Skip to Main Content
Table 1.

Primers (5′ to 3′) for real-time PCR

Human geneForwardReverse
GAPDH TCGACAGTCAGCCGCATCTTCTTT ACCAAATCCGTTGACTCCGACCTT 
GLI1 GGCTGCAGTAAAGCCTTCAGCAAT TGCAGCCAGGGAGCTTACATACAT 
GLI2 AGGACAAGGCCAACATCGTCATCT TCCCTGGCTTTCATTTGCAGTTGG 
GLI3 TTGCACAAAGGCCTACTCGAGACT CTTGTTGCAACCTTCGTGCTCACA 
NKX2.2 GACAACTGGTGGCAGATTTCGCTT AGCCACAAAGAAAGGAGTTGGACC 
OLIG2 GGTAAGTGCGCAATGCTAAGCTGT TACAAAGCCCAGTTTGCAACGCAG 
SHH AAGATCTCCAGAAACTCCGAGCGA CGAGATGGCCAAAGCGTTCAACTT 
Human geneForwardReverse
GAPDH TCGACAGTCAGCCGCATCTTCTTT ACCAAATCCGTTGACTCCGACCTT 
GLI1 GGCTGCAGTAAAGCCTTCAGCAAT TGCAGCCAGGGAGCTTACATACAT 
GLI2 AGGACAAGGCCAACATCGTCATCT TCCCTGGCTTTCATTTGCAGTTGG 
GLI3 TTGCACAAAGGCCTACTCGAGACT CTTGTTGCAACCTTCGTGCTCACA 
NKX2.2 GACAACTGGTGGCAGATTTCGCTT AGCCACAAAGAAAGGAGTTGGACC 
OLIG2 GGTAAGTGCGCAATGCTAAGCTGT TACAAAGCCCAGTTTGCAACGCAG 
SHH AAGATCTCCAGAAACTCCGAGCGA CGAGATGGCCAAAGCGTTCAACTT 
Close Modal

or Create an Account

Close Modal
Close Modal