Skip to Main Content
Table 1.

Oligonucleotides and TaqMan fluorogenic probes

GeneGenBank accession no.PrimerSequence 5′ → 3′bp
MyoD AY396566.1 TGCTCAGATGGCATGATGGA 77 
  AAGTAGGAGTTGTCATAGCTGTTTCG  
  TAATGGCCCTACATGCCCGTCTGG  
myogenin AY396565.1 GCAGCCCAGAGTGGAGCA 114 
  GATGTCAGAGACCTCATGTTGGC  
  CCGCCTACAGCTCCACCCACGA  
myf5 DQ016032.1 GCTCCGACAGCATGACAG 72 
  TGTAAGTGCTGCATGGGTTTA  
  TTGCAGCAGTCCTGTCTGGTCTCA  
MRF4 DQ059552.1 GCAAGCTAAACTCCCTGATAACAATA 82 
  TTTCCAGTGATACTCACCGTTACC  
  AACTGTAGCGCCAAAGACCACAGCG  
GeneGenBank accession no.PrimerSequence 5′ → 3′bp
MyoD AY396566.1 TGCTCAGATGGCATGATGGA 77 
  AAGTAGGAGTTGTCATAGCTGTTTCG  
  TAATGGCCCTACATGCCCGTCTGG  
myogenin AY396565.1 GCAGCCCAGAGTGGAGCA 114 
  GATGTCAGAGACCTCATGTTGGC  
  CCGCCTACAGCTCCACCCACGA  
myf5 DQ016032.1 GCTCCGACAGCATGACAG 72 
  TGTAAGTGCTGCATGGGTTTA  
  TTGCAGCAGTCCTGTCTGGTCTCA  
MRF4 DQ059552.1 GCAAGCTAAACTCCCTGATAACAATA 82 
  TTTCCAGTGATACTCACCGTTACC  
  AACTGTAGCGCCAAAGACCACAGCG  

Sequences are shown for sense (s) and antisense (a) primers and TaqMan probe (p), as well as the size of amplicon (in base pairs, bp). Primers for MyoD and MRF4 were between exons 1 and 2, and primers for myogenin and myf5 were between exons 2 and 3

Close Modal

or Create an Account

Close Modal
Close Modal