1-20 of 120
Keywords: Mitochondria
Close
Follow your search
Access your saved searches in your account

Would you like to receive an alert when new items match your search?
Close Modal
Sort by
Journal Articles
J Exp Biol (2022) 225 (15): jeb243646.
Published: 9 August 2022
... individual fitness, group function and species communities in different environments. Locomotion Metabolic rate Muscle Mitochondria Temperature Exercise Allocation trade-off Australian Research Council http://dx.doi.org/10.13039/501100000923 DP220101342 Limited resources...
Journal Articles
J Exp Biol (2022) 225 (12): jeb242612.
Published: 28 June 2022
... in mitochondrial metabolism between thermal acclimation states in birds. Some functions of the mitochondria covary with thermogenic capacity and basal maintenance costs in patterns that are dependent on temperature and body mass. Our analyses first tested whether thermal treatments (−10°C and 27° C) generated...
Includes: Supplementary data
Journal Articles
In collection:
Cardiology articles
J Exp Biol (2022) 225 (12): jeb243680.
Published: 22 June 2022
... =0.001, paired t -test) than the RCR for the other replicates from the same hearts (10.3±2.5, mean±s.d., n =8), indicating poorly coupled mitochondria. These replicates were removed from the analyses. In addition, the ventricle of one of the smaller fish yielded only one sample of myocardial tissue...
Includes: Supplementary data
Journal Articles
In collection:
Cardiology articles
J Exp Biol (2022) 225 (12): jeb242771.
Published: 14 June 2022
...James Robertson; Andrew Jeffs; Christopher Hedges; Anthony J. R. Hickey ABSTRACT The anaesthetic isoeugenol has been used as metabolic suppressant for commercial transport of live lobsters in order to decrease energy expenditure and improve survival. Given the central role of mitochondria...
Journal Articles
J Exp Biol (2022) 225 (6): jeb243740.
Published: 16 March 2022
... 2 O 2 production is proportional to changes in the fluorometric signal generated by Amplex Red (Cayman Chemical, Ann Arbor, MI, USA). Following the addition of isolated mitochondria and respiration buffer (see above), we added 10 μmol l −1 Amplex Red and 2 U horseradish peroxidase. We also added 5...
Journal Articles
J Exp Biol (2022) 225 (Suppl_1): jeb243351.
Published: 8 March 2022
..., mitochondria and hypoxia-inducible factors, as well as convergent pathways involved in energy regulation, development, reproductive investment and energy storage. The details of these mechanisms are only known from a few model systems, and more comparative studies are needed. We make two main recommendations...
Journal Articles
J Exp Biol (2022) 225 (4): jeb196725.
Published: 21 February 2022
... et al., 2009 ; Peterson et al., 2012b ). Furthermore, at the organelle level and relative to mice, NMR brain mitochondria better retain respiration capacity, have lower H 2 O 2 emission rates and stable respiratory coupling ratios, and better maintain membrane integrity following in vitro...
Journal Articles
J Exp Biol (2022) 225 (1): jeb243304.
Published: 11 January 2022
... availability during hypoxia–reoxygenation (H/R). We investigated the effects of acute H/R stress (15 min at ∼0% O 2 and 10 min reoxygenation) on isolated mitochondria from the gill and the digestive gland of C. gigas respiring on different substrates (pyruvate, glutamate, succinate, palmitate...
Journal Articles
J Exp Biol (2021) 224 (21): jeb243082.
Published: 9 November 2021
... for its hypoxia tolerance associated with metabolic rate depression, yet the mechanisms that sustain mitochondrial function during oxygen fluctuations are not well understood. We used top-down metabolic control analysis (MCA) to determine aerobic capacity and control over oxygen flux in the mitochondria...
Includes: Supplementary data
Journal Articles
J Exp Biol (2021) 224 (18): jeb242634.
Published: 22 September 2021
... confirmed the involvement of K ATP in mitochondria with TMRE imaging, as hypoxia rapidly (<5 min) depolarized mitochondria in a mK ATP channel-sensitive manner. We conclude that mK ATP channels initiate a neuroprotective pathway in goldfish HCs to maintain [Ca 2+ ] i and avoid excitotoxicity in hypoxia...
Journal Articles
J Exp Biol (2021) 224 (17): jeb215764.
Published: 6 September 2021
... of hydrogen sulfide in mammalian hibernation, particularly on the mechanisms for the suppression of mitochondrial respiration during torpor. H 2 S Hypometabolism Mitochondria Sulfide:quinone oxidoreductase Hibernation Novo Nordisk Fonden http://dx.doi.org/10.13039/501100009708...
Journal Articles
J Exp Biol (2021) 224 (17): jeb242745.
Published: 3 September 2021
..., indicating the important role of acclimation in their capacity to adjust to thermal challenges. Climate change Mitochondria Reactive oxygen species Aquatic ectotherms Thermal sensitivity Metabolism Groupe de Recherche Interuniversitaire en Limnologie Natural Sciences...
Includes: Supplementary data
Journal Articles
J Exp Biol (2021) 224 (10): jeb242279.
Published: 1 June 2021
... respirometry on isolated iBAT mitochondria using substrates and inhibitors targeted to UCP-1. We found that rates of NST increased with cold hypoxia acclimation but only in highland deer mice. There was no effect of cold hypoxia acclimation on iBAT mass in any group, but highland deer mice showed increases...
Journal Articles
In collection:
Cardiology articles
J Exp Biol (2021) 224 (9): jeb242382.
Published: 30 April 2021
...Jakob Michaelsen; Angela Fago; Amanda Bundgaard ABSTRACT Mitochondria provide cellular energy through oxidative phosphorylation, and thus temperature-induced constraints on mitochondrial function may be crucial to animal aerobic scope and thermal tolerance. Here, we report the effect of temperature...
Journal Articles
J Exp Biol (2020) 223 (21): jeb233684.
Published: 4 November 2020
... to conserve oxygen. The aim of the present study was to determine in vitro whether skeletal muscle mitochondria become more ‘thermogenic’ to sustain heat production or more ‘economical’ to conserve oxygen in sea-acclimatized immature penguins (hereafter ‘immatures’) compared with terrestrial juveniles. Rates...
Journal Articles
J Exp Biol (2020) 223 (20): jeb227801.
Published: 27 October 2020
... of mitochondrial processes, as mitochondria play a crucial role in animals as the primary site of ATP production. Conventional measures of mitochondrial performance suggest that these organelles can function at temperatures much higher than those that limit whole-organism function, suggesting...
Includes: Supplementary data
Journal Articles
J Exp Biol (2020) 223 (15): jeb222513.
Published: 4 August 2020
... of natural stressful developmental conditions reveals that glucocorticoid hormones induce telomere shortening by decreasing mitochondrial efficiency without altering oxidative stress, suggesting that telomeres are costly to maintain. Mitochondria Metabolism Proton leak Oxidative stress Telomere...
Includes: Supplementary data
Journal Articles
J Exp Biol (2020) 223 (12): jeb223776.
Published: 17 June 2020
..., and that 90% of CI is found in this highly stable SC. Interestingly, the presence of stable SCs did not prevent mitochondrial H 2 O 2 production and was not associated with elevated respiration rates of mitochondria isolated from the examined species. Together, these data show that SC stability varies among...
Includes: Supplementary data
Journal Articles
J Exp Biol (2020) 223 (2): jeb215921.
Published: 29 January 2020
... such as freshwater mussels. However, some species seem to thrive more than others in face of temperature-related stressors. Thermal tolerance may, for example, explain the success of invasive species. It is also known that mitochondria can play a key role in setting an ectothermic species' thermal tolerance...
Includes: Supplementary data
Journal Articles
J Exp Biol (2019) 222 (18): jeb203687.
Published: 18 September 2019
...: TCGTCCCAGTTGGTGACGAT). Fish Mitophagy Mitochondria ER stress DNA and histone methylation Nutritional programming For more than 20 years, it has been widely accepted that nutritional stimuli (quantity or quality of nutrients) experienced at critical periods of an organism's life can result...