Skip to Main Content
Table 2.

Primers used for the quantification of visual pigment transcripts from black bream retinal cDNA by qPCR

Forward primer (5′–3′)Reverse primer (5′–3′)
SWS1 TTTGAGCAGGTACATCCCTGAGGGTTTAGG CCTTGTTTTCGTCTGTCGAGTAGGCGAAGT 
SWS2A ATTGGTGGTATGGTCAGCCTGTGGTCTCTT TGCCGATTTCAGTATGAGGAGCAGCTGTGA 
SWS2B TTTGGCGGTATGGTCAGTCTGTGGTCTCTA GGCCATTTTCAGTGTGATGAGCAGCTGAGT 
Rh2Aα TTTTTAGCTTGCGCTGCTCCCCCTCTTTTC AATCCAGCCGGCAAATGTTGCGTATGGAGT 
Rh2Aβ AATATGGCTTGTGCTGCACCCCTCTTTTCG AATACAGCCGGCAAATGAGGCATATGGGAC 
LWS AACAGGTACTGGCCTCATGGTCTGAAGACT AAAATGCATATCCCGGGTTAGCCGCAGCAA 
Rh1 TTTGTCTGCAAGCCCATCAGCAACTTCCGT TTTTAATTCCCTCTCAGCCCTCTGGGTGGT 
Forward primer (5′–3′)Reverse primer (5′–3′)
SWS1 TTTGAGCAGGTACATCCCTGAGGGTTTAGG CCTTGTTTTCGTCTGTCGAGTAGGCGAAGT 
SWS2A ATTGGTGGTATGGTCAGCCTGTGGTCTCTT TGCCGATTTCAGTATGAGGAGCAGCTGTGA 
SWS2B TTTGGCGGTATGGTCAGTCTGTGGTCTCTA GGCCATTTTCAGTGTGATGAGCAGCTGAGT 
Rh2Aα TTTTTAGCTTGCGCTGCTCCCCCTCTTTTC AATCCAGCCGGCAAATGTTGCGTATGGAGT 
Rh2Aβ AATATGGCTTGTGCTGCACCCCTCTTTTCG AATACAGCCGGCAAATGAGGCATATGGGAC 
LWS AACAGGTACTGGCCTCATGGTCTGAAGACT AAAATGCATATCCCGGGTTAGCCGCAGCAA 
Rh1 TTTGTCTGCAAGCCCATCAGCAACTTCCGT TTTTAATTCCCTCTCAGCCCTCTGGGTGGT 

qPCR, quantitative PCR

Close Modal

or Create an Account

Close Modal
Close Modal