Skip to Main Content
Table 1.

Primers used in this study for quantitative RT-PCR

Oligonucleotide sequence (5′-3′)
TemplateForward primerReverse primer
SPL2 TGTAGCAGGTTCCACTGTCTCTC TGTCCTTCCAGGATTTGGCTTG 
SPL3 CTGAGTGAGGAAGAGGAAGAAGAAG CGCGTGAAACCTGCTGCATTG 
SPL4 AGGCATCTTCTGTCTTTCTCTCAGG TGGTCGCTTGAATGATGAGTTTGG 
SPL5 TCAGGCAACGCTTTTGTCAAC GATCTTCCTCCTCCTCTCATTGTG 
SPL6 GTGCAGCAGGTTTCATTTCCTCTC TGCAGGTTTCCTTCTTCGTTCATTG 
SPL9 GTCACTGTGGCTGGTATCGAAC CCTGCGGCAACTCCTTTTCTC 
SPL10 CACCCTCTCTTTCTCTGCGTTTC GAGCATTCTCCCACACCTTTGTC 
SPL11 CATGGCGAAGATGTGGGAGAATAC CCGAAGAGGTTGACAGAAGAGAGAG 
SPL13 TGGTAGGTGTATGGATTTGTGAGAG ACCCACCAAACGAGATCGAAC 
SPL15 TCGCTCCATCTCTTTACGGAAACC GTTGACCACGCAGTAGGATCTC 
UBQ10 CACACTCCACTTGGTCTTGCGT TGGTCTTTCCGGTGAGAGTCTTCA 
Oligonucleotide sequence (5′-3′)
TemplateForward primerReverse primer
SPL2 TGTAGCAGGTTCCACTGTCTCTC TGTCCTTCCAGGATTTGGCTTG 
SPL3 CTGAGTGAGGAAGAGGAAGAAGAAG CGCGTGAAACCTGCTGCATTG 
SPL4 AGGCATCTTCTGTCTTTCTCTCAGG TGGTCGCTTGAATGATGAGTTTGG 
SPL5 TCAGGCAACGCTTTTGTCAAC GATCTTCCTCCTCCTCTCATTGTG 
SPL6 GTGCAGCAGGTTTCATTTCCTCTC TGCAGGTTTCCTTCTTCGTTCATTG 
SPL9 GTCACTGTGGCTGGTATCGAAC CCTGCGGCAACTCCTTTTCTC 
SPL10 CACCCTCTCTTTCTCTGCGTTTC GAGCATTCTCCCACACCTTTGTC 
SPL11 CATGGCGAAGATGTGGGAGAATAC CCGAAGAGGTTGACAGAAGAGAGAG 
SPL13 TGGTAGGTGTATGGATTTGTGAGAG ACCCACCAAACGAGATCGAAC 
SPL15 TCGCTCCATCTCTTTACGGAAACC GTTGACCACGCAGTAGGATCTC 
UBQ10 CACACTCCACTTGGTCTTGCGT TGGTCTTTCCGGTGAGAGTCTTCA 
Close Modal

or Create an Account

Close Modal
Close Modal