Skip to Main Content
Table 1.

Primers used for qPCR and cloning of toadfish SLC26a6

PrimerSequence (5′→3′)Product size (bp)
Eel SLC26a6-F* TGGTGCGGTTTGGATTTGTG 544 
Eel SLC26a6-R* ACCAGTTCCTGGTTGCTGTC  
SLC26a6-5′ RACE GGAAATGTTGATGGCGTAGCCCACG 1124 
SLC26a6-n5′ RACE GCCACAGCAAACGCATCACCTATCAC 1096 
SLC26a6-3′ RACE GCCTGTCGCTCCAGACGCAAGTATG 3245 
SLC26a6-n3′ RACE GTGATAGGTGATGCGTTTGCTGTGGC 3211 
ORF SLC26a6-F ATGGAGGAGAGGGACGGTTC 2473 
ORF SLC26a6-R TCACATCTGGGTGGTGCAGG  
qPCR SLC26a6-F CTCTCACTTATTTATACTGTGGTG 140 
qPCR SLC26a6-R GCAGGTTATGTCTGTAACATGC  
EF1α-F AGGTCATCATCCTGAACCAC 143 
EF1α-R GTTGTCCTCAAGCTTCTTGC  
18S-F GCTCGTAGTTGGATCTCGG 166 
18S-R GGCCTGCTTTGAACACTC  
PrimerSequence (5′→3′)Product size (bp)
Eel SLC26a6-F* TGGTGCGGTTTGGATTTGTG 544 
Eel SLC26a6-R* ACCAGTTCCTGGTTGCTGTC  
SLC26a6-5′ RACE GGAAATGTTGATGGCGTAGCCCACG 1124 
SLC26a6-n5′ RACE GCCACAGCAAACGCATCACCTATCAC 1096 
SLC26a6-3′ RACE GCCTGTCGCTCCAGACGCAAGTATG 3245 
SLC26a6-n3′ RACE GTGATAGGTGATGCGTTTGCTGTGGC 3211 
ORF SLC26a6-F ATGGAGGAGAGGGACGGTTC 2473 
ORF SLC26a6-R TCACATCTGGGTGGTGCAGG  
qPCR SLC26a6-F CTCTCACTTATTTATACTGTGGTG 140 
qPCR SLC26a6-R GCAGGTTATGTCTGTAACATGC  
EF1α-F AGGTCATCATCCTGAACCAC 143 
EF1α-R GTTGTCCTCAAGCTTCTTGC  
18S-F GCTCGTAGTTGGATCTCGG 166 
18S-R GGCCTGCTTTGAACACTC  
*

Primer sequences used for initial cloning of toadfish SLC26a6 fragment,generously provided by Dr Jonathan Wilson, were designed from conserved regions of three eel SLC26a6 aligned sequences

Sizes include 45 bp at 5′ end corresponding to Clontech Universal Primer A sequence. Abbreviations: forward primer (F); reverse primer (R);nested primer (n); open reading frame (ORF)

Close Modal

or Create an Account

Close Modal
Close Modal