Skip to Main Content
Table 1.

Primer sequences

NameSequence (59 to 39)
Expression analysis
 

 
Ubq-F AACCAGCTGAGGCCCAAGA 
Ubq-R ACGATTGATTTAACCAGTCCATGA 
OsMADS50-F CAGGCCAGGAATAAGCTGGAT 
OsMADS50-R TTAGGATGGTTTGGTGTCATTGC 
Ehd1-F TGCAAATGGCGCTTTTGAT 
Ehd1-R ATATGTGCTGCCAAATGTTGCT 
RFT1-F TGACCTAGATTCAAAGTCTAATCCTT 
RFT1-R TGCCGGCCATGTCAAATTAATAAC 
Hd3a-F GCTCACTATCATCATCCAGCATG 
Hd3a-R CCTTGCTCAGCTATTTAATTGCATAA 
OsMADS14-F CGGTTGCGAGACGAGGAA 
OsMADS14-R GAAAGACGGTGCTGGACGAA 
OsMADS15-F CGTCGTCGGCCAAACAG 
OsMADS15-R TGACTTCAATTCATTCAAGGTTGCT 
Hd1-F TCAGCAACAGCATATCTTTCTCATCA 
Hd1-R TCTGGAATTTGGCATATCTATCACC 
Ghd7-F ATGGGGATGGCCAATGAGGAGTC 
Ghd7-R GAGGAATCCGGCCGCCTTTTTTC 
RID1/Ehd2/OsID1-F CGACGACAATAGCTCGATCGC 
RID1/Ehd2/OsID1-R
 
GTGCATGGTCACGGAGCCTT
 
RNAi constructs
 

 
Hd3a-F TACTTCAACTGCCAGCGCGAGGCAG 
Hd3a-R TGCTGGATGATGATAGTGAGCATGC 
RFT1-F TACTTCAACTGCCAGCGCGAGG 
RFT1-R
 
AGCTATAGCTGCTGCATGCATGGA
 
pRFT1::RFT1:GFP
 

 
RFT1 promoter-F AAGCTTTGATATTCTCGCACCCAGTCTTGCT 
RFT1 promoter-R CCCGGGGATGCACTAGTTGTGCAAGCTTCTC 
RFT1 5′-F ACTAGTCCTGTCACTGTTTGGCTAGCTTA 
RFT1 5′-R GCGGCAGGAGGGTCTACCCCTCTAGA 
GFP-F TCTAGATCTAGAGTGAGCAAGGGCGA 
RFT1 3′-R
 
ACTAGTTATACAGCTAGGCAGGTCTCAG
 
Screening pRFT1::RFT1:GFP transgenic plants
 

 
GFP2-F TACGGCGTGCAGTGCTTC 
GFP2-R
 
CGGGCATGGCGGACT
 
Screening RNAi plants
 

 
Hd3a-F GTCTACTTCAACTGCCAGCGCGAG 
Hd3a-R GAACCTGCAATGTATAGCATGCTGG 
RFT1-F GTCTACTTCAACTGCCAGCGCGAG 
RFT1-R CTTAGCTATAGCTGCTGCATGCATG 
NameSequence (59 to 39)
Expression analysis
 

 
Ubq-F AACCAGCTGAGGCCCAAGA 
Ubq-R ACGATTGATTTAACCAGTCCATGA 
OsMADS50-F CAGGCCAGGAATAAGCTGGAT 
OsMADS50-R TTAGGATGGTTTGGTGTCATTGC 
Ehd1-F TGCAAATGGCGCTTTTGAT 
Ehd1-R ATATGTGCTGCCAAATGTTGCT 
RFT1-F TGACCTAGATTCAAAGTCTAATCCTT 
RFT1-R TGCCGGCCATGTCAAATTAATAAC 
Hd3a-F GCTCACTATCATCATCCAGCATG 
Hd3a-R CCTTGCTCAGCTATTTAATTGCATAA 
OsMADS14-F CGGTTGCGAGACGAGGAA 
OsMADS14-R GAAAGACGGTGCTGGACGAA 
OsMADS15-F CGTCGTCGGCCAAACAG 
OsMADS15-R TGACTTCAATTCATTCAAGGTTGCT 
Hd1-F TCAGCAACAGCATATCTTTCTCATCA 
Hd1-R TCTGGAATTTGGCATATCTATCACC 
Ghd7-F ATGGGGATGGCCAATGAGGAGTC 
Ghd7-R GAGGAATCCGGCCGCCTTTTTTC 
RID1/Ehd2/OsID1-F CGACGACAATAGCTCGATCGC 
RID1/Ehd2/OsID1-R
 
GTGCATGGTCACGGAGCCTT
 
RNAi constructs
 

 
Hd3a-F TACTTCAACTGCCAGCGCGAGGCAG 
Hd3a-R TGCTGGATGATGATAGTGAGCATGC 
RFT1-F TACTTCAACTGCCAGCGCGAGG 
RFT1-R
 
AGCTATAGCTGCTGCATGCATGGA
 
pRFT1::RFT1:GFP
 

 
RFT1 promoter-F AAGCTTTGATATTCTCGCACCCAGTCTTGCT 
RFT1 promoter-R CCCGGGGATGCACTAGTTGTGCAAGCTTCTC 
RFT1 5′-F ACTAGTCCTGTCACTGTTTGGCTAGCTTA 
RFT1 5′-R GCGGCAGGAGGGTCTACCCCTCTAGA 
GFP-F TCTAGATCTAGAGTGAGCAAGGGCGA 
RFT1 3′-R
 
ACTAGTTATACAGCTAGGCAGGTCTCAG
 
Screening pRFT1::RFT1:GFP transgenic plants
 

 
GFP2-F TACGGCGTGCAGTGCTTC 
GFP2-R
 
CGGGCATGGCGGACT
 
Screening RNAi plants
 

 
Hd3a-F GTCTACTTCAACTGCCAGCGCGAG 
Hd3a-R GAACCTGCAATGTATAGCATGCTGG 
RFT1-F GTCTACTTCAACTGCCAGCGCGAG 
RFT1-R CTTAGCTATAGCTGCTGCATGCATG 
Close Modal

or Create an Account

Close Modal
Close Modal