Skip to Main Content
Table 1.

Real-time PCR primers

GeneForward primer (5′–3′)Reverse primer (5′–3′)
PGC-1α1 atggcgtgggacaggtgta tgattggtcactgtaccacttgag 
PGC-1β2 tggggaagaggaggtctgc ccgtccaggctgtctgtg 
PRC3 cagttatgagcaggtggaca tctcgcctctatctgaatgg 
PPARα4 gagcccaagtttcagtttgc ggaagaggaactcgttgtcg 
PPARβ5 tggctttgtggatctcttcc gatctcgctgaaaggtttgc 
NRF-16 aggccctgaggactatcgtt gctccagtgccaacctgtat 
CS7 atggacttgatcgccaagc ccaccctcatggtcactgt 
COX IV8 agggatcctggctgcact tcaaaggtatgggggacatc 
COX I9 gtgcctgagccggaatagt tcagtttccgaatcctccaat 
MCAD10 caatggtcagaaaatgtggat ggcccatgtttaattccttt 
FAS11 ccaacacctcagtgcagttc ggaacgtcacaccttgctc 
EF-1α12 atgcggtggaatcgacaa cagagagcaatgtcaatggtg 
GeneForward primer (5′–3′)Reverse primer (5′–3′)
PGC-1α1 atggcgtgggacaggtgta tgattggtcactgtaccacttgag 
PGC-1β2 tggggaagaggaggtctgc ccgtccaggctgtctgtg 
PRC3 cagttatgagcaggtggaca tctcgcctctatctgaatgg 
PPARα4 gagcccaagtttcagtttgc ggaagaggaactcgttgtcg 
PPARβ5 tggctttgtggatctcttcc gatctcgctgaaaggtttgc 
NRF-16 aggccctgaggactatcgtt gctccagtgccaacctgtat 
CS7 atggacttgatcgccaagc ccaccctcatggtcactgt 
COX IV8 agggatcctggctgcact tcaaaggtatgggggacatc 
COX I9 gtgcctgagccggaatagt tcagtttccgaatcctccaat 
MCAD10 caatggtcagaaaatgtggat ggcccatgtttaattccttt 
FAS11 ccaacacctcagtgcagttc ggaacgtcacaccttgctc 
EF-1α12 atgcggtggaatcgacaa cagagagcaatgtcaatggtg 

Gene-specific primers were designed on goldfish or consensus sequences. CS,citrate synthase; COX, cytochrome oxidase; EF-1α, elongation factor-1α; FAS, fatty acid synthase; MCAD, medium chain acyl CoA dehydrogenase; NRF-1, nuclear respiratory factor-1; PPAR, peroxisome proliferator activator receptor; PGC-1, PPARγ coactivator-1; PRC,PGC-1-related coactivator. GenBank accession numbers: 1EU426842,XM678107; 2EU426839, XM678566; 3EU426841, XM001338200,CAAB01000022.1, CA371089; 4AY198322, AM230808, AY590299; 5AY894894, AF342937, AJ416953, AY590301, AY356399; 6AF087671; 7BC045362, DQ059757, AY382596; 8EU426840; 9AB111951, DQ656543, NC001606, AY996924; 10NM213010, NM016986, NM000016; 11XM682295, NM007988,NM004104, NM205155; and 12AB056104, NM1312

Close Modal

or Create an Account

Close Modal
Close Modal