Skip to Main Content
Table 1.

Nucleotide sequences of real-time PCR primers and probes used to quantify gene expression in gills of Atlantic salmon

GeneGenBank accession no.Forward primerReverse primer6-FAM MGB probesSize (bp)
NKA α-1a CK878443 CCAGGATCACTCAATGTCACTCT GCTATCAAAGGCAAATGAGTTTAATATCATTGTAAAA ACGATTACATTATAAGGCAATACT 93 
NKA α-1b CK879688 GCTACATCTCAACCAACAACATTACAC TGCAGCTGAGTGCACCAT ACCATTACATCCAATGAACACT 91 
NKA α-1c CK 885259 AGGGAGACGTACTACTAGAAAGCAT CAGAACTTAAAATTCCGAGCAGCAA ACAACCATGCAAGAACT 85 
NKA α-3 CK170270 GGAGACCAGCAGAGGAACAG CCCTACCAGCCCTCTGAGT AAGACCCAGCCTGAAATG 58 
NKA β1 CK886866 CGTCAAGCTGAACAGGATCGT CCTCAGGGATGCTTTCATTGGA CCTTGGCCTGAAGTTG 68 
NKCC AJ417890 GATGATCTGCGGCCATGTTC AGACCAGTAACCTGTCGAGAAAC CTCCAGAAGGCCCAACTT 68 
EF1AA AF321836 CCCCTCCAGGACGTTTACAAA CACACGGCCCACAGGTACA ATCGGTGGTATTGGAAC 57 
CFTR I AF155237 CCTTCTCCAATATGGTTGAAGAGGCAAG GAGGCACTTGGATGAGTCAGCAG Sybr Green 84 
CFTR II AF161070 GCCTTATTTCTTCTATTTGTATGCACTT GCCACCATGAAAAACTAAAGAGTACCTCAG Sybr Green 67 
EF1AA AF321836 GAGAACCATTGAGAAGTTCGAGAAG GCACCCAGGCATACTTGAAAG Sybr Green 71 
GeneGenBank accession no.Forward primerReverse primer6-FAM MGB probesSize (bp)
NKA α-1a CK878443 CCAGGATCACTCAATGTCACTCT GCTATCAAAGGCAAATGAGTTTAATATCATTGTAAAA ACGATTACATTATAAGGCAATACT 93 
NKA α-1b CK879688 GCTACATCTCAACCAACAACATTACAC TGCAGCTGAGTGCACCAT ACCATTACATCCAATGAACACT 91 
NKA α-1c CK 885259 AGGGAGACGTACTACTAGAAAGCAT CAGAACTTAAAATTCCGAGCAGCAA ACAACCATGCAAGAACT 85 
NKA α-3 CK170270 GGAGACCAGCAGAGGAACAG CCCTACCAGCCCTCTGAGT AAGACCCAGCCTGAAATG 58 
NKA β1 CK886866 CGTCAAGCTGAACAGGATCGT CCTCAGGGATGCTTTCATTGGA CCTTGGCCTGAAGTTG 68 
NKCC AJ417890 GATGATCTGCGGCCATGTTC AGACCAGTAACCTGTCGAGAAAC CTCCAGAAGGCCCAACTT 68 
EF1AA AF321836 CCCCTCCAGGACGTTTACAAA CACACGGCCCACAGGTACA ATCGGTGGTATTGGAAC 57 
CFTR I AF155237 CCTTCTCCAATATGGTTGAAGAGGCAAG GAGGCACTTGGATGAGTCAGCAG Sybr Green 84 
CFTR II AF161070 GCCTTATTTCTTCTATTTGTATGCACTT GCCACCATGAAAAACTAAAGAGTACCTCAG Sybr Green 67 
EF1AA AF321836 GAGAACCATTGAGAAGTTCGAGAAG GCACCCAGGCATACTTGAAAG Sybr Green 71 
Close Modal

or Create an Account

Close Modal
Close Modal