Skip to Main Content
Table 1.

List of primers for RT-PCR and RACE

FragmentTermSequencePositionLength
COX4 Cox4-F5-M CTGAAGGAGAAGGAGAAGG 221–240 157 
 Cox4-B4 CRGTGAARCCGATRAAGAAC 377–358  
COX4-3′ Cox4-RACE-F1 TGAAGGAGAAGGAGAAGGGC 233–252 517 
 Cox4-RACE-F2 CTGTGGTTGGAGGGATGTTC 353–372  
COX4-5′ Cox4-RACE-B1 GCGGTACAATCCAATCTTCTCCTC 297–274 297 
 Cox4-RACE-B2 CAACCACAGATTTCCACTCTTGC 361–339  
 Cox4-RACE-B3 CGATAAAGAACATCCCTCCAACCAC 379–355  
COX4-c Cox4-F8 CCTTCGCCTTGTTGGAAAACG 66–86 183 
 Cox4-B6 TTCTCCTTCTCCTTCAGGGACAC 248–226  
COX2-a Cox2-F3 TTATCCTTATCGCCCTGCCC 145–164 255 
 Cox2-B2 CATCAGCGGAGACTAAAACG 399–380  
FragmentTermSequencePositionLength
COX4 Cox4-F5-M CTGAAGGAGAAGGAGAAGG 221–240 157 
 Cox4-B4 CRGTGAARCCGATRAAGAAC 377–358  
COX4-3′ Cox4-RACE-F1 TGAAGGAGAAGGAGAAGGGC 233–252 517 
 Cox4-RACE-F2 CTGTGGTTGGAGGGATGTTC 353–372  
COX4-5′ Cox4-RACE-B1 GCGGTACAATCCAATCTTCTCCTC 297–274 297 
 Cox4-RACE-B2 CAACCACAGATTTCCACTCTTGC 361–339  
 Cox4-RACE-B3 CGATAAAGAACATCCCTCCAACCAC 379–355  
COX4-c Cox4-F8 CCTTCGCCTTGTTGGAAAACG 66–86 183 
 Cox4-B6 TTCTCCTTCTCCTTCAGGGACAC 248–226  
COX2-a Cox2-F3 TTATCCTTATCGCCCTGCCC 145–164 255 
 Cox2-B2 CATCAGCGGAGACTAAAACG 399–380  

All sequences are written from 5′ to 3′. The positions correspond to the position of the following genes: Tunnus obesuscytochrome c oxidase subunit IV (COX4)[(Hüttemann, 2000),GenBank accession no. AF204870]; Z. viviparus cytochrome coxidase subunit II (COX2-a) [(Lucassen et al., 2003), GenBank accession no. AY227660] and subunit IV(COX4-3′; COX4-5′; COX4-a) (GenBank accession no. EF175142)

Close Modal

or Create an Account

Close Modal
Close Modal