Skip to Main Content
Table 1.

Primers for quantitative RT-PCR

GeneForward (5′–3′)Reverse (5′–3′)Fragment (bp)
CD14 ATTGCGATGTGCATTTCCG GAAAGTCCACTGCTTTGCTCG 109 
TLR4 TTATGTGGAGGGGAAAAGCAC GGAGGCAGATTGGAATGAG 124 
TNF-α GGACATCACCAAACGACACC CCCCAGCAAGAAGAAGGAAG 184 
GAPDH GGTAAGCTGTGGAGTGATGGGCG TGGGAGTAGGAACACGGAAGGCC 118 
23S rRNA CGATGTCGGCTCTTCCTATC TCCTCAGCCAAGCACATACA 205 
β-Actin GCGTCACCCACAACGTACCCATCT GATGTCACGCACAATTTCCCGCTC 140 
GeneForward (5′–3′)Reverse (5′–3′)Fragment (bp)
CD14 ATTGCGATGTGCATTTCCG GAAAGTCCACTGCTTTGCTCG 109 
TLR4 TTATGTGGAGGGGAAAAGCAC GGAGGCAGATTGGAATGAG 124 
TNF-α GGACATCACCAAACGACACC CCCCAGCAAGAAGAAGGAAG 184 
GAPDH GGTAAGCTGTGGAGTGATGGGCG TGGGAGTAGGAACACGGAAGGCC 118 
23S rRNA CGATGTCGGCTCTTCCTATC TCCTCAGCCAAGCACATACA 205 
β-Actin GCGTCACCCACAACGTACCCATCT GATGTCACGCACAATTTCCCGCTC 140 

Primers used for quantitative PCR of CD14 and TLR4 expression in the organs of the pouch young. bp, base pairs. Primers were manufactured by Sigma-Genosys(Castle Hill, NSW, Australia)

Close Modal

or Create an Account

Close Modal
Close Modal