norpA and itpr mutants reveal roles for phospholipase C and inositol (1,4,5)- trisphosphate receptor in Drosophila melanogaster renal function

The accepted paradigm for hormonally stimulated increases in intracellular cytosolic calcium concentration ([Ca²⁺]_i) in non-excitable cells centres on G-protein-coupled activation of phospholipase Cβ (PLCβ) upon ligand—receptor binding, resulting in an increase in intracellular levels of the second messengers diacylglycerol (DAG)and inositol (1,4,5)-trisphosphate (IP₃). IP₃ binds to its receptor on the endoplasmic reticulum (ER), IP₃R, which functions as a calcium-release channel. Calcium is released from intracellular stores, with associated calcium entry via plasma membrane calcium channels by an unknown mechanism termed `capacitative calcium entry'(Berridge, 1997; Putney, 1997).

The processes of calcium signalling in vivo have been intensely investigated in Drosophila phototransduction, where novel calcium channels and associated signalling proteins have been discovered in forward genetic screens (Hardie and Raghu,2001). Importantly, studies in Drosophila have subsequently revealed vertebrate and human homologues of such signalling complexes (Harteneck et al.,2000). Light-driven phototransduction has been shown to be PLC-dependent; as such, most studies of PLC function in vivo in Drosophila have utilised the photoreceptor model. Two genes encode PLCβ in Drosophila: norpA and Plc21C. Mutants in norpA severely reduce phototransduction(Pak et al., 1970). Molecular cloning of the gene, together with biochemical analyses of PLC activity in the eye of norpA mutants showed that norpA encodes a retinal-specific PLC similar to bovine brain PLC(Bloomquist et al., 1988). By contrast, Plc21C is more generally expressed, with a 7 kb transcript in the eye and central nervous system (CNS) and a 5.6 kb transcript in heads and bodies (Shortridge et al.,1991).

Mutagenic analysis of the IP₃R has also been informative in insects. In Drosophila, a single gene, itpr-83, encodes IP₃R (Hasan and Rosbash,1992; Yoshikawa et al.,1992). Drosophila IP₃R has most similarity to type I IP₃R in vertebrates. Embryonic expression of itprhas been documented, and a delayed-development phenotype has been identified in mutants (Venkatesh and Hasan,1997). In the adult, expression has been shown in photoreceptors,brain and antennae, with expression also documented in the eye, which suggests a role for IP₃R in chemosensation and in visual processes. However,in spite of the documented role of PLC in the eye, recent work has shown that IP₃ signalling is unnecessary for phototransduction to occur(Hardie and Raghu, 1998; Venkatesh and Hasan,1997).

While norpA and itpr have been assigned neural roles— indeed, norpA is generally considered to be visual system specific — it is likely that much more general roles for these genes exist but have yet to be documented due to lack of an informative physiological phenotype. The Drosophila Malpighian tubule is an ideal genetic model for transporting epithelia and provides a robust phenotype for the integrative physiology of cell signalling and transport genes(Dow and Davies, 2001). Previous work has established that ion transport and cell signalling process are compartmentalised into different tubule cell subtypes: the principal and stellate cells (Dow and Davies,2001). Furthermore, direct measurements of cell-specific intracellular calcium signalling mechanisms using targeted aequorin show a direct modulation of fluid transport by agents that mobilise intracellular calcium (O'Donnell et al.,1998; Rosay et al.,1997; Terhzaz et al.,1999; MacPherson et al.,2001). The Drosophila neurohormones capa-1 (a member of the CAP_2b family; Kean et al.,2002) and Drosophila leucokinin (Drosokinin; Terhzaz et al., 1999) have been shown to stimulate fluid transport rates, which are associated with increases in cytoplasmic calcium concentration in principal and stellate cells, respectively, in tubule main segment. The CAP_2b response is dependent on extracellular calcium (Rosay et al., 1997); furthermore, it has been recently demonstrated that TRP/TRPL (transient receptor potential/TRP-like) and L-type calcium channels play a role in this response (MacPherson et al., 2000, 2001). However, the relative contribution of intracellular calcium stores to these neurohormone-induced responses is still unclear. Use of the ER Ca²⁺-ATPase inhibitor thapsigargin in the presence of extracellular calcium results in elevation of intracellular calcium levels in both principal and stellate cells and increased fluid transport rates (Rosay et al., 1997). However, in the absence of extracellular calcium the response is abolished in principal cells but remains in stellate cells. Thus,it appears that the contribution of ER calcium stores, and thus of calcium signalling via IP₃R to capacitative calcium entry in tubule cells, is cell-type specific. Alternatively, the putative thapsigargin-sensitive pool in principal cells is very small and is emptied too rapidly to monitor. It is thus of interest to try to dissect the different contributions of calcium signalling genes in the context of principal and stellate cell function.

In this study, we show that mutations in norpA reduce stimulation of fluid transport by both CAP_2b and Drosokinin. Furthermore,CAP_2b and Drosokinin both elevate IP₃ levels. Thus,PLCβ and IP₃ are involved in stimulated fluid transport; we have thus utilised itpr mutants to define the contribution of IP₃R to neurohormone-mediated increases in epithelial fluid transport. Genetic blockade of IP₃R function results in inhibition of neuropeptide-fluid transport rates associated with either CAP_2bor Drosokinin. In itpr mutants, downregulation of fluid transport is associated with reductions in neuropeptide-stimulated intracellular calcium levels. Thus, PLCβ-mediated IP₃ signalling plays a functional role in calcium signalling and epithelial fluid transport in Drosophila, confirming that the important norpA and itpr genes are not neural specific.

Coelenterazine was purchased from Molecular Probes (Leiden, The Netherlands) and dissolved in ethanol before use. Schneider's medium was obtained from GIBCO Life Technologies (Invitrogen Ltd, Paisley, UK). Neuropeptides CAP_2b (pyroELYAFPRV-amide; Davies et al., 1995) and Drosokinin (NSVVLGKKQRFHSWG-amide; Terhzaz et al., 1999) were synthesised by Research Genetics, Inc.(Invitrogen Ltd). All other chemicals were obtained from Sigma (Pool, UK).

Drosophila melanogaster (Meigen) were maintained on a 12h: 12h L:D cycle on standard cornmeal—yeast—agar medium at 25°C. Oregon R(OrR) wild-type flies used were those described previously(Dow et al., 1994). Mutant lines of norpA (Bloomquist et al.,1988; Pearn et al.,1996) and itpr(Venkatesh and Hasan, 1997)have been described previously. itpr lines were used as out-crossed lines to OrR to rule out the effects of balancer chromosomes on the tubule phenotype. Multiple alleles were utilised in this study in order to control for any effects of genetic background in individual lines. Choice of alleles was based on the health of the lines. Lines used were as follows: norpA^H52/norpA^H52 (temperature-sensitive allele); norpA^P24/norpA^P24 (kind gifts of R. C. Hardie, University of Cambridge); itpr^XR12/+ (X-ray inversion); itpr^90B.0/+, itpr¹⁶⁶⁴/+, itpr¹⁶⁶⁴/itpr^XR12,itpr¹⁶⁶⁴/itpr^90B.0 and itpr¹⁶⁶⁴/itpr¹⁶⁶⁴ (P-element insertions); itpr^WC361/itpr^UG3 (EMS alleles). itprlines were slow-growing due to eclosion defects(Venkatesh and Hasan, 1997). Additionally, the following lines were also utilised:hsGAL4;itpr^90B.0 and UAS-itpr(Venkatesh et al., 2001). Temperature-sensitive (ts) and hsGAL4 lines were heat-shocked at 37°C for 30 min and left to recover at 23°C before experimentation.

To produce flies in which tubule calcium measurements could be made using the calcium reporter aequorin (Rosay et al., 1997; Terhzaz et al.,1999), it was necessary to generate itpr lines in an aequorin background under control of an hsGAL4 promoter. These were based on an X-chromosome insertion of UAS-aeq, and an hsGAL4 construct on chromosome 2,leaving chromosome 3 free for itpr alleles. The following lines were generated and utilised for this study:aeq;hsGAL4;itpr^XR12/+,aeq;hsGAL4;itpr^90B.0/+,aeq;hsGAL4;itpr¹⁶⁶⁴/+,aeq;hsGAL4;itpr¹⁶⁶⁴/itpr¹⁶⁶⁴ and aeq;hsGAL4;itpr^WC361/itpr^UG3. Extremely poor viability of the itpr¹⁶⁶⁴/itpr^XR12 and itpr¹⁶⁶⁴/itpr^90B.0 heteroallelics in the aequorin background did not allow use of these lines for calcium measurements. Verification of aequorin expression was achieved at several stages of the crossing procedure by measuring total light output by dissected, intact tubules after lysis in Triton/CaCl₂ as described below. The presence of the appropriate itpr allele was verified in progeny of aeq;itpr flies by RT-PCR. Maintenance of the itpr phenotype was assessed by fluid transport assays in the presence of either CAP_2b or Drosokinin.

Flies were cooled on ice and then decapitated prior to isolation of whole tubules. Malpighian tubules were isolated into 10 μl drops of a 1:1 mixture of Schneider's medium and Drosophila saline (NaCl, 117.5 mmoll^-1; KCl, 20 mmoll^-1; CaCl₂, 2 mmoll^-1; MgCl₂, 8.5 mmoll^-1;NaHCO₃, 10.2 mmoll^-1; NaH₂PO₄, 4.3 mmoll^-1; Hepes, 15 mmoll^-1; glucose 20 mmoll^-1) under liquid paraffin, and fluid secretion rates were measured as described previously (Dow et al., 1994) under the different conditions described in the text. CAP_2b and Drosokinin were added as solutions in assay medium at 30 min.

The recently characterised Drosokinin receptor(Radford et al., 2002) was used to assay Drosokinin-stimulated IP₃ production. In order to transfect S2 cells with Drosokinin receptor, the protocol described below was adopted.

Primers were designed for the Drosokinin receptor (CG1062; Radford et al., 2002) to allow amplification from the start to the stop codon of the coding sequence. Forward primers were designed to include a 5′ Kozak translational initiation sequence (G/ANNATGG). Amplification was carried out with EXPAND High Fidelity Polymerase (Roche Diagnostics Ltd, Lewes, UK)according to manufacturers instructions. Forward (GACATGGACTTAATCGAGCAGGAG)and reverse (TTAAAGTGGTTGCCACAAGGAC) primers were used to generate a fragment of 1626bp. OrR cDNA was used as template. The PCR product was purified by gel extraction and directly cloned into the pMT-V5/His TOPO TA inducible expression vector (Invitrogen). The construct was verified by restriction enzyme digestion and sequencing to ensure that no mutations had been induced during cloning.

S2 cells were maintained in DES (Drosophila expression system)medium (Invitrogen) supplemented with 10% heat-inactivated foetal calf serum(FCS; Invitrogen). Cells were grown in suspension at an initial density of 2-4×10⁶ cells ml^-1 at 23°C. S2 cells were transiently transfected at a density of 1×10⁶ cells ml^-1 using calcium phosphate (Invitrogen), according to manufacturer's instructions. Cells were transfected with 20μg of the Drosokinin receptor expression construct and were used 24h post-induction of the metallothionein promoter with Cu²⁺ ions.

IP₃ levels in tubules were measured by a quantitative radioligand-binding assay as described elsewhere(Palmer et al., 1989) using an IP₃-binding protein preparation derived from bovine adrenal gland.

Tubules (20 per sample) were dissected from wild-type and itprmutants into 9μl of Schneider's medium. Samples were stimulated with CAP_2b (10^-7 moll^-1) for 0 s (control), 2 s or 5 s in a final sample volume of 10μl and performed in triplicate. Initial experiments showed that IP₃ levels peaked at 5 s post-stimulation(data not shown); this time was used for all subsequent experiments.

To stimulate S2 cells, Drosokinin(Terhzaz et al., 1999) was diluted to working concentration in DES medium/FCS, then added to 5×10⁴ cells (approximating to 5000 transfected cells) in DES medium/FCS to a final concentration of 10^-7 moll^-1 for the appropriate time. Initial experiments showed that peak IP₃generation occurred at 10 s after peptide stimulation (data not shown). Cells were co-transfected with an eGFP (enhanced green fluorescent protein) control plasmid in order to measure transfection efficiency using a haemocytometer. The same transfection batch was used for all samples in any one data set;stimulations were performed in duplicate.

For both tubule and S2 cell preparations, reactions were terminated with 10% (v/v) ice-cold perchloric acid and samples were homogenised using a Polytron homogeniser on ice. Cellular debris was removed by centrifugation and the supernatants neutralised with 1.5 moll^-1 KOH/60 mmoll^-1 Hepes in the presence of 2μl Universal Indicator. Precipitated salts were spun down and the supernatants transferred to fresh tubes. Additions of 2500 d.p.m. [³H]Ins(1,4,5)P₃([³H]IP₃; specific activity 370-1850 GBq mmoll^-1; Amersham Biosciences UK Ltd, Little Chalfont, UK),incubation buffer and binding protein were made [final concentrations: 25 mmoll^-1 Tris-HCl (pH 9); 5 mmoll^-1 NaHCO₃; 1 mmoll^-1 EDTA; 1 mmoll^-1 EGTA; 0.25 mmoll^-1dithiothreitol (DTT); 1 mg ml^-1 bovine serum albumin (Fraction V);0.4 mg ml^-1 binding protein] to a final volume of 400μl, and the samples were incubated on ice for 45 min prior to centrifugation at 12 000g (4°C) for 1 min. Supernatants were removed by aspiration, the pellets dissolved in 1 ml of scintillation fluid and the radioactivity therein determined by scintillation counting. A standard curve,using 0-40 pmol IP₃ per sample, was generated in parallel. Non-specific binding was determined using 100 pmol IP₃. Standard curves were plotted as %B/Bo versus pmol of unlabelled IP₃, where B is the specific binding of[³H]IP₃ (at a given concentration of unlabelled IP₃), and Bo is the maximal specific binding of[³H]IP₃ (at 0 pmol of unlabelled IP₃). A similar calculation was made using values of specific binding of[³H]IP₃ of tissue samples and the IP₃ content therein determined using the standard curve.

Protein concentrations in tubule samples were assessed by Lowry assays. Three replicate samples were pooled for assay of IP₃ content in order to obtain measurable levels of IP₃. Duplicate samples were assayed for each experimental sample.

hsGAL4;aeq (Rosay et al.,1997) were used as control animals, and protocols used were essentially those previously described. For each assay, 20-40 tubules from 4-14-day-old adults were dissected in Schneider's medium 2 h after heat-shock(37°C for 30 min). Tubules were pooled in 160μl of the same buffer and aequorin reconstituted with the cofactor coelenterazine (final concentration,2.5 μmoll^-1). Bioluminescence recordings were made with a luminometer (LB9507; Berthold, Pforzheim, Germany); recordings were made every 0.1 s for each tube. Each tube of 20 tubules was used for a single data point:after recording [Ca²⁺]_i levels, tissues were disrupted in 350μl lysis solution [1% (v/v) Triton X-100/100 mmoll^-1CaCl₂], causing discharge of the remaining aequorin and allowing estimation of the total amount of aequorin in the sample. Calibration of the aequorin system and calculation of [Ca²⁺]_i were performed as previously described (Rosay et al., 1997). Mock injections with Schneider's medium were applied to all samples prior to treatment with neuropeptides.

Two norpA alleles of differing severity were available for study. norpA^P24 eyes do not express norpA protein, as assessed by western blots, and show markedly reduced PLC activity(Pearn et al., 1996); as expected, norpA^P24 shows no electroretinogram response to any light stimulus. This allele, therefore, would be expected to display a severe phenotype if norpA acted in tubule function. In norpA^H52, however, some norpA transcript is detectable at the restrictive temperature, although this is severely reduced compared with wild type (Bloomquist et al.,1988). As such, any epithelial phenotype would not be expected to be as severe as that of norpA^P24.

Both norpA mutants manifest an epithelial phenotype(Fig. 1). No significant change in basal secretion rate was observed repeatedly in norpA mutants;however, both alleles, norpA^H52 and norpA^P24, severely attenuated CAP_2b-induced secretion to similar extents (Fig. 1A). By contrast, for Drosokinin-stimulated fluid transport, the norpA alleles were distinguishable(Fig. 1B); in the eye, norpA^P24 displays a much more severe phenotype compared with norpA^H52. Kinetics of the fluid secretion response in all lines were similar.

Thus, the data show that fluid transport induced by both CAP_2band Drosokinin requires a PLCβ-dependent signalling pathway; as such, norpA function is not confined to phototransduction.

CAP_2b and Drosokinin have both been shown to act through intracellular calcium; so, if their action relies on PLC(Fig. 1), they should also each act to raise IP₃ in tubules. Table 1 shows that CAP_2b, which acts only on principal cells, increases IP₃levels in intact wild-type tubules. This, together with the data in Fig. 1, shows that CAP_2b acts via a phosphoinositide (PI)-PLC-dependent mechanism.

Aedes leucokinins have been shown to stimulate IP₃production in mosquito tubules (Cady and Hagedorn, 1999). However, as Drosokinin exerts its effects solely via stellate cells in Drosophila tubules(Terhzaz et al., 1999), and as Drosophila tubules each contain only 22 stellate cells(Sozen et al., 1997),Drosokinin-stimulated IP₃ levels could not be reliably quantified in intact tubules (data not shown). Accordingly, an in vitro approach was used. Drosophila S2 cells transfected with the Drosokinin receptor have been shown to display increased cytosolic intracellular calcium when stimulated with Drosokinin (Radford et al., 2002). Data in Table 1 show that Drosokinin increases IP₃ content in these cells by approximately eightfold. As the Drosokinin receptor has been localised to only stellate cells in vivo(Radford et al., 2002), it is probable that Drosokinin stimulates IP₃ production in stellate cells in intact tubules. As with CAP_2b, Drosokinin action requires activation of PI-PLC.

Intracellular signalling is frequently regulated by feedback. If IP₃ signalling contributes to the biological effects of neuropeptides in tubules, lesions in the IP₃R might feed back to downregulate the IP₃ signalling molecule in vivo.

Measurement of basal IP₃ levels in wild-type and itprtubules shows that disruption of IP₃R results in a reduction in resting IP₃ levels. Significant reductions in basal IP₃levels are observed in heterozygous alleles, homozygous itpr¹⁶⁶⁴/itpr¹⁶⁶⁴ and heteroallelic lines(Fig. 2A).

IP₃ levels were also measured in neurohormone-stimulated intact tubules. As Drosokinin-stimulated IP₃ production was not measurable in intact tubules, experiments were conducted only on CAP_2b-stimulated wild-type and itpr tubules(Fig. 2B). IP₃content is increased in all CAP_2b-stimulated itpr tubules,although to a lesser extent in homozygous itpr¹⁶⁶⁴/itpr¹⁶⁶⁴ and heteroallelic itpr^WC361/itpr^UG3 lines compared with wild type. However, these differences are not statistically significant. Thus,tubules from itpr mutants are able to generate IP₃ in response to CAP_2b, suggesting that PI-PLC-dependent signalling is not compromised in these lines.

As mutations in norpA result in an epithelial phenotype, we investigated the possibility of uncovering such phenotypes in itprmutants. We show that CAP_2b stimulation of fluid transport is inhibited in heterozygous, homozygous and heteroallelic itpr alleles(Fig. 3A). Significant inhibition is observed in itpr^90B.0/+, itpr¹⁶⁶⁴/itpr^XR12 and itpr¹⁶⁶⁴/itpr^90B.0. However,CAP_2b-stimulated fluid transport is almost completely abolished in the homozygous itpr¹⁶⁶⁴/itpr¹⁶⁶⁴ and heteroallelic itpr^WC361/itpr^UG3 lines. It is possible that the non-correlation between the severity of the alleles(itpr¹⁶⁶⁴/itpr^90B.0 versus itpr¹⁶⁶⁴/itpr¹⁶⁶⁴) and CAP_2b-stimulated transport in these alleles is due to either differences in genetic background or by impact of the mutations on other interacting signalling pathways that are activated by CAP_2b.

By contrast, Drosokinin-stimulated fluid transport is not affected by either heterozygous itpr^XR12/+, itpr^90B.0/+ or itpr¹⁶⁶⁴/+ alleles(Fig. 3B). Significant inhibition is only observed in the heteroallelics itpr¹⁶⁶⁴/itpr^XR12,itpr¹⁶⁶⁴/itpr^90B.0 and itpr^WC361/itpr^UG3 and in the homozygous itpr¹⁶⁶⁴/itpr¹⁶⁶⁴. Furthermore, there are marked differences in the severity of inhibition between Drosokinin- and CAP_2b-stimulated fluid transport, especially in itpr¹⁶⁶⁴/itpr¹⁶⁶⁴ and itpr^WC361/itpr^UG3 alleles.

Thus, itpr acts in both principal and stellate cells to transduce CAP_2b and Drosokinin diuretic signals.

Sometimes, phenotypes ascribed to mutant loci in Drosophila are subsequently found to be caused by second-site mutations or other genetic accidents incidental to the original study. It is thus desirable to confirm that mutant effects are genuinely due to the locus of interest. Crosses were established between heterozygous hsGAL4;itpr^90B.0 and UAS-itpr homozygotes to allow rescue of itpr^90B.0. Tubules from flies with the w/UAS-itpr;+/hsGAL4;+/itpr^90B.0 genotype were used in transport assays. Control lines used were OrR and UAS-itpr. Non-heat-shocked w/UAS-itpr;+/hsGAL4;+/itpr^90B.0were not used as controls, as the heat-shock promoter is `leaky' and is transcribed at 25°C (G. Hasan, unpublished).

Fig. 4 shows that expression of itpr restores CAP_2b-stimulated fluid transport to levels indistinguishable from wild-type. Although disruption of itprmay compromise associated signalling pathways resulting in downregulation of CAP_2b-stimulated transport, successful rescue of itpr^90B.0/+ with USA-itpr provides strong evidence that the epithelial phenotype observed in this line is associated with mutated itpr.

Previous work has shown that capa peptides(Kean et al., 2002) increase intracellular calcium in tubule main segment principal cells(Rosay et al., 1997) via plasma membrane calcium channels (MacPherson et al., 2000, 2001). However, release from intracellular stores is not measurable in this cell type(Rosay et al., 1997), thus calling into question the role of IP₃R-sensitive stores in principal cells. If release of calcium from IP₃-sensitive internal stores does occur upon CAP_2b stimulation, changes in this response may be observed in itpr mutants.

Using targeted aequorin, cytosolic calcium measurements in wild-type and itpr tubules stimulated with CAP_2b were performed; typical traces are shown in Fig. 5A. Fig. 5Ai shows the biphasic rise, consisting of a rapid primary peak followed by a slow secondary rise in cytosolic calcium in CAP_2b-stimulated wild-type aeq;hsGAL4 tubules. This calcium signature is also observed in capa/CAP_2b-stimulated wild-type tubules (Kean et al.,2002). The response is reduced in heterozygous itpralleles, aeq;hsGAL4;itpr^XR12/+ and aeq;hsGAL4;itpr^90B.0/+(Fig. 5B), which may result in the transport phenotype observed. Interestingly, in heterozygous itpr¹⁶⁶⁴/+, the primary response is unaffected, with only the secondary response being reduced; in this line, stimulated fluid transport is not significantly different from control(Fig. 3A). By contrast, the alleles that display the most severe transport phenotype(itpr¹⁶⁶⁴/itpr¹⁶⁶⁴ and itpr^WC361/itpr^UG3) also display an attenuated calcium response to CAP_2b (Fig. 5Av,vi,B). Both reduction in the primary peak and loss of the secondary rise are observed in these lines. However, none of the itpralleles completely abolish CAP_2b-stimulated calcium signalling. This is consistent with itpr being an essential gene and with viable alleles all being hypomorphs rather than nulls.

These results thus suggest that IP₃R-mediated calcium release from intracellular stores contributes significantly to calcium signalling, and consequent diuresis, in principal cells.

We have shown previously that leucokinin(Rosay et al., 1997; O'Donnell et al., 1998) and endogenous Drosophila leucokinin(Terhzaz et al., 1999) elevate intracellular calcium levels in stellate cells. Furthermore, experiments in calcium-free medium show that stellate cells display emptying of intracellular calcium stores in the presence of the ER-calcium ATPase inhibitor,thapsigargin (Rosay et al.,1997). Thus, Drosokinin-stimulated calcium increases should be reduced in itpr mutants.

Data in Fig. 6A show typical traces of Drosokinin-stimulated increases in cytosolic calcium in wild-type and itpr tubules. A rapid response is observed in wild-type tubules(Fig. 6Ai; Terhzaz et al., 1999; Radford et al., 2002). This response is severely reduced in itpr¹⁶⁶⁴/itpr¹⁶⁶⁴ and itpr^WC361/itpr^UG3 flies(Fig. 6Av,vi,B). Drosokinin-stimulated fluid transport is also reduced in these lines(Fig. 3B); thus, functional IP₃R contributes to Drosokinin-stimulated calcium signalling and fluid transport.

The role of PLC in vivo has been most studied in Drosophila phototransduction. Experimental evidence suggested that norpA and plc21 were expressed in the eye or CNS(Bloomquist et al., 1988; Shortridge et al., 1991);furthermore, the dependence of phototransduction on PI-PLC supported specific roles for these genes in the eye. However, RT-PCR data show that norpA and plc21 are both expressed in tubules (M. R. MacPherson and V. P. Pollock, unpublished). We have shown here that norpA mutants display an epithelial phenotype, which is revealed upon neuropeptide stimulation. Furthermore, the severity of the epithelial response for each allele correlates with that observed in the eye and also with the levels of expression of norpA and biochemical activity of PLC. However, while we have established an epithelial role for norpA, it has been difficult to assess the contribution of plc21 to epithelial transport and signalling due to our lack of genetic tools and suitable antibodies.

IP₃ and IP₃R have been shown to be critical for calcium signalling in non-excitable cells via a mechanism of IP₃-induced release of calcium from internal stores. Previous work has shown that IP₃R is expressed in Malpighian tubules(Pollock et al., 2000; Blumenthal, 2001). We now ascribe functional significance to this finding and show that CAP_2bstimulates IP₃ production in intact Drosophila tubules. Furthermore, we show that Drosokinin mobilises IP₃ in Drosokinin receptor-transfected S2 cells.

A role for IP₃R in neurohormone-stimulated epithelial transport has been demonstrated using an allelic series of itpr mutants. These itpr lines have been extensively investigated previously in order to determine the role of IP₃R in vivo. itpr^XR12/+(inversion), itpr^90B.0/+ (null) and itpr¹⁶⁶⁴/+ (hypomorph) display delayed moulting and reduced expression of the ecdysone-inducible gene E74. In terms of severity, itpr^90B.0 and itpr^XR12 are the most severe alleles (Venkatesh and Hasan, 1997). These lines, as well as itpr^WC361/itpr^UG3, have also been used in studies of olfaction, where it has been shown that, in the most severe alleles, olfactory adaptation is not maintained(Deshpande et al., 2000). CAP_2b-stimulated epithelial transport is reduced in the null mutant(itpr^90B.0) compared with wild-type tubules, while the most severe phenotypes are observed in itpr¹⁶⁶⁴homozygotes and the heteroallelics. Rescue of the itpr^90B.0 transport phenotype is demonstrated with UAS-itpr, which strongly suggests that the tubule phenotype is associated with disruption in IP₃R. Interestingly, while the null mutant displays a phenotype upon CAP_2b stimulation, only the most severe itpr¹⁶⁶⁴ homozygotes and the heteroallelics affect Drosokinin-stimulated secretion. Therefore, reduced CAP_2b-stimulated fluid transport in itpr^90B.0may be due to principal cell-specific signalling processes associated with the null mutation.

Intriguingly, resting levels of IP₃ in tubules are significantly reduced in all itpr mutants apart from itpr¹⁶⁶⁴/itpr^XR12, suggesting a possible feedback mechanism between receptor (IP₃R) and second messenger(IP₃). However, this is not associated with an epithelial phenotype, as no difference in basal rate is observed in tubules from itpr lines as compared to wild-type flies.

We have previously shown that the neuropeptide CAP_2b induces a rise in cytosolic calcium in only principal cells that is dependent on extracellular calcium; these calcium signalling events, which may mediate NO/cGMP signalling, correlate with CAP_2b-stimulated fluid transport. The CAP_2b-induced response is abolished by L-type calcium channel inhibitors and also in mutants for the plasma membrane calcium channels, TRP and TRPL (MacPherson et al., 2000, 2001). Thus,CAP_2b-induced calcium signalling occurs via multichannel mechanisms. We demonstrate here that IP₃R plays a role in CAP_2b-induced calcium signalling(Fig. 5). Extensive work using norpA mutants has shown that norpA-encoded PLC plays a critical role in rhabdomeres. Thus, PLCβ, which is required for the cleavage of phosphatidylinositol (4,5)-bisphosphate (PIP₂) to IP₃ and diacylglycerol (DAG), is necessary for phototransduction. Interestingly, however, using the itpr null and itpr¹⁶⁶⁴ mutants, IP₃ signalling has been shown to be unnecessary to activate light-activated conductance(Raghu et al., 2000a). This response is, however, dependent on calcium entry via TRP/TRPL channels. DAG has been shown to activate native TRP and TRPL channels in photoreceptors and recombinant TRPL channels(Chyb et al., 1999). Furthermore, recent studies have supported the role of DAG in TRP/TRPL action:DAG kinase mutants display constitutive activation of TRP and TRPL channels(Raghu et al., 2000b), and, in vertebrate cells, TRPC3 (transient receptor potential-like channel 3) has been shown to be activated by DAG independently of IP₃R(Venkatachalam et al., 2001). Thus, PLC is involved in regulation of TRP/TRPL plasma membrane calcium channels without a requirement for IP₃. It is possible, then, that PLC-activated DAG generation may regulate TRP/TRPL channels in tubules, which may contribute significantly to the `multichannel' mode of action of CAP_2b. Furthermore, if DAG/TRP/TRPL signalling were compromised in some itpr lines, this may explain the significant impact of itpr alleles (for example, itpr null) on CAP_2b-stimulated, but not Drosokinin-stimulated, fluid transport and calcium signalling (Figs 3, 5).

Previous work has shown that leucokinin and Drosokinin increase cytosolic calcium concentration in only stellate cells in tubules, which express the Drosokinin receptor (Rosay et al.,1997; Terhzaz et al.,1999; Radford et al.,2002). This suggests that IP₃-mediated calcium signalling may occur in stellate cells. Activation of calcium signalling may be linked to chloride shunt conductance, which is also confined to stellate cells (O'Donnell et al.,1998). It is thus possible that Drosokinin stimulates PLCβ-dependent, IP₃-mediated calcium signalling in stellate cells in vivo, which increases chloride conductance, resulting in increased fluid transport.

Thus, Malpighian tubules, in contrast to photoreceptors, require both functional PLCβ and IP₃R for neuropeptide-activated signal transduction in principal and stellate cells. The expression of plc21in tubules, however, and the role of DAG on plasma membrane calcium channels suggest that extremely complex mechanisms of signalling are used by tubule cells.

In summary, we have demonstrated non-neuronal, epithelial phenotypes for norpA (PLCβ) and itpr (IP₃R) and have correlated cell-specific signalling events for both IP₃ and calcium to transport phenotypes.

This work was supported by the BBSRC.