Skip to Main Content
Table 2.

Primers used for RT-PCR

Primer sequence (5′-3′)
Gene Forward Reverse
CRALBP  AGATCTCAGGAAGATGGTGGAC   GAAGTGGATGGCTTTGAACC  
CRX  GCCCCACTATTCTGTCAACG   CTTCCAGCTCCTCCAGTTG  
NRL  GAGCCCAGAGGAGACAGGA   TTTAGCTCCCGCACAGACAT  
PDC  TCAAAGGAACGAGTCAGCAG   CTGCTGCAAGGCATGTTAAA  
PDE6b  CAGTGATGAACACCGACACC   ATTTGACCAGGTCCAGTTCG  
PDE6c  CTGAGGTGGCCTCTAGGTTG   GCTGGTGTGATGAAGCCTTAG  
RCVRN  TAACGGGACCATCAGCAAG   CCTCGGGAGTGATCATTTTG  
RHO  CACCAGGCTGTGCCCTAC   GCCTCATCGTCACCCAGT  
GRK1  GGACTGGTTCCTGGACTTCA   AAGCCAGGGTTCTCCTCATT  
RPE65  CAATGGGTTTCTGATTGTGGA   CCAGTTCTCACGTAAATTGGCTA  
SAG  CTGATCCGCAAAGTACAGCA   TCAGCGTCTTGGTCAAAGTG  
GAPDH  ACCACAGTCCATGCCATCAC   TCCACCACCCTGTTGCTGTA  
Primer sequence (5′-3′)
Gene Forward Reverse
CRALBP  AGATCTCAGGAAGATGGTGGAC   GAAGTGGATGGCTTTGAACC  
CRX  GCCCCACTATTCTGTCAACG   CTTCCAGCTCCTCCAGTTG  
NRL  GAGCCCAGAGGAGACAGGA   TTTAGCTCCCGCACAGACAT  
PDC  TCAAAGGAACGAGTCAGCAG   CTGCTGCAAGGCATGTTAAA  
PDE6b  CAGTGATGAACACCGACACC   ATTTGACCAGGTCCAGTTCG  
PDE6c  CTGAGGTGGCCTCTAGGTTG   GCTGGTGTGATGAAGCCTTAG  
RCVRN  TAACGGGACCATCAGCAAG   CCTCGGGAGTGATCATTTTG  
RHO  CACCAGGCTGTGCCCTAC   GCCTCATCGTCACCCAGT  
GRK1  GGACTGGTTCCTGGACTTCA   AAGCCAGGGTTCTCCTCATT  
RPE65  CAATGGGTTTCTGATTGTGGA   CCAGTTCTCACGTAAATTGGCTA  
SAG  CTGATCCGCAAAGTACAGCA   TCAGCGTCTTGGTCAAAGTG  
GAPDH  ACCACAGTCCATGCCATCAC   TCCACCACCCTGTTGCTGTA  
Close Modal

or Create an Account

Close Modal
Close Modal