Skip to Main Content
Table 2.

Primers used for RT-PCR of MHC isoforms

MHC-2A for 5′AGCCGGGAGGTTCACACAAA3′ 
 rev 5′CTTTGCAATAGGGTAGGATAGGC3′ 
MHC-2B for 5′TGAAAATGAACAGAAGCGCAATG3′ 
 rev 5′TTTCCTTGACATCACATGACATATAAC3′ 
MHC-2X for 5′TGAAGAAGAACCTGGAGCAGACG3′ 
 rev 5′CATTAAGTACAAAACAGAGTGACAAAGATT3′ 
MHC-slow for 5′TGGAGCGCATGAAGAAGAACA3′ 
 rev 5′AGTGCTTTATTCTGCTTCCTCCAA3′ 
MHC-2A for 5′AGCCGGGAGGTTCACACAAA3′ 
 rev 5′CTTTGCAATAGGGTAGGATAGGC3′ 
MHC-2B for 5′TGAAAATGAACAGAAGCGCAATG3′ 
 rev 5′TTTCCTTGACATCACATGACATATAAC3′ 
MHC-2X for 5′TGAAGAAGAACCTGGAGCAGACG3′ 
 rev 5′CATTAAGTACAAAACAGAGTGACAAAGATT3′ 
MHC-slow for 5′TGGAGCGCATGAAGAAGAACA3′ 
 rev 5′AGTGCTTTATTCTGCTTCCTCCAA3′ 

for, forward; rev, reverse.

Close Modal

or Create an Account

Close Modal
Close Modal