTTCCGCTTGTGCAGAGG 3′     
Xnot This paper 5′ ATACATGGTTGGCACTGA 3′ 95 50/5 72/8 72/3 
  5′ CTCCTACAGTTCCACATC 3′     
Xnr1 Kofron et al. (1999) 5′ TGGCCAGATAGAGTAGAG 3′ 95 55/5 72/12 81/3 
  5′ TCCAACGGTTCTCACTTT 3′     
Xnr2 Kofron et al. (1999) 5′ GTCTTCTATATCCAGCAGCAAT 3′ 95 55/5 72/11 81/3 
  5′ TTGATGGAGATAATACTGGAGC 3′     
Xnr4 Kofron et al. (1999) 5′ ACTTGGCTGCTCTACCTC 3′ 95 55/5 72/12 82/3 
  5′ CAGCAAGTTGATGTTCTTCC 3′     
Xnr5 This paper 5′ TCCATTGTTACTCCAGGTTCC 3′ 95 55/5 72/12 81/3 
  5′ AAGCCGCTTCTTATGATGC 3′     
Xnr6 This paper 5′ CAATGAGTTGAATTTGGCTGAG 3′ 95 55/5 72/12 81/3 
  5′ GTTTGTCTTTAGCGAACACCAC 3′     
Xvent1 This paper 5′ TGGTTCAACAGGGATTCTC 3′ 95 54/5 72/8 80/3 
  5′ CTGCTAAGGAAGGATTTGC 3′     
Xwnt8 Ding et al. (1998) 5′ CTGATGCCTTCAGTTCTGTGG 3′ 95 58/6 72/14 85/3 
  5′ CTACCTGTTTGCATTGCTCGC 3′     
Close Modal

or Create an Account

Close Modal
Close Modal