Skip to Main Content
Table 1.

PCR reactions and primers used to determine the cDNA sequence of M. californianus preCols

PreCol D 5′RACE/DR-1, DF-2/DR-2, DF-3/DR-3 
   McDR-1 5′ TCCGCCACCTACAACTGGACC 3′ 
   McDF-2 5′ GCAGCAGCAAACGCAGCAGCAGGAGGAT 3′ 
   McDR-2 5′ CTCCGGCTGTTCTGAGGTCTTCAAT 3′ 
   McDF-3* 5′ GTGGTATGGGTAGACGAG 3′ 
   McDR-3* 5′ AACACTTGCAGATTTTATTGATA 3′ 
PreCol NG 5′RACE/NGR-1,NGF-2/NGR-2dg,NGF-3/NGR-3, NGf-4/NGR-4 
   McNGR-1 5′ AAGTGGGAATCCGCCGCCACCAGTTGC 3′ 
   McNGF-2 5′ GCGGCTATCGCCCGCACAGGACTA 3′ 
   McNGR-2dg 5′ YTGWCCWGGDGCWCCWCCDGCATTWCCWGGTTGG 3′ 
   McNGF-3 5′ GCAACTGGTGGCGGCGGATTCCCACTT 3′ 
   McNGR-3 5′ CCACCAGCCTCTCCTGCTGGTCCTTCT 3′ 
   McNGF-4* 5′ AAGGAGAACTTGGACCAGTCG 3′ 
   McNGR-4* 5′ AGGAACTTGCACTTTTTAT 3′ 
PreCol P 5′RACE/PR-1, PF-2/PR-2, PF-3/3′RACE 
   McPR-1 5′ GGATCAGGCAGTGGCAGAGCATTTGGTGG 3′ 
   McPR-2* 5′ GAATAACACCTGGTGCTCCT 3′ 
   McPF-2* 5′ GAGGATTCGGTGGACCAGGTAC 3′ 
   McPF-3 5′ GGGACCAGGAGGTGAAAGAGGAGGCCAAGG 3′ 
PreCol D 5′RACE/DR-1, DF-2/DR-2, DF-3/DR-3 
   McDR-1 5′ TCCGCCACCTACAACTGGACC 3′ 
   McDF-2 5′ GCAGCAGCAAACGCAGCAGCAGGAGGAT 3′ 
   McDR-2 5′ CTCCGGCTGTTCTGAGGTCTTCAAT 3′ 
   McDF-3* 5′ GTGGTATGGGTAGACGAG 3′ 
   McDR-3* 5′ AACACTTGCAGATTTTATTGATA 3′ 
PreCol NG 5′RACE/NGR-1,NGF-2/NGR-2dg,NGF-3/NGR-3, NGf-4/NGR-4 
   McNGR-1 5′ AAGTGGGAATCCGCCGCCACCAGTTGC 3′ 
   McNGF-2 5′ GCGGCTATCGCCCGCACAGGACTA 3′ 
   McNGR-2dg 5′ YTGWCCWGGDGCWCCWCCDGCATTWCCWGGTTGG 3′ 
   McNGF-3 5′ GCAACTGGTGGCGGCGGATTCCCACTT 3′ 
   McNGR-3 5′ CCACCAGCCTCTCCTGCTGGTCCTTCT 3′ 
   McNGF-4* 5′ AAGGAGAACTTGGACCAGTCG 3′ 
   McNGR-4* 5′ AGGAACTTGCACTTTTTAT 3′ 
PreCol P 5′RACE/PR-1, PF-2/PR-2, PF-3/3′RACE 
   McPR-1 5′ GGATCAGGCAGTGGCAGAGCATTTGGTGG 3′ 
   McPR-2* 5′ GAATAACACCTGGTGCTCCT 3′ 
   McPF-2* 5′ GAGGATTCGGTGGACCAGGTAC 3′ 
   McPF-3 5′ GGGACCAGGAGGTGAAAGAGGAGGCCAAGG 3′ 
*

Primers from M. edulis. McDR-3 and McNGR-4 are based on the 3′ UTR

dg

Degenerate primer

Close Modal

or Create an Account

Close Modal
Close Modal