Skip to Main Content
Table 1.

PCR primers used

GeneForward primerReverse primerSize of product (bp)
Oct3/4 atggctggacacctggcttc ccaggttctcttgtctacctc 1121 
Sox2 acactgcccctgtcgcacatgtgagtcgacaa ttgatatcatgtataacatgatggagacggagc 976 
Otx1 gcagcgacgggagcgcacca tgctgctggcggcacttggc 180 
Emx2 ttcgaaccgccttctcgccg tgagccttcttcctctag 188 
Gata4 ccgagcaggaatttgaagagg gcctgtatgtaatgcctgcg 469 
CK-17 cctgctccagattgacaatg cttgctgaagaaccagtcttc 380 
Fgf5 aaagtcaatggctcccacgaa agaggctgtagaacatgatt 464 
Gapdh accacagtccatgccatcac tccaccaccctgttgctgta 452 
GeneForward primerReverse primerSize of product (bp)
Oct3/4 atggctggacacctggcttc ccaggttctcttgtctacctc 1121 
Sox2 acactgcccctgtcgcacatgtgagtcgacaa ttgatatcatgtataacatgatggagacggagc 976 
Otx1 gcagcgacgggagcgcacca tgctgctggcggcacttggc 180 
Emx2 ttcgaaccgccttctcgccg tgagccttcttcctctag 188 
Gata4 ccgagcaggaatttgaagagg gcctgtatgtaatgcctgcg 469 
CK-17 cctgctccagattgacaatg cttgctgaagaaccagtcttc 380 
Fgf5 aaagtcaatggctcccacgaa agaggctgtagaacatgatt 464 
Gapdh accacagtccatgccatcac tccaccaccctgttgctgta 452 
Close Modal

or Create an Account

Close Modal
Close Modal