Skip to Main Content
Table 1.

PCR primers for cDNA cloning and PCR

Target genesApplicationOligonucleotide sequences (5′–3′)
AVT precursor Real-time PCR Sense: TGTATGTCATGTGGTCCACGG 
  Antisense: ATCTCAAAGTCTCTGCGGTGC 
VT1aR Degenerate PCR Sense: GARGARCTNGCNAARATHGA 
  Antisense: TGNCCNGARAARAACATRTA 
 5′-RACE PCR Antisense1: AACCAGGTCAGCTAAACTAAGATG 
  Antisense2: AGAGCAAGCAACACACTAATG 
 3′-RACE PCR Sense1: CAGTAAAAATGACATTCGTGATTG 
  Sense2: GGATGATCAGTTCTCTTGGGA 
 RT-PCR Sense: GGATGATCAGTTCTCTTGGGA 
  Antisense: GTCTGATCCTTGTTTTGTAGTGG 
 Real-time PCR Sense: GAAGGCAAACCTCTCTAACCAAGA 
  Antisense: GCGATTCCTTCCAGGTTCCT 
VT2R Degenerate PCR Sense: TAYATGATHGTNGCNATGAC 
  Antisense: CCANGGRTTNGTRCARCTRTT 
  Antisense1: CTTGAAAGTACTTGACAGCTCGG 
  Antisense2: GATAACAATTTGTGGGAGACTGAG 
  Sense1: GTTATTGTGGTTATCTATATCGCTTG 
  Sense2: TTATCTATATCGCTTGCTGGGCT 
 RT-PCR Sense: GTTATTGTGGTTATCTATATCGCTTG 
  Antisense: ATTTTAATACAGAGATTCTTTGGG 
 Real-time PCR Sense: GATCCCCACGCACCAAAG 
  Antisense: CAGCTGTTCAGACTTGCTAATAGCA 
GAPDH (internal standard) RT-PCR Sense: AGTTTTCTGAGTGGCTGTATAAG 
  Antisense: ATCCTGCTAACATCAAGTGGG 
 Real-time PCR Sense: GGGAGCCAGGCAGTTGGTA 
  Antisense: ATGAAAAGTACGACAACAGTCTGACA 
Target genesApplicationOligonucleotide sequences (5′–3′)
AVT precursor Real-time PCR Sense: TGTATGTCATGTGGTCCACGG 
  Antisense: ATCTCAAAGTCTCTGCGGTGC 
VT1aR Degenerate PCR Sense: GARGARCTNGCNAARATHGA 
  Antisense: TGNCCNGARAARAACATRTA 
 5′-RACE PCR Antisense1: AACCAGGTCAGCTAAACTAAGATG 
  Antisense2: AGAGCAAGCAACACACTAATG 
 3′-RACE PCR Sense1: CAGTAAAAATGACATTCGTGATTG 
  Sense2: GGATGATCAGTTCTCTTGGGA 
 RT-PCR Sense: GGATGATCAGTTCTCTTGGGA 
  Antisense: GTCTGATCCTTGTTTTGTAGTGG 
 Real-time PCR Sense: GAAGGCAAACCTCTCTAACCAAGA 
  Antisense: GCGATTCCTTCCAGGTTCCT 
VT2R Degenerate PCR Sense: TAYATGATHGTNGCNATGAC 
  Antisense: CCANGGRTTNGTRCARCTRTT 
  Antisense1: CTTGAAAGTACTTGACAGCTCGG 
  Antisense2: GATAACAATTTGTGGGAGACTGAG 
  Sense1: GTTATTGTGGTTATCTATATCGCTTG 
  Sense2: TTATCTATATCGCTTGCTGGGCT 
 RT-PCR Sense: GTTATTGTGGTTATCTATATCGCTTG 
  Antisense: ATTTTAATACAGAGATTCTTTGGG 
 Real-time PCR Sense: GATCCCCACGCACCAAAG 
  Antisense: CAGCTGTTCAGACTTGCTAATAGCA 
GAPDH (internal standard) RT-PCR Sense: AGTTTTCTGAGTGGCTGTATAAG 
  Antisense: ATCCTGCTAACATCAAGTGGG 
 Real-time PCR Sense: GGGAGCCAGGCAGTTGGTA 
  Antisense: ATGAAAAGTACGACAACAGTCTGACA 

VT1aR, V1a-type receptor; VT2R, V2-type receptor; GAPDH,glyceraldehyde-3-phosphate dehydrogenase

Close Modal

or Create an Account

Close Modal
Close Modal