Skip to Main Content
Table 1.

Primers used for real-time PCR

Primer sequence (5′-3′)
Gene Forward Reverse
Mouse    
   Cripto  GCCTATGGGATTCCCTTCC   ACAGCGGGATACAGGGACT  
   Hes1  ACACCGGACAAACCAAAGAC   CGCCTCTTCTCCATGATAGG  
   Hes5  GATGCTCAGTCCCAAGGAGA   AGCTTCAGCTGCTCTATGCTG  
   Hesr1  CATGAAGAGAGCTCACCCAGA   CGCCGAACTCAAGTTTCC  
   Hesr2  GTGGGGAGCGAGAACAATTA   GTTGTCGGTGAATTGGACCT  
   Hesr3  CTGAATTGCGACGATTGGT   GCAAGACCTCAGCTTTCTCC  
   Nodal  CCAACCATGCCTACATCCA   CACAGCACGTGGAAGGAAC  
   Sox1  GTGACATCTGCCCCCATC   GAGGCCAGTCTGGTGTCAG  
   Wnt1  TACTGGCACTGACCGCTCT   CTTGGAATCCGTCAACAGGT  
   Wnt3  CTCGCTGGCTACCCAATTT   GAGGCCAGAGATGTGTACTGC  
   β-actin   CTAAGGCCAACCGTGAAAAG   ACCAGAGGCATACAGGGACA  
Human    
   BF1  TACTACCGCGAGAACAAGCA   TCACGAAGCACTTGTTGAGG  
   CHX10  GCTGGACACCAGCCAGAC   GCAGATTTGGACATTTTTCGAT  
   CRALBP  AGATCTCAGGAAGATGGTGGAC   GAAGTGGATGGCTTTGAACC  
   CRX  CACCAGGCTGTGCCCTAC   CTTCCAGCTCCTCCAGTTG  
   GBX2  AAAGAGGGCTCGCTGCTC   ATCGCTCTCCAGCGAGAA  
   HOXB4  TGGATGCGCAAAGTTCAC   GCTGGACACCAGCCAGAC  
   IRX3  AAAAGTTACTCAAGACAGCTTTCCA   GAAATTCCTTCTCCAGCTCCA  
   MITF  AGAGTCTGAAGCAAGAGCACTG   TGCGGTCATTTATGTTAAATCTTC  
   NANOG  ATGCCTCACACGGAGACTGT   AGGGCTGTCCTGAATAAGCA  
   OCT3/4  GCAAAACCCGGAGGAGGAGTC   CCACATCGGCCTGTGTATATC  
   PAX6  TCACCATGGCAAATAACCTG   CAGCATGCAGGAGTATGAGG  
   RCVRN  TAACGGGACCATCAGCAAG   CCTCGGGAGTGATCATTTTG  
   RPE65  CAATGGGTTTCTGATTGTGGA   CCAGTTCTCACGTAAATTGGCTA  
   RX  GGCAAGGTCAACCTACCAGA   CTTCATGGAGGACACTTCCAG  
   SIX3  CCGGAAGAGTTGTCCATGTT   CTCCTCCAGCGTCTCACAG  
   β-actin   ATTGGCAATGAGCGGTTC   GGATGCCACAGGACTCCA  
Primer sequence (5′-3′)
Gene Forward Reverse
Mouse    
   Cripto  GCCTATGGGATTCCCTTCC   ACAGCGGGATACAGGGACT  
   Hes1  ACACCGGACAAACCAAAGAC   CGCCTCTTCTCCATGATAGG  
   Hes5  GATGCTCAGTCCCAAGGAGA   AGCTTCAGCTGCTCTATGCTG  
   Hesr1  CATGAAGAGAGCTCACCCAGA   CGCCGAACTCAAGTTTCC  
   Hesr2  GTGGGGAGCGAGAACAATTA   GTTGTCGGTGAATTGGACCT  
   Hesr3  CTGAATTGCGACGATTGGT   GCAAGACCTCAGCTTTCTCC  
   Nodal  CCAACCATGCCTACATCCA   CACAGCACGTGGAAGGAAC  
   Sox1  GTGACATCTGCCCCCATC   GAGGCCAGTCTGGTGTCAG  
   Wnt1  TACTGGCACTGACCGCTCT   CTTGGAATCCGTCAACAGGT  
   Wnt3  CTCGCTGGCTACCCAATTT   GAGGCCAGAGATGTGTACTGC  
   β-actin   CTAAGGCCAACCGTGAAAAG   ACCAGAGGCATACAGGGACA  
Human    
   BF1  TACTACCGCGAGAACAAGCA   TCACGAAGCACTTGTTGAGG  
   CHX10  GCTGGACACCAGCCAGAC   GCAGATTTGGACATTTTTCGAT  
   CRALBP  AGATCTCAGGAAGATGGTGGAC   GAAGTGGATGGCTTTGAACC  
   CRX  CACCAGGCTGTGCCCTAC   CTTCCAGCTCCTCCAGTTG  
   GBX2  AAAGAGGGCTCGCTGCTC   ATCGCTCTCCAGCGAGAA  
   HOXB4  TGGATGCGCAAAGTTCAC   GCTGGACACCAGCCAGAC  
   IRX3  AAAAGTTACTCAAGACAGCTTTCCA   GAAATTCCTTCTCCAGCTCCA  
   MITF  AGAGTCTGAAGCAAGAGCACTG   TGCGGTCATTTATGTTAAATCTTC  
   NANOG  ATGCCTCACACGGAGACTGT   AGGGCTGTCCTGAATAAGCA  
   OCT3/4  GCAAAACCCGGAGGAGGAGTC   CCACATCGGCCTGTGTATATC  
   PAX6  TCACCATGGCAAATAACCTG   CAGCATGCAGGAGTATGAGG  
   RCVRN  TAACGGGACCATCAGCAAG   CCTCGGGAGTGATCATTTTG  
   RPE65  CAATGGGTTTCTGATTGTGGA   CCAGTTCTCACGTAAATTGGCTA  
   RX  GGCAAGGTCAACCTACCAGA   CTTCATGGAGGACACTTCCAG  
   SIX3  CCGGAAGAGTTGTCCATGTT   CTCCTCCAGCGTCTCACAG  
   β-actin   ATTGGCAATGAGCGGTTC   GGATGCCACAGGACTCCA  
Close Modal

or Create an Account

Close Modal
Close Modal