ABSTRACT

Alterations to the gut microbiome caused by changes in diet, consumption of antibiotics, etc., can affect host function. Moreover, perturbation of the microbiome during critical developmental periods potentially has long-lasting impacts on hosts. Using four selectively bred high runner and four non-selected control lines of mice, we examined the effects of early-life diet and exercise manipulations on the adult microbiome by sequencing the hypervariable internal transcribed spacer region of the bacterial gut community. Mice from high runner lines run ∼3-fold more on wheels than do controls, and have several other phenotypic differences (e.g. higher food consumption and body temperature) that could alter the microbiome, either acutely or in terms of coevolution. Males from generation 76 were given wheels and/or a Western diet from weaning until sexual maturity at 6 weeks of age, then housed individually without wheels on standard diet until 14 weeks of age, when fecal samples were taken. Juvenile Western diet reduced bacterial richness and diversity after the 8-week washout period (equivalent to ∼6 human years). We also found interactive effects of genetic line type, juvenile diet and/or juvenile exercise on microbiome composition and diversity. Microbial community structure clustered significantly in relation to both line type and diet. Western diet also reduced the relative abundance of Muribaculum intestinale. These results constitute one of the first reports of juvenile diet having long-lasting effects on the adult microbiome after a substantial washout period. Moreover, we found interactive effects of diet with early-life exercise exposure, and a dependence of these effects on genetic background.

INTRODUCTION

Animals have evolved in a bacterial world. Coevolution between hosts and symbionts has resulted in complex relationships, wherein the diverse community of species inhabiting the gastrointestinal tract in mammals is essential for breaking down nutrients from ingested food, normal metabolic function and protection through enhanced immunity (Dominguez-Bello et al., 2019; Gilbert et al., 2018; Kohl and Carey, 2016). Many factors have been shown to influence the gut microbial community and diversity, including diet, exercise, antibiotics and age (Bokulich et al., 2016; Clark and Mach, 2016; Lozupone et al., 2012; Yatsunenko et al., 2012). Alterations to the community can result in potentially irreversible (Dethlefsen and Relman, 2011; Langdon et al., 2016) changes in the microbiome. Compositional changes in the gut microbiome can, in turn, affect many aspects of host biology, including physiology and behavior.

Diet can rapidly alter the gut microbiome community in as short as 24 h (David et al., 2014). For example, many laboratory studies of adult rodents have shown that a typical Western diet (high in fat and sugar) alters the gut microbiome community and reduces diversity of bacterial species (Becker et al., 2020; Beilharz et al., 2017; Leamy et al., 2014; Pindjakova et al., 2017; Turnbaugh et al., 2008). In multiple strains of inbred, outbred and transgenic mice, a shift in diet can have lasting effects on the community, as repetitive switching from a high-fat, high-sugar diet to a low-fat diet results in altered community membership and composition that does not revert to the original state (Carmody et al., 2015). Rodent studies also indicate that diet can alter microbial function. For example, adult mice fed a high-fat diet for 12 weeks had unique gut microbiome communities, increased body mass, and altered gut bacterial function as measured by metaproteome and metabolome analyses (Daniel et al., 2014). In that study, high-fat diet led to an increase in amino acid metabolism and enzymes involved in the oxidative stress response, possibly in response to the shift in nutrient availability within the gut.

Acute and chronic exercise can also affect the microbiome (Clark and Mach, 2016; Codella et al., 2018; Mach and Fuster-Botella, 2017; Mailing et al., 2019; O'Sullivan et al., 2015; Scheiman et al., 2019). The first paper highlighting the relationship between exercise and the microbiome found that adult rats with wheel access for 5 weeks had an increased amount of cecal n-butyrate, a short-chain fatty acid byproduct of bacterial fermentation (Matsumoto et al., 2008). Butyrate can be transported from the small intestine to muscles, where it can lead to activation of several regulatory pathways linked to ATP production as well as muscle integrity, thus potentially altering athletic ability and/or performance (Ticinesi et al., 2017; Walsh et al., 2015). Approaches for measuring the effect of exercise on the gut microbiome vary widely in the literature, but consistent trends in results are emerging. For example, both rodent and human studies have reported increased butyrate-producing bacteria (Barton et al., 2018; Matsumoto et al., 2008), and also increases in taxa such as Lactobacillus (Batacan et al., 2017; Lambert et al., 2014; Petriz et al., 2014; Queipo-Ortuño et al., 2013), Bifidobacterium (Bressa et al., 2017; Lambert et al., 2014; Queipo-Ortuño et al., 2013) and Akkermansia (Barton et al., 2018; Bressa et al., 2017; Clarke et al., 2014; Liu et al., 2015). In amateur half-marathon runners, the relative abundances of several bacterial taxa and fecal metabolites were significantly different pre- and post-race (Zhao et al., 2018).

Diet and exercise have also been shown to interactively influence the gut microbiome community and diversity in rodents (Batacan et al., 2017; Denou et al., 2016; Evans et al., 2014). Mice placed on a high-fat diet for 6 weeks followed by 6 weeks of high-intensity interval training had greater bacterial diversity in the feces compared with sedentary mice on standard chow (Denou et al., 2016). Exercise-trained mice on a high-fat diet had significant changes in the relative abundance of the phylum Bacteroidetes in the small intestine, cecum and colon compared with mice on a high-fat diet without exercise training. In another study on the interactions between exercise and diet, mice given 12 weeks of voluntary wheel access on a standard or high-fat diet had higher diversity than sedentary controls as well as significant main effects of diet, exercise and their interactions on taxa relative abundance (Evans et al., 2014). More specifically, that study found an increase in the relative abundance of butyrate-producing taxa in the Clostridiales order compared with sedentary mice. In rats, high-intensity and light-intensity interval training regimens resulted in unique microbiome communities regardless of whether they were on a high-fat, high-fructose diet or a standard diet (Batacan et al., 2017). The scarcity of studies examining diet–exercise interactions highlights the need for more research in this growing field.

In mammals, the period of development from weaning to sexual maturity is a crucial time during which environmental conditions can have a lasting impact on many traits (Garland et al., 2017), including normal development of the microbiome (Kerr et al., 2015). Immediately after birth, initial colonizers of the gut microbiome in placental mammals are dominated by microbes from the mother, followed by further acquisitions from the early-life environment (Funkhouser and Bordenstein, 2013; Milani et al., 2017). A clear example of developmental effects on the gut microbiome is early-life diet: babies that are breastfed have a unique microbiome compared with those fed formula (Sprockett et al., 2018), and have higher bacterial diversity during the first 12–24 months of age (Bokulich et al., 2016). In mice, early-life antibiotic treatment followed by placement on a high-fat, high-sugar diet as adults results in increased adult adiposity and an increase in the ratio of Firmicutes to Bacteroidetes as compared with mice on a normal diet (Schulfer et al., 2019). In a recent study, juvenile mice given 3 weeks of high-fat diet or cafeteria diet starting at 4 weeks of age followed by an approximately 7-week-long washout period had altered adult gut microbiome communities (Fülling et al., 2020). More specifically, mice with a juvenile high-fat diet had reduced diversity of the adult gut microbiome at approximately 14 weeks of age. However, only one study has tested whether early-life effects of exercise on the microbiome can persist after a substantial washout period. Mika et al. (2015) found that after a 25-day washout period, rats with 6 weeks of juvenile wheel access tended to have decreased Firmicutes abundance as adults.

The first goal of the present study was to test for long-lasting effects of early-life Western diet and exercise on the adult microbiome. To do so, we used a unique animal model: four lines of high runner (HR) mice that have been selectively bred for high voluntary wheel-running behavior and their four non-selected control (C) lines (Swallow et al., 1998). The HR mice differ from C mice in several ways that might affect the microbiome through alterations in the gut environment. HR mice have higher activity levels and food consumption even when housed without wheels, and increased body temperature when active (Copes et al., 2015; Malisch et al., 2009; Swallow et al., 2009; Wallace and Garland, 2016), all of which might affect the gut environment. In the absence of compensatory reductions in other aspects of physical activity, exercise leads to increased energy expenditure and hence necessitates greater food consumption (Garland et al., 2011), which should directly impact the gut microbiome. Exercise also causes many acute changes in physiology, including increases in body temperature, and changes in hormone levels, intestinal barrier function and digestive transit time that could feedback into the gut environment (Campbell and Wisniewski, 2017; Mach and Fuster-Botella, 2017). HR and C mice also differ in circulating concentrations of hormones (Garland et al., 2016). When housed without wheels, HR and C mice do not differ in small or large intestine mass or length, suggesting that the former might have faster digestive throughput (Kelly et al., 2017). Therefore, our second goal was to test for microbiome differences between the HR and C lines, which could result from acute effects of the noted phenotypic differences. Another possibility is coevolution of the gut microbiome across many tens of generations of selective breeding, but we cannot differentiate that from acute/chronic effects of exercise with the present experimental design. Our analyses also considered the possibility of interactive effects, e.g. that genetic background (Benson et al., 2010; Carmody et al., 2015; Leamy et al., 2014) might influence whether and how early-life Western diet or exercise opportunity affects the adult microbiome.

MATERIALS AND METHODS

All experiments and methods were approved by the Institutional Animal Use and Care Committee of the University of California, Riverside.

Experimental animals

Mice were sampled from generation 76 of an ongoing selection experiment selecting for high voluntary wheel-running behavior. Four replicate HR lines were bred for high levels of voluntary wheel running and were compared with four non-selected C lines. The base population was 224 outbred Hsd:ICR laboratory house mice (Swallow et al., 1998). Mice were weaned at 21 days of age and housed four per cage separated by line and sex until ∼6–8 weeks of age. Mice were then placed into individual cages attached to a 1.12 m circumference wheel (Lafayette Instruments, Lafayette, IN, USA) with a sensor to record the total number of revolutions per day (e.g. see Swallow et al., 1998). For HR mice, the highest running male and female from each family based on the average revolutions on days 5 and 6 of a 6-day period of wheel access were chosen as breeders for the next generation. Breeders in the C lines were chosen without regard to how much they run. Each generation had ∼10 breeding pairs per line, and sibling pairings were not allowed.

Early-life diet and exercise treatment

A total of 165 male mice, sampled approximately equally from the four replicate HR and four non-selected C lines, were weaned at 21 days of age and placed into one of four treatment groups for 3 weeks: (1) standard diet, no wheels; (2) Western diet, no wheels; (3) standard diet, wheels; and (4) Western diet, wheels (see Fig. 1). Mice were provided with ad libitum food and water for the duration of the experiment. Standard Laboratory Rodent Diet (SD) from Harlan Teklad (W-8604) contained 4% kJ from fat and the Western diet (WD) from Harland Teklad (TD.88137) contained 42% kJ from fat. After the 3 weeks of juvenile exposure, which allowed them to reach sexual maturity, all mice were housed individually without wheel access on standard diet for an 8-week washout period (equivalent to approximately 6 human years: Dutta and Sengupta, 2016). Mice were maintained in rooms with lights on at 07:00 Pacific Standard Time for a 12 h:12 h light:dark photoperiod, and at approximately 22°C.

Fig. 1.

Early-life experimental design and treatment groups (N=149 mice). Fecal sampling occurred as adults (14 weeks of age) after the 8-week washout period on standard diet with no wheel access.

Fig. 1.

Early-life experimental design and treatment groups (N=149 mice). Fecal sampling occurred as adults (14 weeks of age) after the 8-week washout period on standard diet with no wheel access.

Juvenile wheel running

Juvenile wheel running was measured during weeks 3–6 of the early-life diet and/or exercise manipulation. Mice were housed individually in home cages with attached wheels, as used during the routine selective breeding protocol (Swallow et al., 1998). Sensors attached to the wheel record the number of revolutions in each 1-min interval during a 23 h measurement period. We measured wheel freeness by recording the number of revolutions per wheel until it reached a stop after accelerating each wheel to a constant speed (Copes et al., 2015).

Juvenile food consumption

Juvenile food consumption was measured during weeks 3–6 of the early-life diet and/or exercise manipulation. Food hoppers were weighed at the start and end of each week to measure apparent food consumption after accounting for food wasting (Koteja et al., 2003). Food consumption was converted to caloric intake as the diets differed in energy content (Meek et al., 2010).

Fecal sampling

At 14 weeks of age, individual mice were placed into a clean, empty cage and watched until defecation. We obtained fecal samples from 149 individuals. The samples were placed into a sterile tube and held on dry ice prior to storage at −80°C, where they remained until DNA extraction.

Bacterial rRNA ITS analysis

Illumina bacterial rRNA internal transcribed spacer (ITS) libraries were constructed as follows. PCRs were performed using a DNA Engine thermal cycler (Bio-Rad Inc., Hercules, CA, USA) as 25-µl reactions containing: 50 mmol l−1 Tris (pH 8.3), bovine serum albumin (BSA) at 500 µg ml−1, 2.5 mmol l−1 MgCl2, 250 µmol l−1 of each deoxynucleotide triphosphate (dNTP), 400 nmol l−1 of the forward PCR primer, 200 nmol l−1 of each reverse PCR primer, 2.5-µl of DNA template, and 0.625 units JumpStart Taq DNA polymerase (Sigma-Aldrich, St Louis, MO, USA). PCR primers targeted a portion of the small-subunit (ITS-1507F, GGTGAAGTCGTAACAAGGTA) and large-subunit (ITS-23SR, GGGTTBCCCCATTCRG) rRNA genes and the hypervariable ITS region (Ruegger et al., 2014), with the reverse primers including a 12-bp barcode and both primers including the sequences needed for Illumina cluster formation; primer binding sites are the reverse and complement of the commonly used small-subunit rRNA gene primer 1492R (Frank et al., 2008) and the large-subunit rRNA gene primer 129F (Hunt et al., 2006). PCR primers were only frozen and thawed once. Thermal cycling parameters were as follows: 94°C for 5 min; 35 cycles of 94°C for 20 s, 56°C for 20 s and 72°C for 40 s; followed by 72°C for 10 min. PCR products were purified using a Qiagen QIAquick PCR Purification Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. DNA sequencing (single-end 250 base) was performed using an Illumina MiSeq (Illumina, Inc., San Diego, CA, USA). Clusters were created using template concentrations 2.5 pmol l−1 and phi X at 107,000 mm−2.

Data processing was performed with USEARCH v10.0 (Edgar, 2010). We used the UPARSE pipeline for de-multiplexing, length trimming, quality filtering and operational taxonomic unit (OTU) picking using default parameters or recommended guidelines that were initially described in Edgar (2013) and which have been updated at https://www.drive5.com/usearch/manual10/uparse_pipeline.html. Briefly, after demultiplexing and using the recommended 1.0 expected error threshold, sequences were trimmed to a uniform length of 248 bp and then dereplicated. Dereplicated sequences were subjected to error correction (denoised) and chimera filtering to generate zero-radius operational taxonomic units (ZOTUs) using UNOISE3 (Edgar, 2016b preprint). An OTU table was then generated using the otutab command. ZOTUs with non-bacterial DNA were identified and enumerated by performing a local BLAST search (Altschul et al., 1990) of their seed sequences against the nucleotide database. ZOTUs were removed if any of their highest scoring BLAST hits contained taxonomic IDs within the rodent family, Fungi, Viridiplantae or phi X. Taxonomic assignments to bacterial ZOTUs were made with the SINTAX taxonomy prediction algorithm (Edgar, 2016a preprint) on an updated SSU-ITS database (Ruegger et al., 2014). This resulted in 2730 OTUs with an average of 47,851 sequences per sample. Data were normalized within each sample by dividing the number of reads in each OTU by the total number of reads in that sample.

The bacterial rRNA ITS sequences were deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under SRA BioProject Accession PRJNA624662.

Statistical analyses

Juvenile wheel running and food consumption

As used in numerous previous studies of these lines of mice, we used linear mixed models in SAS 9.4 Proc Mixed (SAS Institute, Cary, NC, USA). The effect of line type is tested against the variance among replicate lines, which are a nested random effect within line type. Wheel access×line(line type), diet×line(line type) and wheel access×diet×line(line type) were also nested random effects. In these full models, the effects of wheel access, diet, line type and their interactions were tested with 1 and 6 degrees of freedom. If the covariance parameter estimate for higher-order random effects was zero, we removed them in a stepwise fashion. In other words, if the covariance parameter estimate for the three-way interaction was 0, we removed the wheel access×diet×line(line type) random effect. Then, if one of the two-way random interaction effects was also zero, we removed it. However, we always retained the line(line type) random effect, given the nature of the experimental design (e.g. see Castro and Garland, 2018; Castro et al., 2020; Swallow et al., 1998). For juvenile wheel running, we included wheel freeness as a covariate in the model. For caloric intake, we included body mass as a covariate.

In these statistical models, we also tested for effects of the mini-muscle phenotype (present in two of the HR lines) on juvenile wheel running, juvenile caloric intake, adult gut microbiome richness and relative abundance. The mini-muscle phenotype is caused by an autosomal recessive allele, a single base pair change in a myosin heavy chain gene (Kelly et al., 2013). Homozygotes for this naturally occurring mutation are characterized by a 50% reduction in hindlimb muscle mass, larger internal organs and various other differences as compared with unaffected individuals (Garland et al., 2002; Swallow et al., 2009; Wallace and Garland, 2016). In the present study, the number of mini-muscle individuals varied among analysis. For example, of the 88 mice for which we obtained wheel-running data during week 1 of juvenile exposures, 12 had the mini-muscle phenotype (all nine in line 3 and three of 11 in line 6). Of the 165 mice for which we obtained week 1 food consumption data, 43 had the mini-muscle phenotype (all 21 in line 3 and five of 22 in line 6). Of the 149 mice for which we obtained microbiome data, 25 had the mini-muscle phenotype (all 20 in line 3 and five of 20 in line 6).

Beta diversity of the adult gut microbiome

Gut microbiome membership and community structure were compared by calculating unweighted UniFrac and Hellinger distance matrices in QIIME version 1.9.1. Unweighted UniFrac distance utilizes the presence and absence of bacterial species while accounting for the phylogenetic relationship between bacterial species. For statistical and graphical representation, we used an OTU table rarified to an even sequencing depth of 14,000 reads per sample. We used a principal coordinates analysis (PCoA) to visualize the communities in a 3D space. For beta diversity, we used a PERMANOVA test in QIIME to determine statistical significance (Anderson, 2001). For these tests we did not treat replicate line as a nested random effect because the software to do this is not currently available.

Alpha diversity of the adult gut microbiome

To determine the effects of diet, exercise, line type and their interactions on alpha diversity of the adult gut microbiome, we used the Chao1 index and Shannon index calculated in QIIME Version 1.9.1 from an OTU table rarified to the lowest common sequencing depth of 14,000 reads. We also totaled the number of non-zero OTUs identified in each mouse using the rarified OTU table. We used the statistical procedures described above in ‘Juvenile wheel running and food consumption’. Because ANOVAs have relatively low power to detect interactions (Wahlsten, 1990), and following our laboratory's previous analyses of these mice (e.g. Belter et al., 2004; Houle-Leroy et al., 2000), we considered interactions significant if P<0.10.

Lower-level taxa summary comparisons

We compared the relative abundance data of identified phylum, class, order, family, genus and species groups produced by the summarize_taxa.py script in QIIME. Based on the simulations reported by Aschard et al. (2019), we only analyzed taxa found in >85% of the mice [phylum (N=6), class (N=9), order (N=8), family (N=16), genus (N=17), species (N=26) and OTUs (N=140, of the total 2730 identified OTUs)], which totaled 221 tests and 1761 P-values. We used the statistical procedures described above in ‘Juvenile wheel running and food consumption’. Bacterial relative abundance data were log or arcsine square-root transformed to normalize residuals (Brown et al., 2020; Kohl et al., 2016). P-values were corrected for multiple comparisons using the false discovery rate (FDR; Benjamini and Hochberg, 1995). For these analyses, we accepted statistical significance at P<0.05 after adjustment for FDR.

RESULTS

Line type, diet and exercise affect juvenile wheel running and food consumption

Diet had an interactive effect on wheel running across the 3 weeks of early-life exposure (full statistical results are in Table S1). During the first week, Western diet increased wheel running, but the effect was greater in HR mice (interaction F1,76=7.62, P=0.0072; Fig. 2A), and mini-muscle mice ran more than normal-muscle mice (F1,76=6.12, P=0.0156). During the second week, mice with a Western diet continued to run significantly more than those with standard diet, and HR mice ran 2.6-fold more revolutions per day than C mice, with no interaction between diet and line type (interaction F1,76=0.51, P=0.4765; Fig. 2A). By the third week of juvenile wheel access, HR mice ran 3.4-fold more than C mice and diet no longer significantly affected wheel running.

Fig. 2.

Weekly revolutions per day and caloric intake in response to juvenile diet and/or exercise treatment. Data are presented as untransformed least squares means±s.e.m. (values for mini-muscle versus normal-muscle mice are not shown). Shown above each week are the significant main effects and interactions (two-tailed ANCOVAs P<0.05, not adjusted for multiple comparisons). Full statistical results are in Table S1. (A) Weekly juvenile wheel running for half of the mice during the 3 weeks of early-life exposure (N=88). (B) Weekly mass-adjusted juvenile caloric intake during the 3 weeks of early-life exposure (N=165).

Fig. 2.

Weekly revolutions per day and caloric intake in response to juvenile diet and/or exercise treatment. Data are presented as untransformed least squares means±s.e.m. (values for mini-muscle versus normal-muscle mice are not shown). Shown above each week are the significant main effects and interactions (two-tailed ANCOVAs P<0.05, not adjusted for multiple comparisons). Full statistical results are in Table S1. (A) Weekly juvenile wheel running for half of the mice during the 3 weeks of early-life exposure (N=88). (B) Weekly mass-adjusted juvenile caloric intake during the 3 weeks of early-life exposure (N=165).

During the first week of early-life exposure, diet and wheel access had an interactive effect on caloric intake (interaction F1,143=26.62, P<0.0001; Fig. 2B). Western diet increased caloric intake in all groups, by ∼21% on average (F1,143=313.25, P<0.0001; Fig. 2B). However, wheel access increased intake in mice on a standard diet but decreased it in those on a Western diet. During the second week, mice on the Western diet had increased caloric intake (F1,6=37.71, P=0.0009; Fig. 2B) and those with wheels consumed more than mice without wheels (F1,6=25.18, P=0.0024; Fig. 2B). In the third week, mice with wheels again consumed more calories than those without wheels (F1,6=84.23, P<0.0001; Fig. 2B), but the effect of diet was no longer significant. Mini-muscle mice consumed significantly more food than normal-muscle mice during both weeks 2 (F1,137=5.55, P=0.0199) and 3 (F1,136=4.97, P=0.0274).

Dominant phyla of the adult gut microbiome

The 2730 identified OTUs were classified into seven phyla, 22 classes, 36 orders, 58 families, 79 genera and 112 species. Community composition for the entire set of experimental mice (N=149) was dominated by the phyla Bacteroidetes (68.1±17.4%) (mean±s.d.) and Firmicutes (27.9±16.7%), with additional phyla being much less abundant: Proteobacteria (1.2±2.1%), Candidatus Melanobacteria (0.3±0.6%), Tenericutes (0.2±0.3%) and Actinobacteria (0.05±0.04%) (Fig. 3).

Fig. 3.

Community composition of the adult gut microbiome for all experimental mice (N=149). Bars represent the mean relative abundance of the three main phyla found in greater than 1% of the population, separated by treatment group. C, control; HR, high running; SD, standard diet; WD, Western diet.

Fig. 3.

Community composition of the adult gut microbiome for all experimental mice (N=149). Bars represent the mean relative abundance of the three main phyla found in greater than 1% of the population, separated by treatment group. C, control; HR, high running; SD, standard diet; WD, Western diet.

Juvenile diet and line type affect adult community membership (Beta diversity)

Community membership measured by unweighted UniFrac distance and by Hellinger distance plotted in a PCoA plot (Figs 4 and 5, respectively; corresponding statistical results in Tables 1 and 2, respectively) showed clustering of mice by line type and by juvenile diet exposure. HR and C mice significantly clustered independent of one another (PERMANOVA, F1,147=1.56, P=0.009, Fig. 4A; PERMANOVA, F1,147=2.31, P=0.001, Fig. 5A). Mice fed a juvenile Western diet resulted in significant clustering of samples compared with mice fed a juvenile standard diet (PERMANOVA, F1,147=2.72, P=0.001, Fig. 4B; PERMANOVA, F1,147=2.85, P=0.001, Fig. 5B). Within both HR and C line types, mice clustered together by diet (C, F1,75=1.64, P=0.007; HR F1,70=0.001, P=0.001: Fig. S1F). Wheel access did not result in significant clustering within line types (PERMANOVA, F1,70=1.30, P=0.072, Fig. S1G). HR mice also clustered independently by diet (PERMANOVA, F1,70=3.783, P=0.001, Fig. S2F).

Fig. 4.

Community membership of the adult gut microbiome principal coordinate analysis (PCoA) using unweighted UniFrac distances. (A) Clustering of mice by high runner (N=72) and control (N=77) lines of mice (PERMANOVA, F1,147=1.56, R2=0.010, P=0.009). (B) Clustering of mice by Western diet (N=77) and standard diet (N=72) (PERMANOVA, F1,147=2.72, R2=0.018, P=0.001). (C) Clustering of mice by wheel access (N=75) and no wheel access (N=74) (PERMANOVA, F1,147=1.24, R2=0.008, P=0.096). Results of statistical analyses are shown in Table 1.

Fig. 4.

Community membership of the adult gut microbiome principal coordinate analysis (PCoA) using unweighted UniFrac distances. (A) Clustering of mice by high runner (N=72) and control (N=77) lines of mice (PERMANOVA, F1,147=1.56, R2=0.010, P=0.009). (B) Clustering of mice by Western diet (N=77) and standard diet (N=72) (PERMANOVA, F1,147=2.72, R2=0.018, P=0.001). (C) Clustering of mice by wheel access (N=75) and no wheel access (N=74) (PERMANOVA, F1,147=1.24, R2=0.008, P=0.096). Results of statistical analyses are shown in Table 1.

Fig. 5.

Community membership of the adult gut microbiome PCoA using a Hellinger distance matrix. (A) Clustering of mice by high runner (N=72) and control (N=77) lines of mice (PERMANOVA, F1,147=2.31, R2=0.015, P=0.001). (B) Clustering of mice by Western diet (N=77) and standard diet (N=72) (PERMANOVA, F1,147=2.85, R2=0.019, P=0.001). (C) Clustering of mice by wheel access (N=75) and no wheel access (N=74) (PERMANOVA, F1,147=0.99, R2=0.007, P=0.483). Results of statistical analyses are shown in Table 2.

Fig. 5.

Community membership of the adult gut microbiome PCoA using a Hellinger distance matrix. (A) Clustering of mice by high runner (N=72) and control (N=77) lines of mice (PERMANOVA, F1,147=2.31, R2=0.015, P=0.001). (B) Clustering of mice by Western diet (N=77) and standard diet (N=72) (PERMANOVA, F1,147=2.85, R2=0.019, P=0.001). (C) Clustering of mice by wheel access (N=75) and no wheel access (N=74) (PERMANOVA, F1,147=0.99, R2=0.007, P=0.483). Results of statistical analyses are shown in Table 2.

Table 1.

Community membership of the adult gut microbiome assessed by PERMANOVA statistical tests using unweighted UniFrac distances

Community membership of the adult gut microbiome assessed by PERMANOVA statistical tests using unweighted UniFrac distances
Community membership of the adult gut microbiome assessed by PERMANOVA statistical tests using unweighted UniFrac distances
Table 2.

Community membership of the adult gut microbiome assessed by PERMANOVA statistical tests using a Hellinger distance matrix

Community membership of the adult gut microbiome assessed by PERMANOVA statistical tests using a Hellinger distance matrix
Community membership of the adult gut microbiome assessed by PERMANOVA statistical tests using a Hellinger distance matrix

Early-life exposures, line type and their interactions affect adult gut microbiome richness (alpha diversity)

For the total number of OTUs, early-life diet and exercise exposures altered the adult gut microbial richness in a line-type-dependent manner: the three-way interaction of juvenile diet, wheel access and line type was significant (interaction F1,128=2.83, P=0.095; Fig. 6A). Early-life Western diet tended to have a lasting impact on gut microbiome diversity by reducing the total OTUs (ANOVA, F1,6=5.67, P=0.055; Fig. 6A).

Fig. 6.

Alpha diversity metrics of the adult gut microbiome (N=149 mice). Data are presented as untransformed least squares means±s.e.m. (A) Total operational taxonomic units (OTUs) when the OTU table was rarified to an even number of reads per sample. The three-way interaction between juvenile diet, exercise and line type on fecal bacterial richness was significant (two-tailed ANOVA interaction, F1,128=2.83, P=0.095, not adjusted for multiple comparisons). Early-life exposure to Western diet tended to have a lasting impact on gut microbiome diversity by reducing the total OTUs (two-tailed ANOVA, F1,6=5.67, P=0.055, not adjusted for multiple comparisons). (B) Chao1 index. The three-way interaction between Western diet, exercise and line type was statistically significant (two-tailed ANOVA interaction, F1,128=6.39, P=0.013, not adjusted for multiple comparisons). Early-life exposure to Western diet tended to have a lasting impact on the gut microbiome by reducing adult gut community richness (two-tailed ANOVA, F1,6=5.68, P=0.054, not adjusted for multiple comparisons). (C) The Shannon index was not significantly affected by any experimental factor.

Fig. 6.

Alpha diversity metrics of the adult gut microbiome (N=149 mice). Data are presented as untransformed least squares means±s.e.m. (A) Total operational taxonomic units (OTUs) when the OTU table was rarified to an even number of reads per sample. The three-way interaction between juvenile diet, exercise and line type on fecal bacterial richness was significant (two-tailed ANOVA interaction, F1,128=2.83, P=0.095, not adjusted for multiple comparisons). Early-life exposure to Western diet tended to have a lasting impact on gut microbiome diversity by reducing the total OTUs (two-tailed ANOVA, F1,6=5.67, P=0.055, not adjusted for multiple comparisons). (B) Chao1 index. The three-way interaction between Western diet, exercise and line type was statistically significant (two-tailed ANOVA interaction, F1,128=6.39, P=0.013, not adjusted for multiple comparisons). Early-life exposure to Western diet tended to have a lasting impact on the gut microbiome by reducing adult gut community richness (two-tailed ANOVA, F1,6=5.68, P=0.054, not adjusted for multiple comparisons). (C) The Shannon index was not significantly affected by any experimental factor.

The three-way interaction of juvenile diet, exercise and line type was significant for the Chao1 index, a corrected index of gut microbial richness that accounts for rarer taxa (interaction F1,128=2.83, P=0.013; Fig. 6B). Early-life exposure to Western diet tended to have a lasting impact on the gut microbiome by reducing adult gut community richness (ANOVA, F1,6=5.68, P=0.054; Fig. 6B). The Shannon index, another measure of gut microbial richness that accounts for the abundance of taxa in a sample, was not statistically different among groups (Fig. 6C).

Juvenile Western diet affects adult gut microbiome community

Of the 1760 P-values tested, only two remained significant at P<0.05 after correcting for multiple comparisons using a Benjamini and Hochberg FDR (see Table S2 for phylum through genus P-values before FDR). Western diet significantly reduced the relative abundance of the family Muribaculaceae, which is commonly found in the mouse gut microbiome (ANOVA, F1,128=19.2, P=0.021). This decrease is explained by the gut bacterial species Muribaculum intestinale, which was found in all mice from our study (ANOVA, F1,128=19.2, P=0.021; Fig. 7). Muribaculum intestinale made up 0.38% of the identified OTUs. Mini-muscle mice did not significantly differ in the relative abundance of any of the tested taxa.

Fig. 7.

Relative abundance of the species Muribaculum intestinale (N=149 mice). Data are presented as transformed least squares means±s.e.m. Mice with juvenile exposure to Western diet had a significantly lower relative abundance of the species M. intestinale (two-tailed ANOVA, F1,128=19.2; FDR-adjusted P=0.0213).

Fig. 7.

Relative abundance of the species Muribaculum intestinale (N=149 mice). Data are presented as transformed least squares means±s.e.m. Mice with juvenile exposure to Western diet had a significantly lower relative abundance of the species M. intestinale (two-tailed ANOVA, F1,128=19.2; FDR-adjusted P=0.0213).

DISCUSSION

Our results constitute one of the first reports of juvenile diet having long-lasting effects on the adult microbiome after a substantial washout period (equivalent to ∼6 human years). Moreover, we found interactive effects of diet with early-life exercise exposure, and a dependence of these effects on genetic background. The overall bacterial community composition that we found (Fig. 3) is similar to that reported in many other studies of adult laboratory house mice (e.g. Benson et al., 2010; Lamoureux et al., 2017). However, beta diversity metrics indicated that community membership was unequal between the two genetic line types we studied (replicate, selectively bred HR and C lines of mice), and was also affected by early-life Western diet (Figs 4, 5). Bacterial richness and alpha diversity were also affected by an interaction of juvenile diet, exercise and line type (Fig. 6). Finally, juvenile Western diet significantly decreased the relative abundance of the Muribaculaceae family driven by the species M.intestinale (Fig. 7).

Selective breeding for high voluntary wheel running resulted in unique clustering of gut microbiomes by line type (Figs 4, 5). These results are consistent with the fact that selection for wheel-running behavior has caused many exercise-associated biological changes that could influence the gut environment, including higher food consumption even when housed without wheels, higher body temperatures when active, and differences in circulating concentrations of multiple hormones, including corticosterone, a classic ‘stress hormone’ (Copes et al., 2015; Garland et al., 2016; Malisch et al., 2009; Swallow et al., 2009; Wallace and Garland, 2016). Our results and those of other recent studies also demonstrate the utility of selectively bred rodent models for understanding possible coevolutionary changes in the microbiome (e.g. see Kohl et al., 2016; Liu et al., 2015; van der Eijk et al., 2020; Zhang et al., 2020).

A Western diet can negatively impact the host's normal gut barrier function by increasing intestinal permeability (Martinez-Medina et al., 2014) and by increasing inflammation of the gut environment (Agus et al., 2016). Several studies have demonstrated effects of a Western diet on the gut microbiome in adult rodents. For example, Western diet results in unique clustering of microbiome communities (Carmody et al., 2015; Pindjakova et al., 2017). We also found significant clustering of microbiome communities by diet (Figs 4, 5). Previous studies of adult mice have reported that a high-fat or high-sugar diet can decrease bacterial diversity (Pindjakova et al., 2017; Sonnenburg et al., 2016; Turnbaugh et al., 2008). Adult rats on standard chow supplemented with 10% sucrose solution and a selection of cakes, biscuits and high-protein foods continuously for 25 days had a significantly reduced alpha diversity, evidenced by a reduction in the total number of OTUs compared with control rats (Beilharz et al., 2017). In our study, Western diet during the juvenile period increased wheel-running behavior and food consumption in both selectively bred HR mice and non-selected C mice (Fig. 2). Both altered diet and increased food consumption can affect the gut environment and thus alter the bacterial community. In principle, early-life Western diet could have altered the gut microbiome in a way that persists into adulthood, an effect that we did indeed find (Figs 47).

Only one other publication has examined the long-lasting effects of juvenile diet on the adult gut microbiome after a significant washout period in mice. Mice with 3 weeks of juvenile high-fat diet followed by a 7-week washout period had decreased alpha diversity as measured by the Shannon index as adults (Fülling et al., 2020). In our study, perturbation of the juvenile gut microbiome with Western diet also had long-lasting effects on species community indicators of adult gut microbial richness by reducing the total number of OTUs and the Chao1 index, though no differences in Shannon diversity were found (Fig. 6). Similarly to Carmody et al. (2015), who demonstrated that a high-fat, high-sugar diet in multiple inbred, outbred and transgenic strains of mice resulted in clustering of mice by both diet and genotype within diet treatment, we found significant clustering of genetic lines within diet treatment (Fig. S1), showing the response to diet can be genotype-dependent.

After correction for multiple comparisons of 1760 P-values comparing taxa at the level of phylum, class, order, family, genus, species and OTU, we found one species (and its family) whose relative abundance was significantly decreased by juvenile Western diet, Muribaculum intestinale (Fig. 7, Table S2). The Muribaculaceae family is commonly found in mouse (but not human) gut microbiomes (previously referred to as S24-7; Lagkouvardos et al., 2016; Seedorf et al., 2014). Muribaculaceae has been linked with propionate production, a short-chain fatty acid, in a mouse longevity study (Smith et al., 2019). This family was also seen to increase in abundance in mice given voluntary wheel access while on a high-fat or standard diet, and decrease in relative abundance in mice on a high-fat diet with or without exercise (Evans et al., 2014). This finding is similar to our study in which the relative abundance of M.intestinale, a species of the Muribaculaceae family, was unaffected by exercise but decreased in abundance with juvenile Western diet (Fig. 7). Muribaculaceae belongs to the phylum Bacteroidetes, one of the two most abundant phyla in the gut microbiome. A Western diet has been shown to usually decrease the relative abundance of Bacteroidetes, a primarily acetate- and propionate-producing phylum. while increasing the relative abundance of Firmicutes, a primarily butyrate-producing phylum (Carmody et al., 2015; den Besten et al., 2013; Ley et al., 2006). If species in the Muribaculaceae family could potentially influence the energy substrate availability to the host, this could lead to a differential effect of diet and exercise treatments on normal host function. As M. intestinale is a newly cultured species, it remains to be seen what other functions it might have (Lagkouvardos et al., 2019). In a small sample of adult wild-type and AC5KO mice (known for their exercise-associated traits of longevity and increased mitochondrial metabolism in skeletal muscle; Ho et al., 2015), a taxon with high sequence similarity to M. intestinale was enriched in adult AC5KO mice after 5 weeks of treadmill training, suggesting that M. intestinale is a potentially exercise-associated species (Dowden et al., 2020).

To our knowledge, only one previous study of rodents has tested for long-lasting effects of juvenile exercise on the adult microbiome. Mika et al. (2015) found that juvenile rats given 6 weeks of wheel access, followed by a 25-day washout period, tended (not statistically significant) to have a decreased abundance of the Firmicutes phylum compared with sedentary juveniles. We found that early-life exercise significantly interacted with diet and line type to influence gut microbial diversity (Fig. 6). Given that we have shown long-lasting effects of relatively mild and natural early-life changes (diet, exercise), more severe treatments, such as antibiotics, might have even stronger long-lasting effects (Ma et al., 2020).

Limitations and future directions

When examining the gut microbiome, variation in sequencing methods can lead to different results under similar experimental conditions. Much of the literature consists of 16S rRNA analysis. Instead, we sequenced the ITS rRNA gene for finer resolution of the gut microbial community (Ruegger et al., 2014). This poses a challenge when comparing ITS data with 16S data. Nevertheless, by examining broad patterns in diversity and community structure (Figs 46), we were able find similar patterns between our data and the literature (see above). For example, a Western diet tends to decrease gut microbiome diversity (Fig. 6) and alters the gut microbiome community measured by beta diversity (Figs 4, 5).

We were only able to sample feces and obtain microbial sequence data for one time point. Logistical constraints precluded our obtaining fecal samples at the beginning of the study. In future studies, repeating this experiment with a baseline sample at weaning and immediately after the juvenile exposure to diet and/or exercise would increase the power to detect longitudinal changes. As we had only the microbiome data after the washout period, we cannot know when the effects of the experimental treatments first appeared. They might have appeared during the 3-week treatment period, which seems likely, or they might have appeared later, at any time prior to when we took fecal samples. Regardless of when the effects first appeared, they were detectable when we analyzed the adult fecal samples. This is an important result, even in the absence of information regarding the longitudinal trajectory of the effects. Future studies should examine the time course of early-life effects. In addition, study of the cecum would allow a more in situ view of the microbiome.

We did not separate or sterilize cages, bedding, food or water, thus giving the mice constant exposure to environmental bacteria. This exposure should have tended to homogenize the gut microbiome, thus possibly erasing any early-life effects of diet or exercise. Nevertheless, we were able to detect such effects after a substantial washout period, supporting the idea that the early-life developmental period of the microbiome is sensitive and responsive to change, and can be impacted in ways that resist subsequent environmental perturbations.

Future experiments involving antibiotic reduction and transplantation of the microbiome will be required to determine whether the unique microbial community of HR mice (Figs 4, 5), which has potentially co-evolved during the selection experiment, contributes to their high motivation and/or ability for sustained, aerobically supported exercise (Hsu et al., 2015; Nay et al., 2019; Okamoto et al., 2019; Scheiman et al., 2019). More specifically, one could administer antibiotics to eliminate the existing gut microbiome, monitor changes in wheel running, and then transplant the HR microbiome into C mice and vice versa. Additional groups would receive their own line-type-specific microbiome in the reseeding phase of the experiment (i.e. HR to HR and C to C). If a unique microbiome is partly responsible for the HR phenotype, then we would predict that (1) antibiotics would reduce their wheel running and (2) reseeding with HR (but not C) microbiome would recover the normal wheel-running behavior for HR mice. It is also possible that transplanting the HR microbiome to C mice would increase their wheel running, at least if some other inherent factor does not limit their running motivation or ability.

Overall, we found that an early-life Western diet had more long-lasting effects on the microbiome than did early-life exercise. Future studies will be required to determine whether this is a general result. In particular, we need dose–response studies of how much exercise, and what type of exercise, is needed to elicit a permanent, potentially beneficial, change in the gut microbiome. The field also needs more studies of how voluntary exercise can acutely change the gut microbiome (e.g. by short-term or alternate-day wheel access), combined with longitudinal sampling. Finally, milder diet alterations should be examined, in addition to effects of probiotics (Sanders et al., 2019).

Footnotes

Author contributions

Conceptualization: M.P.M., J.M.S., M.D.C., J.B., T.G.; Methodology: M.P.M., J.M.S., M.D.C., J.B., T.G.; Software: J.B.; Validation: J.B., T.G.; Formal analysis: M.P.M., M.D.C., P.M.R., J.B., T.G.; Investigation: M.P.M., J.M.S., M.D.C., P.M.R., J.B., T.G.; Resources: J.B., T.G.; Data curation: M.P.M., M.D.C., P.M.R., J.B., T.G.; Writing - original draft: M.P.M., P.M.R., J.B., T.G.; Writing - review & editing: M.P.M., J.M.S., M.D.C., P.M.R., J.B., T.G.; Visualization: M.P.M., P.M.R., J.B., T.G.; Supervision: J.B., T.G.; Project administration: T.G.; Funding acquisition: J.B., T.G.

Funding

This work was supported by the National Science Foundation [grant number DEB 1655362 to T.G.], the National Institutes of Health [grant number R21HD084856 to J.B.] and funds from the University of California, Riverside Academic Senate. Deposited in PMC for release after 12 months.

Data availability

Microbiome data have been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA) under SRA BioProject Accession PRJNA624662.

References

Agus
,
A.
,
Denizot
,
J.
,
Thévenot
,
J.
,
Martinez-Medina
,
M.
,
Massier
,
S.
,
Sauvanet
,
P.
,
Bernalier-Donadille
,
A.
,
Denis
,
S.
,
Hofman
,
P.
,
Bonnet
,
R.
et al. 
(
2016
).
Western diet induces a shift in microbiota composition enhancing susceptibility to adherent-invasive E. coli infection and intestinal inflammation
.
Sci. Rep.
6
,
19032
.
Altschul
,
S. F.
,
Gish
,
W.
,
Miller
,
W.
,
Myers
,
E. W.
and
Lipman
,
D. J.
(
1990
).
Basic local alignment search tool
.
J. Mol. Biol.
215
,
403
-
410
.
Anderson
,
M. J.
(
2001
).
A new method for non-parametric multivariate analysis of variance
.
Austral. Ecol.
26
,
32
-
46
.
Aschard
,
H.
,
Laville
,
V.
,
Tchetgen
,
E. T.
,
Knights
,
D.
,
Imhann
,
F.
,
Seksik
,
P.
,
Zaitlen
,
N.
,
Silverberg
,
M. S.
,
Cosnes
,
J.
and
Weersma
,
R. K.
(
2019
).
Genetic effects on the commensal microbiota in inflammatory bowel disease patients
.
PLoS Genet.
15
,
e1008018
.
Barton
,
W.
,
Penney
,
N. C.
,
Cronin
,
O.
,
Garcia-Perez
,
I.
,
Molloy
,
M. G.
,
Holmes
,
E.
,
Shanahan
,
F.
,
Cotter
,
P. D.
and
O'Sullivan
,
O.
(
2018
).
The microbiome of professional athletes differs from that of more sedentary subjects in composition and particularly at the functional metabolic level
.
Gut
67
,
625
-
633
.
Batacan
,
R. B.
,
Fenning
,
A. S.
,
Dalbo
,
V. J.
,
Scanlan
,
A. T.
,
Duncan
,
M. J.
,
Moore
,
R. J.
and
Stanley
,
D.
(
2017
).
A gut reaction: the combined influence of exercise and diet on gastrointestinal microbiota in rats
.
J. Appl. Microbiol.
122
,
1627
-
1638
.
Becker
,
S. L.
,
Chiang
,
E.
,
Plantinga
,
A.
,
Carey
,
H. V.
,
Suen
,
G.
and
Swoap
,
S. J.
(
2020
).
Effect of stevia on the gut microbiota and glucose tolerance in a murine model of diet-induced obesity
.
FEMS Microbiol. Ecol.
96
,
fiaa079
.
Beilharz
,
J. E.
,
Kaakoush
,
N. O.
,
Maniam
,
J.
and
Morris
,
M. J.
(
2017
).
Cafeteria diet and probiotic therapy: cross talk among memory, neuroplasticity, serotonin receptors and gut microbiota in the rat
.
Mol. Psychiatry
23
,
351
-
361
.
Belter
,
J. G.
,
Carey
,
H. V.
and
Garland
,
T.
Jr.
(
2004
).
Effects of voluntary exercise and genetic selection for high activity levels on HSP72 expression in house mice
.
J. Appl. Physiol.
96
,
1270
-
1276
.
Benjamini
,
Y.
and
Hochberg
,
Y.
(
1995
).
Controlling the false discovery rate: a practical and powerful approach to multiple testing
.
J. R. Stat. Soc. Ser. B Methodol.
57
,
289
-
300
.
Benson
,
A. K.
,
Kelly
,
S. A.
,
Legge
,
R.
,
Ma
,
F.
,
Low
,
S. J.
,
Kim
,
J.
,
Zhang
,
M.
,
Oh
,
P. L.
,
Nehrenberg
,
D.
,
Hua
,
K.
et al. 
(
2010
).
Individuality in gut microbiota composition is a complex polygenic trait shaped by multiple environmental and host genetic factors
.
Proc. Natl. Acad. Sci.
107
,
18933
-
18938
.
Bokulich
,
N. A.
,
Chung
,
J.
,
Battaglia
,
T.
,
Henderson
,
N.
,
Jay
,
M.
,
Li
,
H.
,
Lieber
,
A. D.
,
Wu
,
F.
,
Perez-Perez
,
G. I.
,
Chen
,
Y.
et al. 
(
2016
).
Antibiotics, birth mode, and diet shape microbiome maturation during early life
.
Sci. Transl. Med.
8
,
343ra82
.
Bressa
,
C.
,
Bailén-Andrino
,
M.
,
Pérez-Santiago
,
J.
,
González-Soltero
,
R.
,
Pérez
,
M.
,
Montalvo-Lominchar
,
M. G.
,
Maté-Muñoz
,
J. L.
,
Domínguez
,
R.
,
Moreno
,
D.
and
Larrosa
,
M.
(
2017
).
Differences in gut microbiota profile between women with active lifestyle and sedentary women
.
PloS ONE
12
,
e0171352
.
Brown
,
T. A.
,
Tashiro
,
H.
,
Kasahara
,
D. I.
,
Cho
,
Y.
and
Shore
,
S. A.
(
2020
).
Early life microbiome perturbation alters pulmonary responses to ozone in male mice
.
Physiol. Rep.
8
,
e14290
.
Campbell
,
S. C.
and
Wisniewski
,
P. J.
(
2017
).
Exercise is a novel promoter of intestinal health and microbial diversity
.
Exerc. Sport Sci. Rev.
45
,
41
-
47
.
Carmody
,
R. N.
,
Gerber
,
G. K.
,
Luevano
,
J. M.
,
Gatti
,
D. M.
,
Somes
,
L.
,
Svenson
,
K. L.
and
Turnbaugh
,
P. J.
(
2015
).
Diet dominates host genotype in shaping the murine gut microbiota
.
Cell Host Microbe
17
,
72
-
84
.
Castro
,
A. A.
and
Garland
,
T.
Jr.
(
2018
).
Evolution of hindlimb bone dimensions and muscle masses in house mice selectively bred for high voluntary wheel-running behavior
.
J. Morphol.
279
,
766
-
779
.
Castro
,
A. A.
,
Rabitoy
,
H.
,
Claghorn
,
G. C.
and
Garland
,
T.
Jr.
(
2020
).
Rapid and longer-term effects of selective breeding for voluntary exercise behavior on skeletal morphology in house mice
.
J. Anat.
00
,
1
-
24
.
Clark
,
A.
and
Mach
,
N.
(
2016
).
Exercise-induced stress behavior, gut-microbiota-brain axis and diet: a systematic review for athletes
.
J. Int. Soc. Sports Nutr.
13
,
43
.
Clarke
,
S. F.
,
Murphy
,
E. F.
,
O'Sullivan
,
O.
,
Lucey
,
A. J.
,
Humphreys
,
M.
,
Hogan
,
A.
,
Hayes
,
P.
,
O'Reilly
,
M.
,
Jeffery
,
I. B.
,
Wood-Martin
,
R.
et al. 
(
2014
).
Exercise and associated dietary extremes impact on gut microbial diversity
.
Gut
63
,
1913
-
1920
.
Codella
,
R.
,
Luzi
,
L.
and
Terruzzi
,
I.
(
2018
).
Exercise has the guts: How physical activity may positively modulate gut microbiota in chronic and immune-based diseases
.
Dig. Liver Dis.
50
,
331
-
341
.
Copes
,
L. E.
,
Schutz
,
H.
,
Dlugosz
,
E. M.
,
Acosta
,
W.
,
Chappell
,
M. A.
and
Garland
,
T.
Jr.
(
2015
).
Effects of voluntary exercise on spontaneous physical activity and food consumption in mice: results from an artificial selection experiment
.
Physiol. Behav.
149
,
86
-
94
.
Daniel
,
H.
,
Gholami
,
A. M.
,
Berry
,
D.
,
Desmarchelier
,
C.
,
Hahne
,
H.
,
Loh
,
G.
,
Mondot
,
S.
,
Lepage
,
P.
,
Rothballer
,
M.
,
Walker
,
A.
et al. 
(
2014
).
High-fat diet alters gut microbiota physiology in mice
.
ISME J.
8
,
295
-
308
.
David
,
L. A.
,
Maurice
,
C. F.
,
Carmody
,
R. N.
,
Gootenberg
,
D. B.
,
Button
,
J. E.
,
Wolfe
,
B. E.
,
Ling
,
A. V.
,
Devlin
,
A. S.
,
Varma
,
Y.
,
Fischbach
,
M. A.
et al. 
(
2014
).
Diet rapidly and reproducibly alters the human gut microbiome
.
Nature
505
,
559
-
563
.
den Besten
,
G.
,
van Eunen
,
K.
,
Groen
,
A. K.
,
Venema
,
K.
,
Reijngoud
,
D.-J.
and
Bakker
,
B. M.
(
2013
).
The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism
.
J. Lipid Res.
54
,
2325
-
2340
.
Denou
,
E.
,
Marcinko
,
K.
,
Surette
,
M. G.
,
Steinberg
,
G. R.
and
Schertzer
,
J. D.
(
2016
).
High-intensity exercise training increases the diversity and metabolic capacity of the mouse distal gut microbiota during diet-induced obesity
.
Am. J. Physiol. Endocrinol. Metab.
310
,
E982
-
E993
.
Dethlefsen
,
L.
and
Relman
,
D. A.
(
2011
).
Incomplete recovery and individualized responses of the human distal gut microbiota to repeated antibiotic perturbation
.
Proc. Natl. Acad. Sci. USA
108
,
4554
-
4561
.
Dominguez-Bello
,
M. G.
,
Godoy-Vitorino
,
F.
,
Knight
,
R.
and
Blaser
,
M. J.
(
2019
).
Role of the microbiome in human development
.
Gut
68
,
1108
-
1114
.
Dowden
,
R. A.
,
McGuinness
,
L. R.
,
Wisniewski
,
P. J.
,
Campbell
,
S. C.
,
Guers
,
J. J.
,
Oydanich
,
M.
,
Vatner
,
S. F.
,
Häggblom
,
M. M.
and
Kerkhof
,
L. J.
(
2020
).
Host genotype and exercise exhibit species-level selection for members of the gut bacterial communities in the mouse digestive system
.
Sci. Rep.
10
,
8984
.
Dutta
,
S.
and
Sengupta
,
P.
(
2016
).
Men and mice: Relating their ages
.
Life Sci.
152
,
244
-
248
.
Edgar
,
R. C.
(
2010
).
Search and clustering orders of magnitude faster than BLAST
.
Bioinformatics
26
,
2460
-
2461
.
Edgar
,
R. C.
(
2013
).
UPARSE: highly accurate OTU sequences from microbial amplicon reads
.
Nat. Methods
10
,
996
-
998
.
Edgar
,
R. C.
(
2016a
).
SINTAX: a simple non-Bayesian taxonomy classifier for 16S and ITS sequences
.
bioRxiv
074161
.
Edgar
,
R. C.
(
2016b
).
UNOISE2: improved error-correction for Illumina 16S and ITS amplicon sequencing
.
bioRxiv
081257
.
Evans
,
C. C.
,
LePard
,
K. J.
,
Kwak
,
J. W.
,
Stancukas
,
M. C.
,
Laskowski
,
S.
,
Dougherty
,
J.
,
Moulton
,
L.
,
Glawe
,
A.
,
Wang
,
Y.
,
Leone
,
V.
et al. 
(
2014
).
Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity
.
PLoS ONE
9
,
e92193
.
Frank
,
J. A.
,
Reich
,
C. I.
,
Sharma
,
S.
,
Weisbaum
,
J. S.
,
Wilson
,
B. A.
and
Olsen
,
G. J.
(
2008
).
Critical evaluation of two primers commonly used for amplification of bacterial 16s rrna genes
.
Appl. Environ. Microbiol.
74
,
2461
-
2470
.
Fülling
,
C.
,
Lach
,
G.
,
Bastiaanssen
,
T. F. S.
,
Fouhy
,
F.
,
O'Donovan
,
A. N.
,
Ventura-Silva
,
A.-P.
,
Stanton
,
C.
,
Dinan
,
T. G.
and
Cryan
,
J. F.
(
2020
).
Adolescent dietary manipulations differentially affect gut microbiota composition and amygdala neuroimmune gene expression in male mice in adulthood
.
Brain. Behav. Immun.
87
,
666
-
678
.
Funkhouser
,
L. J.
and
Bordenstein
,
S. R.
(
2013
).
Mom knows best: the universality of maternal microbial transmission
.
PLoS Biol.
11
,
e1001631
.
Garland
,
T.
, Jr
,
Morgan
,
M. T.
,
Swallow
,
J. G.
,
Rhodes
,
J. S.
,
Girard
,
I.
,
Belter
,
J. G.
and
Carter
,
P. A.
(
2002
).
Evolution of a small-muscle polymorphism in lines of house mice selected for high activity levels
.
Evolution
56
,
1267
-
1275
.
Garland
,
T.
, Jr
,
Schutz
,
H.
,
Chappell
,
M. A.
,
Keeney
,
B. K.
,
Meek
,
T. H.
,
Copes
,
L. E.
,
Acosta
,
W.
,
Drenowatz
,
C.
,
Maciel
,
R. C.
,
van Dijk
,
G.
et al. 
(
2011
).
The biological control of voluntary exercise, spontaneous physical activity and daily energy expenditure in relation to obesity: human and rodent perspectives
.
J. Exp. Biol.
214
,
206
-
229
.
Garland
,
T.
Jr.
,
Zhao
,
M.
and
Saltzman
,
W.
(
2016
).
Hormones and the evolution of complex traits: insights from artificial selection on behavior
.
Integr. Comp. Biol.
56
,
207
-
224
.
Garland
,
T.
Jr.
,
Cadney
,
M. D.
and
Waterland
,
R. A.
(
2017
).
Early-life effects on adult physical activity: concepts, relevance, and experimental approaches
.
Physiol. Biochem. Zool.
90
,
1
-
14
.
Gilbert
,
J. A.
,
Blaser
,
M. J.
,
Caporaso
,
J. G.
,
Jansson
,
J. K.
,
Lynch
,
S. V.
and
Knight
,
R.
(
2018
).
Current understanding of the human microbiome
.
Nat. Med.
24
,
392
-
400
.
Ho
,
D.
,
Zhao
,
X.
,
Yan
,
L.
,
Yuan
,
C.
,
Zong
,
H.
,
Vatner
,
D. E.
,
Pessin
,
J. E.
and
Vatner
,
S. F.
(
2015
).
Adenylyl cyclase type 5 deficiency protects against diet-induced obesity and insulin resistance
.
Diabetes
64
,
2636
-
2645
.
Houle-Leroy
,
P.
,
Garland
,
T. J.
Jr.
,
Swallow
,
J. G.
and
Guderley
,
H.
(
2000
).
Effects of voluntary activity and genetic selection on muscle metabolic capacities in house mice Mus domesticus
.
J. Appl. Physiol.
89
,
1608
-
1616
.
Hsu
,
Y. J.
,
Chiu
,
C. C.
,
Li
,
Y. P.
,
Huang
,
W. C.
,
Huang
,
Y. T.
,
Huang
,
C. C.
and
Chuang
,
H. L.
(
2015
).
Effect of intestinal microbiota on exercise performance in mice
.
J. Strength Cond. Res.
29
,
552
-
558
.
Hunt
,
D. E.
,
Klepac-Ceraj
,
V.
,
Acinas
,
S. G.
,
Gautier
,
C.
,
Bertilsson
,
S.
and
Polz
,
M. F.
(
2006
).
Evaluation of 23s rrna pcr primers for use in phylogenetic studies of bacterial diversity
.
Appl. Environ. Microbiol.
72
,
2221
-
2225
.
Kelly
,
S. A.
,
Bell
,
T. A.
,
Selitsky
,
S. R.
,
Buus
,
R. J.
,
Hua
,
K.
,
Weinstock
,
G. M.
,
Garland
,
T.
Jr.
,
Pardo-Manuel de Villena
,
F.
and
Pomp
,
D.
(
2013
).
A novel intronic single nucleotide polymorphism in the myosin heavy polypeptide 4 gene is responsible for the mini-muscle phenotype characterized by major reduction in hind-limb muscle mass in mice
.
Genetics
195
,
1385
-
1395
.
Kelly
,
S. A.
,
Gomes
,
F. R.
,
Kolb
,
E. M.
,
Malisch
,
J. L.
and
Garland
,
T.
Jr
(
2017
).
Effects of activity, genetic selection, and their interaction on muscle metabolic capacities and organ masses in mice
.
J. Exp. Biol.
220
,
1038
-
1047
.
Kerr
,
C. A.
,
Grice
,
D. M.
,
Tran
,
C. D.
,
Bauer
,
D. C.
,
Li
,
D.
,
Hendry
,
P.
and
Hannan
,
G. N.
(
2015
).
Early life events influence whole-of-life metabolic health via gut microflora and gut permeability
.
Crit. Rev. Microbiol.
41
,
326
-
340
.
Kohl
,
K. D.
and
Carey
,
H. V.
(
2016
).
A place for host-microbe symbiosis in the comparative physiologist's toolbox
.
J. Exp. Biol.
219
,
3496
-
3504
.
Kohl
,
K. D.
,
Sadowska
,
E. T.
,
Rudolf
,
A. M.
,
Dearing
,
M. D.
and
Koteja
,
P.
(
2016
).
Experimental evolution on a wild mammal species results in modifications of gut microbial communities
.
Front. Microbiol.
7
,
634
.
Koteja
,
P.
,
Carter
,
P. A.
,
Swallow
,
J. G.
and
Garland
,
T.
Jr.
(
2003
).
Food wasting by house mice: variation among individuals, families, and genetic lines
.
Physiol. Behav.
80
,
375
-
383
.
Lagkouvardos
,
I.
,
Pukall
,
R.
,
Abt
,
B.
,
Foesel
,
B. U.
,
Meier-Kolthoff
,
J. P.
,
Kumar
,
N.
,
Bresciani
,
A.
,
Martínez
,
I.
,
Just
,
S.
,
Ziegler
,
C.
et al. 
(
2016
).
Corrigendum: the mouse intestinal bacterial collection (miBC) provides host-specific insight into cultured diversity and functional potential of the gut microbiota
.
Nat. Microbiol.
1
,
16219
.
Lagkouvardos
,
I.
,
Lesker
,
T. R.
,
Hitch
,
T. C. A.
,
Gálvez
,
E. J. C.
,
Smit
,
N.
,
Neuhaus
,
K.
,
Wang
,
J.
,
Baines
,
J. F.
,
Abt
,
B.
,
Stecher
,
B.
et al. 
(
2019
).
Sequence and cultivation study of Muribaculaceae reveals novel species, host preference, and functional potential of this yet undescribed family
.
Microbiome
7
,
28
.
Lambert
,
J.
,
Bomhof
,
M.
,
Myslicki
,
J.
,
Belke
,
D.
,
Reimer
,
R.
and
Shearer
,
J.
(
2014
).
Exercise training modifies gut bacterial composition in normal and diabetic mice (LB434)
.
FASEB J.
28
,
LB434
.
Lamoureux
,
E. V.
,
Grandy
,
S. A.
and
Langille
,
M. G. I.
(
2017
).
Moderate exercise has limited but distinguishable effects on the mouse microbiome
.
mSystems
2
,
e00006
-
e00017
.
Langdon
,
A.
,
Crook
,
N.
and
Dantas
,
G.
(
2016
).
The effects of antibiotics on the microbiome throughout development and alternative approaches for therapeutic modulation
.
Genome Med.
8
,
39
.
Leamy
,
L. J.
,
Kelly
,
S. A.
,
Nietfeldt
,
J.
,
Legge
,
R. M.
,
Ma
,
F.
,
Hua
,
K.
,
Sinha
,
R.
,
Peterson
,
D. A.
,
Walter
,
J.
,
Benson
,
A. K.
et al. 
(
2014
).
Host genetics and diet, but not immunoglobulin A expression, converge to shape compositional features of the gut microbiome in an advanced intercross population of mice
.
Genome Biol.
15
,
552
.
Ley
,
R. E.
,
Turnbaugh
,
P. J.
,
Klein
,
S.
and
Gordon
,
J. I.
(
2006
).
Microbial ecology: Human gut microbes associated with obesity
.
Nature
444
,
1022
-
1023
.
Liu
,
T.-W.
,
Park
,
Y.-M.
,
Holscher
,
H. D.
,
Padilla
,
J.
,
Scroggins
,
R. J.
,
Welly
,
R.
,
Britton
,
S. L.
,
Koch
,
L. G.
,
Vieira-Potter
,
V. J.
and
Swanson
,
K. S.
(
2015
).
Physical activity differentially affects the cecal microbiota of ovariectomized female rats selectively bred for high and low aerobic capacity
.
PLoS ONE
10
,
e0136150
.
Lozupone
,
C. A.
,
Stombaugh
,
J. I.
,
Gordon
,
J. I.
,
Jansson
,
J. K.
and
Knight
,
R.
(
2012
).
Diversity, stability and resilience of the human gut microbiota
.
Nature
489
,
220
-
230
.
Ma
,
T.
,
Villot
,
C.
,
Renaud
,
D.
,
Skidmore
,
A.
,
Chevaux
,
E.
,
Steele
,
M.
and
Guan
,
L. L.
(
2020
).
Linking perturbations to temporal changes in diversity, stability, and compositions of neonatal calf gut microbiota: prediction of diarrhea
.
ISME J.
14
,
2223
-
2235
.
Mach
,
N.
and
Fuster-Botella
,
D.
(
2017
).
Endurance exercise and gut microbiota: a review
.
J. Sport Health Sci.
6
,
179
-
197
.
Mailing
,
L. J.
,
Allen
,
J. M.
,
Buford
,
T. W.
,
Fields
,
C. J.
and
Woods
,
J. A.
(
2019
).
Exercise and the gut microbiome: a review of the evidence, potential mechanisms, and implications for human health
.
Exerc. Sport Sci. Rev.
47
,
75
-
85
.
Malisch
,
J. L.
,
Breuner
,
C. W.
,
Kolb
,
E. M.
,
Wada
,
H.
,
Hannon
,
R. M.
,
Chappell
,
M. A.
,
Middleton
,
K. M.
and
Garland
,
T.
Jr
(
2009
).
Behavioral despair and home-cage activity in mice with chronically elevated baseline corticosterone concentrations
.
Behav. Genet.
39
,
192
-
201
.
Martinez-Medina
,
M.
,
Denizot
,
J.
,
Dreux
,
N.
,
Robin
,
F.
,
Billard
,
E.
,
Bonnet
,
R.
,
Darfeuille-Michaud
,
A.
and
Barnich
,
N.
(
2014
).
Western diet induces dysbiosis with increased E coli in CEABAC10 mice, alters host barrier function favouring AIEC colonisation
.
Gut
63
,
116
-
124
.
Matsumoto
,
M.
,
Inoue
,
R.
,
Tsukahara
,
T.
,
Ushida
,
K.
,
Chiji
,
H.
,
Matsubara
,
N.
and
Hara
,
H.
(
2008
).
Voluntary running exercise alters microbiota composition and increases n-butyrate concentration in the rat cecum
.
Biosci. Biotechnol. Biochem.
72
,
572
-
576
.
Meek
,
T. H.
,
Eisenmann
,
J. C.
and
Garland
,
T.
Jr.
(
2010
).
Western diet increases wheel running in mice selectively bred for high voluntary wheel running
.
Int. J. Obes.
34
,
960
-
969
.
Mika
,
A.
,
Van Treuren
,
W.
,
González
,
A.
,
Herrera
,
J. J.
,
Knight
,
R.
and
Fleshner
,
M.
(
2015
).
Exercise is more effective at altering gut microbial composition and producing stable changes in lean mass in juvenile versus adult male f344 rats
.
PLOS ONE
10
,
e0125889
.
Milani
,
C.
,
Duranti
,
S.
,
Bottacini
,
F.
,
Casey
,
E.
,
Turroni
,
F.
,
Mahony
,
J.
,
Belzer
,
C.
,
Palacio
,
S. D.
,
Montes
,
S. A.
,
Mancabelli
,
L.
et al. 
(
2017
).
The first microbial colonizers of the human gut: composition, activities, and health implications of the infant gut microbiota
.
Microbiol. Mol. Biol. Rev.
81
,
e00036-e00017
.
Nay
,
K.
,
Jollet
,
M.
,
Goustard
,
B.
,
Baati
,
N.
,
Vernus
,
B.
,
Pontones
,
M.
,
Lefeuvre-Orfila
,
L.
,
Bendavid
,
C.
,
Rué
,
O.
,
Mariadassou
,
M.
et al. 
(
2019
).
Gut bacteria are critical for optimal muscle function: a potential link with glucose homeostasis
.
Am. J. Physiol. Endocrinol. Metab.
317
,
E158
-
E171
.
Okamoto
,
T.
,
Morino
,
K.
,
Ugi
,
S.
,
Nakagawa
,
F.
,
Lemecha
,
M.
,
Ida
,
S.
,
Ohashi
,
N.
,
Sato
,
D.
,
Fujita
,
Y.
and
Maegawa
,
H.
(
2019
).
Microbiome potentiates endurance exercise through intestinal acetate production
.
Am. J. Physiol. Endocrinol. Metab.
316
,
E956
-
E966
.
O'Sullivan
,
O.
,
Cronin
,
O.
,
Clarke
,
S. F.
,
Murphy
,
E. F.
,
Molloy
,
M. G.
,
Shanahan
,
F.
and
Cotter
,
P. D.
(
2015
).
Exercise and the microbiota
.
Gut Microbes
6
,
131
-
136
.
Petriz
,
B. A.
,
Castro
,
A. P.
,
Almeida
,
J. A.
,
Gomes
,
C. P.
,
Fernandes
,
G. R.
,
Kruger
,
R. H.
,
Pereira
,
R. W.
and
Franco
,
O. L.
(
2014
).
Exercise induction of gut microbiota modifications in obese, non-obese and hypertensive rats
.
BMC Genomics
15
,
511
.
Pindjakova
,
J.
,
Sartini
,
C.
,
Lo Re
,
O.
,
Rappa
,
F.
,
Coupe
,
B.
,
Lelouvier
,
B.
,
Pazienza
,
V.
and
Vinciguerra
,
M.
(
2017
).
Gut dysbiosis and adaptive immune response in diet-induced obesity vs. systemic inflammation
.
Front. Microbiol.
8
,
1157
.
Queipo-Ortuño
,
M. I.
,
Seoane
,
L. M.
,
Murri
,
M.
,
Pardo
,
M.
,
Gomez-Zumaquero
,
J. M.
,
Cardona
,
F.
,
Casanueva
,
F.
and
Tinahones
,
F. J.
(
2013
).
Gut microbiota composition in male rat models under different nutritional status and physical activity and its association with serum leptin and ghrelin levels
.
PLoS ONE
8
,
e65465
.
Ruegger
,
P. M.
,
Clark
,
R. T.
,
Weger
,
J. R.
,
Braun
,
J.
and
Borneman
,
J.
(
2014
).
Improved resolution of bacteria by high throughput sequence analysis of the rRNA internal transcribed spacer
.
J. Microbiol. Methods
105
,
82
-
87
.
Sanders
,
M. E.
,
Merenstein
,
D. J.
,
Reid
,
G.
,
Gibson
,
G. R.
and
Rastall
,
R. A.
(
2019
).
Probiotics and prebiotics in intestinal health and disease: from biology to the clinic
.
Nat. Rev. Gastroenterol. Hepatol.
16
,
605
-
616
.
Scheiman
,
J.
,
Luber
,
J. M.
,
Chavkin
,
T. A.
,
MacDonald
,
T.
,
Tung
,
A.
,
Pham
,
L.-D.
,
Wibowo
,
M. C.
,
Wurth
,
R. C.
,
Punthambaker
,
S.
,
Tierney
,
B. T.
et al. 
(
2019
).
Meta-omics analysis of elite athletes identifies a performance-enhancing microbe that functions via lactate metabolism
.
Nat. Med.
25
,
1104
-
1109
.
Schulfer
,
A. F.
,
Schluter
,
J.
,
Zhang
,
Y.
,
Brown
,
Q.
,
Pathmasiri
,
W.
,
McRitchie
,
S.
,
Sumner
,
S.
,
Li
,
H.
,
Xavier
,
J. B.
and
Blaser
,
M. J.
(
2019
).
The impact of early-life sub-therapeutic antibiotic treatment (STAT) on excessive weight is robust despite transfer of intestinal microbes
.
ISME J.
13
,
1280
-
1292
.
Seedorf
,
H.
,
Griffin
,
N. W.
,
Ridaura
,
V. K.
,
Reyes
,
A.
,
Cheng
,
J.
,
Rey
,
F. E.
,
Smith
,
M. I.
,
Simon
,
G. M.
,
Scheffrahn
,
R. H.
,
Woebken
,
D.
et al. 
(
2014
).
Bacteria from diverse habitats colonize and compete in the mouse gut
.
Cell
159
,
253
-
266
.
Smith
,
B. J.
,
Miller
,
R. A.
,
Ericsson
,
A. C.
,
Harrison
,
D. C.
,
Strong
,
R.
and
Schmidt
,
T. M.
(
2019
).
Changes in the gut microbiome and fermentation products concurrent with enhanced longevity in acarbose-treated mice
.
BMC Microbiol.
19
,
130
.
Sonnenburg
,
E. D.
,
Smits
,
S. A.
,
Tikhonov
,
M.
,
Higginbottom
,
S. K.
,
Wingreen
,
N. S.
and
Sonnenburg
,
J. L.
(
2016
).
Diet-induced extinction in the gut microbiota compounds over generations
.
Nature
529
,
212
-
215
.
Sprockett
,
D.
,
Fukami
,
T.
and
Relman
,
D. A.
(
2018
).
Role of priority effects in the early-life assembly of the gut microbiota
.
Nat. Rev. Gastroenterol. Hepatol.
15
,
197
-
205
.
Swallow
,
J. G.
,
Carter
,
P. A.
and
Garland
,
T.
Jr.
(
1998
).
Artificial selection for increased wheel-running behavior in house mice
.
Behav. Genet.
28
,
227
-
237
.
Swallow
,
J. G.
,
Hayes
,
J. P.
,
Koteja
,
P.
and
Garland
,
T.
Jr.
(
2009
).
Selection experiments and experimental evolution of performance and physiology
. In
Experimental Evolution: Concepts, Methods, and Applications of Selection Experiments (ed. T. Garland, Jr, and M. R. Rose), pp.
301
-
351
. University of California Press.
Ticinesi
,
A.
,
Lauretani
,
F.
,
Milani
,
C.
,
Nouvenne
,
A.
,
Tana
,
C.
,
Del Rio
,
D.
,
Maggio
,
M.
,
Ventura
,
M.
and
Meschi
,
T.
(
2017
).
Aging gut microbiota at the cross-road between nutrition, physical frailty, and sarcopenia: is there a gut–muscle axis?
Nutrients
9
,
1303
.
Turnbaugh
,
P. J.
,
Bäckhed
,
F.
,
Fulton
,
L.
and
Gordon
,
J. I.
(
2008
).
Diet-induced obesity is linked to marked but reversible alterations in the mouse distal gut microbiome
.
Cell Host Microbe
3
,
213
-
223
.
van der Eijk
,
J. A. J.
,
Rodenburg
,
T. B.
,
de Vries
,
H.
,
Kjaer
,
J. B.
,
Smidt
,
H.
,
Naguib
,
M.
,
Kemp
,
B.
and
Lammers
,
A.
(
2020
).
Early-life microbiota transplantation affects behavioural responses, serotonin and immune characteristics in chicken lines divergently selected on feather pecking
.
Sci. Rep.
10
,
2750
.
Wahlsten
,
D.
(
1990
).
Insensitivity of the analysis of variance to heredity-environment interaction
.
Behav. Brain Sci.
13
,
109
-
120
.
Wallace
,
I. J.
and
Garland
,
T.
(
2016
).
Mobility as an emergent property of biological organization: Insights from experimental evolution: mobility and biological organization
.
Evol. Anthropol. Issues News Rev.
25
,
98
-
104
.
Walsh
,
M. E.
,
Bhattacharya
,
A.
,
Sataranatarajan
,
K.
,
Qaisar
,
R.
,
Sloane
,
L.
,
Rahman
,
M. M.
,
Kinter
,
M.
and
Van Remmen
,
H.
(
2015
).
The histone deacetylase inhibitor butyrate improves metabolism and reduces muscle atrophy during aging
.
Aging Cell
14
,
957
-
970
.
Yatsunenko
,
T.
,
Rey
,
F. E.
,
Manary
,
M. J.
,
Trehan
,
I.
,
Dominguez-Bello
,
M. G.
,
Contreras
,
M.
,
Magris
,
M.
,
Hidalgo
,
G.
,
Baldassano
,
R. N.
,
Anokhin
,
A. P.
et al. 
(
2012
).
Human gut microbiome viewed across age and geography
.
Nature
486
,
222
.
Zhang
,
Y.
,
Kumarasamy
,
S.
,
Mell
,
B.
,
Cheng
,
X.
,
Morgan
,
E. E.
,
Britton
,
S. L.
,
Vijay-Kumar
,
M.
,
Koch
,
L. G.
and
Joe
,
B.
(
2020
).
Vertical selection for nuclear and mitochondrial genomes shapes gut microbiota and modifies risks for complex diseases
.
Physiol. Genomics
52
,
1
-
14
.
Zhao
,
X.
,
Zhang
,
Z.
,
Hu
,
B.
,
Huang
,
W.
,
Yuan
,
C.
and
Zou
,
L.
(
2018
).
Response of gut microbiota to metabolite changes induced by endurance exercise
.
Front. Microbiol.
9
,
765
.

Competing interests

The authors declare no competing or financial interests.

Supplementary information