...Pei Zhi Cheryl Chia; Isabelle Gasnereau; Zi Zhao Lieu; Paul A. Gleeson The endopeptidase furin and the trans -Golgi network protein TGN38 are membrane proteins that recycle between the TGN and plasma membrane. TGN38 is transported by a retromer-dependent pathway from early endosomes to the TGN...

..., golgin-97 and golgin-245, onto Golgi membranes. Furthermore, we show that, in concert with Arl1 and GRIP proteins, ARFRP1 is implicated in the Golgi-to-plasma membrane transport of the vesicular stomatitis virus G protein as well as in the retrograde transport of TGN38 and Shiga toxin from endosomes...

... cores. Vesicles containing non-secreted, internalized prolactin did not colocalize with DiI-LDL that had been chased into lysosomes but did transiently colocalize with internalized transferrin. The recycling vesicles also trafficked through a syntaxin 6-positive compartment but not the TGN38-positive...

... participates in Golgi function in living cells through the expression of a dominant negative dynamin construct (K44A). Cells co-transfected to express this mutant dynamin and a GFP-tagged Golgi resident protein (TGN38) exhibit Golgi structures that are either compacted, vesiculated, or tubulated. Electron...

...Sreenivasan Ponnambalam; Milena Girotti; Marie-Laure Yaspo; Charles E. Owen; Anthony C. F. Perry; Tatsuo Suganuma; Tommy Nilsson; Mike Fried; George Banting; Graham Warren ABSTRACT cDNAs encoding the human and macaque homologues of rat TGN38 have been cloned and sequenced. The proteins have...

.... Primers used were: 5′GTCGACGGATCCACCATGATTCACACCAACCTGAAG3′;and 5′GTCGACGGATCCTTACTTTCCCAGCCTGTTCATCTCTA-TATCGGTGTAAGGGCAGTGAATGGTCCGGAAGCC3′. The PCR product was sequenced and subcloned into the Bam HI site of pSRα (DNAX, Palo Alto, CA). A full length cDNA encoding rat TGN38 ( Luzio et al...