Skip to Main Content
Table 1.

Primers used for PCR amplification of opsin gene sequences from black bream retinal cDNA

Forward primer (5′–3′)Reverse primer (5′–3′)
Rh1 TTYCCNGTCAAYTTYCTCACN GTTCATGAAGACRTAGATDAYAGGGTTRTA 
LWS AGTGGGGAGATGCAATTTT GTTCATGAAGACRTAGATDAYAGGGTTRTA 
Rh2Aα GCGCGAATTCCACCATGGTTTGGGACGGC CGGCGTCGACGCAGACACAGAGGACACTTCCGT 
Rh2Aβ1 GGTAAGCGCGAATTCCACCATGGYTTGGGA TTTCGGCGTCGACGCAGACACAGAGGACAC 
Rh2Aβ2 AATATGGCTTGTGCTGCACCCCTCTTTTCG AATACAGCCGGCAAATGAGGCATATGGGAC 
SWS2 CACCTCAACTACATCCTGGT ACAGAGCAAAGGAGGCGTAA 
SWS1 CCACCTGTACGAGAACATCTCC GTTCATGAAGACRTAGATDAYAGGGTTRTA 
Forward primer (5′–3′)Reverse primer (5′–3′)
Rh1 TTYCCNGTCAAYTTYCTCACN GTTCATGAAGACRTAGATDAYAGGGTTRTA 
LWS AGTGGGGAGATGCAATTTT GTTCATGAAGACRTAGATDAYAGGGTTRTA 
Rh2Aα GCGCGAATTCCACCATGGTTTGGGACGGC CGGCGTCGACGCAGACACAGAGGACACTTCCGT 
Rh2Aβ1 GGTAAGCGCGAATTCCACCATGGYTTGGGA TTTCGGCGTCGACGCAGACACAGAGGACAC 
Rh2Aβ2 AATATGGCTTGTGCTGCACCCCTCTTTTCG AATACAGCCGGCAAATGAGGCATATGGGAC 
SWS2 CACCTCAACTACATCCTGGT ACAGAGCAAAGGAGGCGTAA 
SWS1 CCACCTGTACGAGAACATCTCC GTTCATGAAGACRTAGATDAYAGGGTTRTA 
Close Modal

or Create an Account

Close Modal
Close Modal