Skip to Main Content
Table 1.

Sequences of synthetic polynucleotides used as templates for generation of standard curves, primers and GenBank references used for mRNA quantification of α1a, α1b, α1c3 and β1 subunit isoforms of the Salmo salar Na+,K+–ATPase

TranscriptcDNA sequence (5′-3′) used for quantification*Primers 5′-3′Reference
α1a TTCCAAAGGCAAATGGGTTTAATATCATTGTAAAAATGAACGATTCATTACAA F: CCCAGGATCACTCAATGTCAC O. mykiss
 GGCAATACTGCAGCAGAGTGACATTGAGTGATCCTGGGACGGCCTC R: CCAAAGGCAAATGGGTTTAAT AY319391 
α1b GCAGCTGAGTGCACCATCACAGTGTTCATTGGATGTAATGATAAGGTAGCAT F: CTGCTACATCTCAACCAACAACATT O. mykiss
 ATTGAAATGTAGTGT AATGTTGTTGGTTGAGATGTAGCAG CAGAGTG R: CACCATCACAGTGTTCATTGGAT AY319390 
α1c CAGAACTTAAAATTCCGAG CAGCAAGACAACCATGCAAGAACTTGAGCGATG F: GAGAGGGAGACGTACTACTAGAAAGCA O. mykiss
 CAAACGGGATGCTTTCTAGTAGTACGTCTCCCTCTCCACCCAACCTC R: CAGCAAGACAACCATGCAAGA AY319389 
α3 CTTGTGGGTATCAGGCTCAACT GGGACGACCGCGCTTGCAACGACCTGGA F: TCCACGATCTTCCTCTGTTCA S. salar
 AGACAGCTATGGCCAGCAATGGACATA TGAACAGAGGAAGATCGTGGAG R: TTGTGGGTATCAGGCTCAACT CX355357 
β1 TTACCGGCGTCCTCCTCTCTCTTGTTGGTGCAAAAGATGGGCATGACGTTG F: CCAATGAAAGCATCCCTAG S. salar
 GGCTGGACCTTGGTCTGCGCTCCCTCAGGGATGCTTTCATTGGAGCTG R: GGCGTCCTCCTCTCTCTTGT AJ250810 
TranscriptcDNA sequence (5′-3′) used for quantification*Primers 5′-3′Reference
α1a TTCCAAAGGCAAATGGGTTTAATATCATTGTAAAAATGAACGATTCATTACAA F: CCCAGGATCACTCAATGTCAC O. mykiss
 GGCAATACTGCAGCAGAGTGACATTGAGTGATCCTGGGACGGCCTC R: CCAAAGGCAAATGGGTTTAAT AY319391 
α1b GCAGCTGAGTGCACCATCACAGTGTTCATTGGATGTAATGATAAGGTAGCAT F: CTGCTACATCTCAACCAACAACATT O. mykiss
 ATTGAAATGTAGTGT AATGTTGTTGGTTGAGATGTAGCAG CAGAGTG R: CACCATCACAGTGTTCATTGGAT AY319390 
α1c CAGAACTTAAAATTCCGAG CAGCAAGACAACCATGCAAGAACTTGAGCGATG F: GAGAGGGAGACGTACTACTAGAAAGCA O. mykiss
 CAAACGGGATGCTTTCTAGTAGTACGTCTCCCTCTCCACCCAACCTC R: CAGCAAGACAACCATGCAAGA AY319389 
α3 CTTGTGGGTATCAGGCTCAACT GGGACGACCGCGCTTGCAACGACCTGGA F: TCCACGATCTTCCTCTGTTCA S. salar
 AGACAGCTATGGCCAGCAATGGACATA TGAACAGAGGAAGATCGTGGAG R: TTGTGGGTATCAGGCTCAACT CX355357 
β1 TTACCGGCGTCCTCCTCTCTCTTGTTGGTGCAAAAGATGGGCATGACGTTG F: CCAATGAAAGCATCCCTAG S. salar
 GGCTGGACCTTGGTCTGCGCTCCCTCAGGGATGCTTTCATTGGAGCTG R: GGCGTCCTCCTCTCTCTTGT AJ250810 

The sequence of each synthetic polynucleotides was based on the corresponding reverse strand, anti-sense gene sequence listed as reference. *Shaded areas of the polynucleotide sequences indicate primer regions

Close Modal

or Create an Account

Close Modal
Close Modal