ABSTRACT

Dysregulation of the homeostatic balance of histone H3 di- and tri-methyl lysine 27 (H3K27me2/3) levels caused by the mis-sense mutation of histone H3 (H3K27M) is reported to be associated with various types of cancers. In this study, we found that reduction in H3K27me2/3 caused by H3.1K27M, a mutation of H3 variants found in patients with diffuse intrinsic pontine glioma (DIPG), dramatically attenuated the presence of 53BP1 (also known as TP53BP1) foci and the capability of non-homologous end joining (NHEJ) in human dermal fibroblasts. H3.1K27M mutant cells showed increased rates of genomic insertions/deletions and copy number variations, as well as an increase in p53-dependent apoptosis. We further showed that both hypo-H3K27me2/3 and H3.1K27M interacted with FANCD2, a central player in the choice of DNA repair pathway. H3.1K27M triggered the accumulation of FANCD2 on chromatin, suggesting an interaction between H3.1K27M and FANCD2. Interestingly, knockdown of FANCD2 in H3.1K27M cells recovered the number of 53BP1-positive foci, NHEJ efficiency and apoptosis rate. Although these findings in HDF cells may differ from the endogenous regulation of the H3.1K27M mutant in the specific tumor context of DIPG, our results suggest a new model by which H3K27me2/3 facilitates NHEJ and the maintenance of genome stability.

This article has an associated First Person interview with the first author of the paper.

INTRODUCTION

Over the past few decades, accumulating evidence has supported a critical role for aberrant epigenetic regulation and alterations in histone modification in the development of diverse cancers (Allis and Jenuwein, 2016; Lewis et al., 2013; Dawson and Kouzarides, 2012; Jones and Baylin, 2007). One histone modification of particular interest is di- and tri-methylation of lysine 27 on histone H3 (H3K27me2/3), a classic epigenetic marker for transcriptional gene silencing (Pirrotta, 1997; Cao et al., 2002; Margueron and Reinberg, 2011; Xiong et al., 2016). Excessive levels of H3K27me2/3 due to over-expression and gain-of-function mutation of the methyltransferase EZH2 have been found in a wide variety of tumours (Albert and Helin, 2010; Ezponda and Licht, 2014). However, a global decrease in H3K27me2/3 due to mutations of EZH2 that disable its methylation activity have also been identified in leukaemia and myeloid malignancies (Ernst et al., 2010; Kim et al., 2014). Direct mutation of histone H3 lysine 27 is involved in non-brainstem paediatric glioblastoma (non-BS-PG) and diffuse intrinsic pontine glioma (DIPG) (Wu et al., 2012; Schwartzentruber et al., 2012). Nearly 80% of DIPGs harbour mutations in canonical (H3.1) or variant (H3.3) histone H3 genes, with lysine 27 substituted by methionine (H3K27M) (Schwartzentruber et al., 2012). Unlike the replication-independent histone H3.3 variant, H3.1 is the major H3 variant and can be incorporated in a replication- or repair-dependent manner (Tagami et al., 2004; Polo et al., 2006). H3K27M mutants bind and inhibit the catalytic SET domain of EZH2 (Justin et al., 2016), resulting in a global loss of H3K27me2/3 (Lewis et al., 2013; Chan et al., 2013). In addition to the known role of the modification in transcription (Cao et al., 2002; Xiong et al., 2016; Pirrotta, 2009; Margueron and Reinberg, 2011), it remains to be understood what role H3.1K27M plays in tumorigenesis.

Genome instability is a hallmark of tumour progression (Hanahan and Weinberg, 2011; Zhao et al., 2013; Liu et al., 2012; Wang et al., 2015) and the DNA damage repair machinery is the major guardian of genome integrity in mammalian cells (Li et al., 2016; Schultz et al., 2000). Of all types of DNA damage, DNA double-strand breaks (DSBs) are the most difficult to repair and therefore pose the greatest challenge to cells if left unrepaired (Halazonetis et al., 2008). DNA non-homologous end-joining (NHEJ) is the major DSB rejoining pathway that occurs in all cell cycle stages, while homologous recombination (HR) functions in S/G2 phase. PRC2 proteins have been shown to accumulate at sites of DSBs and knockdown of any component could result in an increase in radiation sensitivity (Chou et al., 2010; O'Hagan et al., 2008; Seiler et al., 2011; Johnson et al., 2015; Campbell et al., 2013). PRC2 was also required for ionizing-radiation-induced H2AK119ub foci and DSB-induced transcriptional silencing, thus promoting DSB repair (Kakarougkas et al., 2014). Moreover, a recent study has found the PRC2 complex to be involved in the regulation of Fanconi anaemia (FA) pathway activation by modulating chromatin states (Vierra et al., 2017). However, it remains unclear whether H3K27me2/3 also participates in DSB repair or which repair pathway is responsible. A more detailed elucidation of the function of H3K27me2/3 in the DNA damage response could help further explicate the mechanism of hypo-H3K27me2/3 in tumorigenesis.

In this study, we constructed the H3.1K27M mutant and established a hypo-H3K27me2/3 cell line to explore the role of H3K27me2/3 in DSB repair. We provide direct evidence that H3.1K27M or hypo-H3K27me2/3 significantly reduced 53BP1 foci number and NHEJ repair efficiency. Further investigation showed that H3.1K27M interacted with FANCD2 and loss of H3K27me2/3 promotes FANCD2 association on chromatin, which in turn upregulates recruitment of Tip60 (KAT5), elevates local H4K16ac levels and blocks H4K20me2, the docking site for 53BP1 (van Nuland and Gozani, 2016; Panier and Boulton, 2014). Our results demonstrate that deficiencies in DSB repair, stemming from H3.1K27M and hypo-H3K27me2/3, lead to genome instability, thus providing a new perspective on the pathogenesis of cancers related to H3.1K27M or low H3K27me2/3. Moreover, the reduction of H3K27me2/3 levels promoted the sensitivity of cells towards bleomycin treatment, which provides a novel therapeutic strategy for relevant cancers.

RESULTS

The presence of H3.1K27M or loss of H3K27me2/3 reduces the number of 53BP1 and pDNA-PKcs foci

Chromatin remodelling is believed to be a critical step for DSB repair. In many cases, chromatin structure and nucleosomal organization often represent a barrier to the DSB repair machinery (Price and D'Andrea, 2013). This model has been supported by various lines of evidence, with our recent work and others showing that a reduction in condensed heterochromatin promotes DSB repair (Goodarzi et al., 2008; Chiolo et al., 2011; Chen et al., 2015; An et al., 2017). Histone H3 with hyper-methylation at lysine 27 causes another type of repressive chromatin and is often associated with gene silencing via polycomb group protein (PcG) repression (Pirrotta, 1998, 1997; Simon and Kingston, 2009, 2013). The PRC2 complex has been reported to be related to DSB repair (Campbell et al., 2013; Chou et al., 2010; Kakarougkas et al., 2014; Vierra et al., 2017), however, it is not clear whether the aberrant changes in H3K27me2/3 levels caused by pathological events, such as mutations in EZH2 or presence of H3.1K27M, may directly affect DSB repair efficiency, thus altering genome stability and potentially leading to carcinogenesis. To test this hypothesis, we established stable cell lines ectopically expressing haemagglutinin (HA)-tagged histone H3.1 wild-type (WT) or H3.1K27M mutant by transfecting human primary dermal fibroblasts (HDFs) with lentiviruses (Fig. S1A). In accordance with previous studies on histone H3.3 (Lewis et al., 2013; Funato et al., 2014; Chan et al., 2013; Bender et al., 2013), exogenous expression of H3.1K27M caused a marked reduction in H3K27 di- and tri-methylation (H3K27me2/3) (Fig. 1A). To examine whether the presence or formation of foci containing 53BP1, which serves as a marker for DSBs and promotes NHEJ-mediated DSB repair (Panier and Boulton, 2014), was affected, cell lines expressing H3.1WT and H3.1K27M at different time points after ionizing radiation (IR) treatment (X-ray, 8 Gy) were tested by immunofluorescence staining. There was a 40% reduction in the number of 53BP1 foci per nucleus at 5 min, and an ∼60% reduction at 30 min post IR in H3.1K27M mutant cell lines compared with H3.1WT cells (Fig. 1B,C). This reduction did not seem to be due to altered expression of 53BP1, as the level of 53BP1 was similar in cells expressing H3.1K27M versus H3.1WT before or after induction of DNA damage with bleomycin, a chemotherapeutic drug that produces DSB lesions (Aouida and Ramotar, 2010) (Fig. 1A, Fig. S1B).

Fig. 1.

Reduction of H3K27me3 causesinhibition of 53BP1 and pDNA-PKcs foci formation. (A) Immunoblots of whole-cell extracts from HDF cell lines stably expressing H3.1WT or H3.1K27M (left) and from shRNA-mediated EZH2 knock-down (sh EZH2) or negative control (sh NC) cell lines (right). (B) Immunofluorescence analysis of 53BP1 (red) foci at different time points post IR (X-ray, 8 Gy) in the indicated HDF stable cell lines. (C) Quantification of 53BP1 foci per nucleus at different time points in cells treated as described in B. At least 50 cells were counted for each time point. Data from three independent experiments are presented as the mean±s.e.m. ***P<0.001 (two-tailed unpaired t-test, n=3). (D) Immunoblots of whole-cell extracts from HDF cell lines stably expressing H3.1WT or H3.1K27M (left) and from shRNA-mediated EZH2 knockdown (sh EZH2) or negative control (sh NC) cell lines (right). (E) Immunofluorescence analysis of pDNA-PKcs (red) foci at different time points post bleomycin treatment (5 μg/ml for 4 h) in the indicated HDF stable cell lines. (F) Quantification of pDNA-PKcs foci per nucleus at different time points in cells treated as described in E. At least 50 cells were counted for each time point. Data from three independent experiments are presented as the mean±s.e.m. ***P<0.001 (two-tailed unpaired t-test, n=3).

Fig. 1.

Reduction of H3K27me3 causesinhibition of 53BP1 and pDNA-PKcs foci formation. (A) Immunoblots of whole-cell extracts from HDF cell lines stably expressing H3.1WT or H3.1K27M (left) and from shRNA-mediated EZH2 knock-down (sh EZH2) or negative control (sh NC) cell lines (right). (B) Immunofluorescence analysis of 53BP1 (red) foci at different time points post IR (X-ray, 8 Gy) in the indicated HDF stable cell lines. (C) Quantification of 53BP1 foci per nucleus at different time points in cells treated as described in B. At least 50 cells were counted for each time point. Data from three independent experiments are presented as the mean±s.e.m. ***P<0.001 (two-tailed unpaired t-test, n=3). (D) Immunoblots of whole-cell extracts from HDF cell lines stably expressing H3.1WT or H3.1K27M (left) and from shRNA-mediated EZH2 knockdown (sh EZH2) or negative control (sh NC) cell lines (right). (E) Immunofluorescence analysis of pDNA-PKcs (red) foci at different time points post bleomycin treatment (5 μg/ml for 4 h) in the indicated HDF stable cell lines. (F) Quantification of pDNA-PKcs foci per nucleus at different time points in cells treated as described in E. At least 50 cells were counted for each time point. Data from three independent experiments are presented as the mean±s.e.m. ***P<0.001 (two-tailed unpaired t-test, n=3).

To determine whether the reduction of 53BP1 foci number was due to the hypo-H3K27me2/3 state in H3.1K27M cells, we established a stable cell line with EZH2 knockdown. As expected, the number of 53BP1 foci was reduced by 40% and 41% at 5 min and 30 min after DSB induction, respectively, in cells stably expressing EZH2 shRNA (Fig. 1A-C). Collectively, these results suggest that the presence of H3.1K27M or a decreased H3K27me2/3 level prevents the formation of 53BP1 foci after IR treatment. We next examined the status of DNA-PKcs phosphorylation at T2609 (pDNA-PKcs), a modification of the key NHEJ factor that facilitates DNA end-processing and serves as a proxy for NHEJ-dependent DSB repair (Lieber, 2008). As shown in Fig. 1D-F, the number of pDNA-PKcs foci per nucleus was decreased in H3.1K27M cells and also in cells stably expressing EZH2 shRNA, which was consistent with the behaviour of 53BP1 and further suggested that NHEJ repair was inhibited in these cells.

Hypo-methylation on H3K27 results in decreased efficiency of NHEJ

To further determine the impact of hypo-H3K27me3 on NHEJ efficiency, we used a reporter cell line with a previously described GFP-based NHEJ reporter cassette (Mao et al., 2008, 2011). The reporter contains the GFP gene with a rat Pem1 intron (GFP-Pem1) that is interrupted by an adenoviral exon flanked by two non-palindromic I-Sce1 recognition sites in an opposite orientation; the gene is only activated when I-Sce1-induced DSBs are successfully repaired by NHEJ (Fig. 2A). The DNA-PKcs inhibitor NU7441 was used as a control to confirm the efficiency of the NHEJ reporter system (Fig. 2B). NHEJ efficiency was reduced by 30-40% when H3K27me3 levels were downregulated by either EZH2 siRNA (Fig. 2C) or an EZH2 inhibitor (GSK343) (Fig. 2D). We also tested the impact of other core subunits of the PRC2 complex in the modulation of NHEJ. Depletion of SUZ12 resulted in a similar inhibition of NHEJ to EZH2 siRNA or inhibitor (Fig. S1C). By contrast, siRNA against EED increased NHEJ efficiency over 2-fold (Fig. S1D). Since EED could also act independently of the PRC2 complex, for example, by interacting with histone deacetylases (HDACs) resulting in H3K27me3-independent repression (Ai et al., 2017), the observed change in NHEJ efficiency by EED knockdown may act via a different mechanism to knockdown or inhibit EZH2 or SUZ12.

Fig. 2.

Loss of H3K27me3 inhibits the efficiency of the NHEJ repair pathway. (A) Reporter used for detecting the repair efficiencies of NHEJ. (B) The DNA-PKcs inhibitor (NU7441) was used as a positive control to confirm the efficiency of the NHEJ reporter system. **P<0.01 (two-tailed unpaired t-test; n=3). (C,D) Loss of H3K27me3 suppresses NHEJ. The NHEJ reporter cell line was used to detect NHEJ repair after (C) siRNA-mediated knock-down of EZH2, or (D) treatment with an EZH2 inhibitor (GSK343, 1 mM for 7 days, the solvent DMF was used for the control group). *P<0.05; **P<0.01; ***P<0.001 (two-tailed unpaired t-test; n=3). (E,F) ChIP q-PCR analysis of the relative enrichment of (E) 53BP1 and (F) H3K27me3 at DSB sites cut by I-Sce1 in NHEJ reporter cells with (red) or without (blue) EZH2 inhibitor (GSK343) treatment. NHEJ reporter cells were treated with DMF or GSK343 for 7 days before I-Sce1 transfection. At each time point post transfection, cells were harvested and lysed for ChIP assays with the indicated antibodies, and the immunoprecipitated DNA products were quantified by q-PCR with input DNA as a normalization control. All data are from three independent experiments and are presented as the mean±s.e.m. *P<0.05; **P<0.01; ***P<0.001 (two-tailed unpaired t-test; n=3).

Fig. 2.

Loss of H3K27me3 inhibits the efficiency of the NHEJ repair pathway. (A) Reporter used for detecting the repair efficiencies of NHEJ. (B) The DNA-PKcs inhibitor (NU7441) was used as a positive control to confirm the efficiency of the NHEJ reporter system. **P<0.01 (two-tailed unpaired t-test; n=3). (C,D) Loss of H3K27me3 suppresses NHEJ. The NHEJ reporter cell line was used to detect NHEJ repair after (C) siRNA-mediated knock-down of EZH2, or (D) treatment with an EZH2 inhibitor (GSK343, 1 mM for 7 days, the solvent DMF was used for the control group). *P<0.05; **P<0.01; ***P<0.001 (two-tailed unpaired t-test; n=3). (E,F) ChIP q-PCR analysis of the relative enrichment of (E) 53BP1 and (F) H3K27me3 at DSB sites cut by I-Sce1 in NHEJ reporter cells with (red) or without (blue) EZH2 inhibitor (GSK343) treatment. NHEJ reporter cells were treated with DMF or GSK343 for 7 days before I-Sce1 transfection. At each time point post transfection, cells were harvested and lysed for ChIP assays with the indicated antibodies, and the immunoprecipitated DNA products were quantified by q-PCR with input DNA as a normalization control. All data are from three independent experiments and are presented as the mean±s.e.m. *P<0.05; **P<0.01; ***P<0.001 (two-tailed unpaired t-test; n=3).

To test whether the reduced NHEJ efficiency by EZH2 siRNA or inhibitor was due to loss of 53BP1 binding at DSB sites under hypo-H3K27me3 conditions, we performed a chromatin immunoprecipitation (ChIP) assay using NHEJ reporter cells. Primers were designed adjacent to the I-Sce1 recognition sites to enable the detection of chromatin-associated proteins in the vicinity of DSBs (ChIP-on-break) (Fig. S1E). Consistent with our previous immunostaining assay, the ChIP result showed that 53BP1 binding was decreased over 90% upon DSB induction by I-Sce1 (2 h) in hypo-H3K27me3 cells treated with EZH2 inhibitor (GSK343) (Fig. 2E,F), confirming that the reduction of NHEJ efficiency was due to dissociation of 53BP1.

We wondered whether the H3.1K27M- or hypo-H3K27me3-induced reduction in NHEJ was also accompanied by increased efficiency of HR, the other major DSB repair pathway (Chapman et al., 2012). The RAD51 foci formation was therefore investigated. However, we failed to detect an significant increase in the number of RAD51 foci per nucleus in H3.1K27M cells at 5 min, 30 min or 60 min post DNA damage induction (bleomycin 5 μg/ml, 4 h) (Fig. S1F). The similar results were also observed in cells with depletion of EZH2 (Fig. S1G). To further confirm our observation, we chose to use the previously described homologous recombination (HR) reporter system (Mao et al., 2008, Mao et al., 2011) (Fig. S1H) to examine whether HR efficiency was altered by the downregulation of H3K27me3 levels. Briefly, the HR reporter cassette contains two copies of mutated GFP-Pem1. The GFP exon in the first copy is inactivated by a 22-nt deletion and the insertion of two inverted I-Sce1 recognition sites, while the second copy is inactivated by the lack of a promoter, an ATG and the second exon of GFP (Fig. S1H). The deletion guarantees that GFP cannot be reconstituted by NHEJ. When I-Sce1-induced DSBs are repaired by HR, functional GFP will be reconstituted by gene conversion between the first GFP-Pem1 exons in the two mutated copies. The efficiency of the HR reporter system was confirmed by siRNA-mediated knockdown of BRCA2, a key component in HR repair (Powell et al., 2002) (Fig. S1I). The results showed that HR efficiency was moderately upregulated under hypo-H3K27me3 conditions after either EZH2 knockdown (Fig. S1J) or inhibition (Fig. S1K). Meanwhile, we also detected changes in H3K36me2/3 in these cells and found no obvious alterations (Fig. S1J,K, Fig. 2C,D). H3K36me3 has been reported to be involved in HR repair (Aymard et al., 2014) whereas H3K36me2 was shown to improve the association of early NHEJ repair components upon DSB induction (Fnu et al., 2011). Our results suggest that H3K36me2/3 is unlikely to be involved in the observed alteration of NHEJ or HR repair efficiency. Taken together, our results suggest that hypo-H3K27me3 induced either by H3.1K27M or loss of function of EZH2 leads to reduced DSB repair capacity through NHEJ rather than HR.

Inefficient DSB repair in H3.1K27M cells promotes p53-dependent apoptosis and genome instability

Since decreased H3K27me3 significantly inhibited NHEJ efficiency without an obvious increase in HR repair, we speculated that the induced DSBs might not be repaired efficiently, leading to cell death. We then evaluated the impact of H3.1K27M on apoptosis. In agreement with previous studies on H3.3K27M (Funato et al., 2014), the H3.1K27M mutation in HDFs increased the percentage of early apoptotic cells (Fig. 3A and Fig. S2A, P<0.05). Moreover, after exposure to the DSB-inducing chemotherapeutic drug bleomycin, there was a nearly 3-fold increase in early apoptotic cells in H3.1K27M compared with H3.1WT (Fig. 3A and Fig. S2A, P<0.01). The increased apoptosis seems to be due to the presence of tumour suppressor p53 (TP53), as upregulation of p53 protein was detected in H3.1K27M cells and was further increased after bleomycin treatment (Fig. 3B). When H3.1K27M cells were treated with p53 inhibitor (pifithrin-α), the percentage of early apoptotic cells was significantly decreased (Fig. 3C) and the number of proliferating cells was elevated nearly 2-fold at day 6 (Fig. 3D). The average number of γH2AX, RAD51 and pDNA-PKcs foci per nucleus showed a minor shift in these cells compared with levels in H3.1WT without bleomycin treatment, indicating that spontaneous replication stress may occur in H3.1K27M or hypo-H3K27me3 cells (Fig. S2B), leading to slower proliferation of H3.1K27M cells compared with H3.1WT cells (Fig. S2C).

Fig. 3.

Inefficient DSB repair in H3.1K27M cells promotes apoptosis and genome instability. (A) HDF cells stably expressing H3.1WT (blue) or H3.1K27M (red) were cultured for 24 h in medium with or without bleomycin (Bleo; 10 μg/ml). Cells were collected, stained with Annexin-V–APC and propidium iodide, and analysed by standard two-channel FACS. Typical original FACS data are shown in Fig. S2A. *P<0.05; **P<0.01 (two-tailed unpaired t-test; n=3). (B) HDF cell lines stably expressing H3.1WT or H3.1K27M were treated with or without 5 μg/ml bleomycin for 4 h and recovered for 30 min before collection. Whole-cell lysates were subjected to western blotting with the indicated antibodies. (C) HDF stable cells of H3.1WT (blue) or H3.1K27M (red) were cultured for 48 h in medium with DMSO or p53 inhibitor (Pifithrin-α) followed by treatment with or without bleomycin (10 μg/ml) for 24 h. Cells were collected and stained with Annexin-V–APC and propidium iodide, then analysed by two-channel FACS. (D) H3.1K27M HDF cells were cultured for 48 h in medium with DMSO or p53 inhibitor (Pifithrin-α) and growth curves were examined. (E) Ideogram of the novel DNA copy number variations (CNVs) in H3.1WT and H3.1K27M cell lines as detected by exome sequencing. The Arabic numbers in the coloured and fragmented circles represent the number of chromosomes; the inner circle represents the H3.1WT control, and the circle between the inner circle and the outer bold fragmented circle represents H3.1K27M. Copy gains (blue) and deletions (red) are indicated with the lengths of bars representing the relative fold variations. (F) CNV counts detected in H3.1WT and H3.1K27M HDF cells in E. Each copy gain (red) or deletion (blue) was classified using as.Factor. Details of bioinformatics analysis procedures are provided in the Materials and Methods. All data are from three independent experiments and are presented as the mean±s.e.m. *P<0.05; **P<0.01; ***P<0.001 (two-tailed unpaired t-test; n=3).

Fig. 3.

Inefficient DSB repair in H3.1K27M cells promotes apoptosis and genome instability. (A) HDF cells stably expressing H3.1WT (blue) or H3.1K27M (red) were cultured for 24 h in medium with or without bleomycin (Bleo; 10 μg/ml). Cells were collected, stained with Annexin-V–APC and propidium iodide, and analysed by standard two-channel FACS. Typical original FACS data are shown in Fig. S2A. *P<0.05; **P<0.01 (two-tailed unpaired t-test; n=3). (B) HDF cell lines stably expressing H3.1WT or H3.1K27M were treated with or without 5 μg/ml bleomycin for 4 h and recovered for 30 min before collection. Whole-cell lysates were subjected to western blotting with the indicated antibodies. (C) HDF stable cells of H3.1WT (blue) or H3.1K27M (red) were cultured for 48 h in medium with DMSO or p53 inhibitor (Pifithrin-α) followed by treatment with or without bleomycin (10 μg/ml) for 24 h. Cells were collected and stained with Annexin-V–APC and propidium iodide, then analysed by two-channel FACS. (D) H3.1K27M HDF cells were cultured for 48 h in medium with DMSO or p53 inhibitor (Pifithrin-α) and growth curves were examined. (E) Ideogram of the novel DNA copy number variations (CNVs) in H3.1WT and H3.1K27M cell lines as detected by exome sequencing. The Arabic numbers in the coloured and fragmented circles represent the number of chromosomes; the inner circle represents the H3.1WT control, and the circle between the inner circle and the outer bold fragmented circle represents H3.1K27M. Copy gains (blue) and deletions (red) are indicated with the lengths of bars representing the relative fold variations. (F) CNV counts detected in H3.1WT and H3.1K27M HDF cells in E. Each copy gain (red) or deletion (blue) was classified using as.Factor. Details of bioinformatics analysis procedures are provided in the Materials and Methods. All data are from three independent experiments and are presented as the mean±s.e.m. *P<0.05; **P<0.01; ***P<0.001 (two-tailed unpaired t-test; n=3).

The p53-dependent apoptosis of H3.1K27M cells indicated that genome instability may be involved, since p53 plays a central role in maintaining a stable genome in the face of toxic insults (Eischen, 2016). To test this idea, we first examined whether there were any changes in the foci of the phosphorylated histone variantH2AX (γH2AX-S139), a marker for DSB signalling cascade, after bleomycin treatment (5 μg/ml, 4 h). We found that both H3.1WT and H3.1K27M cells showed active γH2AX foci formation after bleomycin treatment (5 μg/ml, 4 h), which were eliminated more slowly in H3.1K27M cells compared with H3.1WT cells (Fig. S2D), supporting slower repair kinetics of drug-induced DSBs in H3.1K27M cells.

In order to evaluate the outcome of the unusual DSB response in H3.1K27M cells, we further tested its effects on genome stability. We performed exon sequencing of H3.1WT and H3.1K27M cells and found 24% more insertions and deletions (InDels) in H3.1K27M cells than in H3.1WT cells (36 versus 29, respectively). Moreover, there were also increased copy number variations (CNVs) as both gains and losses in H3.1K27M cells compared with H3.1WT cells (Fig. 3E,F). We reasoned that the increased rate of InDel mutations could be an indication that the genome of H3.1K27M cells was more fragile with loss of H3K27me2/3. Indeed, spontaneous replication stress was observed in these cells (Fig. S2B), which provides preferential sensitivity for the common fragile sites (CFSs) (Glover et al., 2017; Irony-Tur Sinai and Kerem, 2018). Collectively, these results indicate that the impaired DSB response in hypo-H3K27me2/3 cells eventually led to p53-dependent apoptosis and the accumulation of more genetic injuries.

The hypo-H3K27me2/3-induced inhibition of NHEJ does not function by regulating DNA-repair-related gene expression

Because H3K27me2/3 is known to be associated with transcriptional gene repression, we first performed RNA sequencing to determine whether the transcription of DNA-repair-related genes was altered in the presence of H3.1K27M. Consistent with the role of H3K27me2/3 in gene repression, there were 26.5% more upregulated genes than downregulated genes in H3.1K27M cells (Fig. S3A,B). There were similar changes of transcription profiles in cells stably expressing H3.1K27A, a mutation nontoxic to PRC2 and global H3K27me3 (Lewis et al., 2013), as well as in EZH2-knockdown cells (Fig. S3A,B). The gene ontology (GO) enrichment analysis for biological processes did not show a significant enrichment of DNA damage repair-related pathways in any of the three cell lines (Fig. S3C). A list of overlapping genes up- or downregulated more than 2-fold in H3.1K27M/A and EZH2 knockdown cells (Fig. S3D) is provided in Table S1, and none of these genes is known to be involved in DNA damage repair, in particular in the NHEJ pathway. We next performed western blot analysis with whole-cell extracts to compare the protein levels of key NHEJ repair genes in H3.1WT and H3.1K27M cells, and found no obvious alterations (Fig. 3B). RT-qPCR for the genes tested by western blotting was also analysed, and none of them showed changes over 2-fold (Fig. S3E). Collectively, these results suggest that hypo-H3K27me2/3-induced inhibition of NHEJ does not function by regulating DNA-repair-related gene expression.

The presence of H3.1K27M promotes the association of FANCD2 on chromatin

Since our results indicated that the hypo-H3K27me2/3-induced inhibition of NHEJ did not function by regulating gene expression at either transcriptional or translational levels, we speculated that H3.1K27M might affect DSB repair efficiency by modulating the association of key repair proteins on adjacent chromatins. To further explore the underlying mechanisms by which hypo-H3K27me3 inhibits NHEJ, we conducted mass spectrometry (MS) to identify proteins specifically bound to exogenous H3.1K27 mutants (Fig. S4A-F, Table S2). Interestingly, we found one protein of particular interest, FANCD2, which has been reported to participate in DSB repair and facilitate DNA replication (Federico et al., 2016; Kais et al., 2016; Lossaint et al., 2013; Moldovan and D'Andrea, 2009; Kim and D'Andrea, 2012; Kottemann and Smogorzewska, 2013; Madireddy et al., 2016; Sato et al., 2012). We verified its interaction with H3.1K27M through co-immunoprecipitation. As shown in Fig. 4A, exogenous H3.1K27M showed much stronger association than H3.1WT with FANCD2 in nuclear extracts. Since nuclear extracts contain only free proteins (including histones) dissociated from chromatin, we next tested the association of FANCD2 with chromatin-incorporated H3.1K27M using nuclear pellets from HDF stable cell lines. As we expected, the results were similar to those using nuclear extracts (Fig. 4B).

Fig. 4.

Loss of H3K27me3 promotes the association of FANCD2 on chromatin. (A,B) Affinity of the protein-protein interaction between HA-tagged H3.1WT, H3.1K27M or H3.1K27A with binding partners detected in (A) nuclear extracts (NEs) and (B) nuclear pellets (NPs). Anti-HA affinity gel was used to capture the histone complexes. The products were analysed by western blotting. (C) HDF (left) and HL7702 (right) cells stably expressing HA-tagged H3.1WT were treated with DMF or GSK343 (1 mM), respectively, for 7 days. Nuclear extracts (NEs) were subjected to co-immunoprecipitation with anti-HA gel, and the binding partners were detected by western blotting. (D) HL7702 cells stably expressing GFP-tagged H3.1WT were treated with DMF or GSK343 (1 mM) for 7 days, and NPs were extracted for GFP-Trap pull-down assays. The captured products were analysed by western blotting using the indicated antibodies. (E) Chromatin fractions were isolated and western blot analysis performed to detect the distribution of FANCD2 in the chromatin fraction (P3) and nucleoplasm (S2) of H3.1WT and H3.1K27M cells. (F) Immunofluorescence analysis of FANCD2 (red) at different time points after bleomycin treatment in the indicated HDF stable cell lines. The immunofluorescence signals only shows the FANCD2 proteins bound to the chromatins, as the dissociative FANCD2 in the nucleoplasm is eliminated in the permeation procedure with 0.2% Triton X-100. (G) Quantification of the fluorescence intensity of FANCD2 at different time points in cells from F. At least 50 cells were analysed for each time point. ***P<0.001 (two-tailed t-test; n=3). Data from three independent experiments are presented as the mean±s.e.m.

Fig. 4.

Loss of H3K27me3 promotes the association of FANCD2 on chromatin. (A,B) Affinity of the protein-protein interaction between HA-tagged H3.1WT, H3.1K27M or H3.1K27A with binding partners detected in (A) nuclear extracts (NEs) and (B) nuclear pellets (NPs). Anti-HA affinity gel was used to capture the histone complexes. The products were analysed by western blotting. (C) HDF (left) and HL7702 (right) cells stably expressing HA-tagged H3.1WT were treated with DMF or GSK343 (1 mM), respectively, for 7 days. Nuclear extracts (NEs) were subjected to co-immunoprecipitation with anti-HA gel, and the binding partners were detected by western blotting. (D) HL7702 cells stably expressing GFP-tagged H3.1WT were treated with DMF or GSK343 (1 mM) for 7 days, and NPs were extracted for GFP-Trap pull-down assays. The captured products were analysed by western blotting using the indicated antibodies. (E) Chromatin fractions were isolated and western blot analysis performed to detect the distribution of FANCD2 in the chromatin fraction (P3) and nucleoplasm (S2) of H3.1WT and H3.1K27M cells. (F) Immunofluorescence analysis of FANCD2 (red) at different time points after bleomycin treatment in the indicated HDF stable cell lines. The immunofluorescence signals only shows the FANCD2 proteins bound to the chromatins, as the dissociative FANCD2 in the nucleoplasm is eliminated in the permeation procedure with 0.2% Triton X-100. (G) Quantification of the fluorescence intensity of FANCD2 at different time points in cells from F. At least 50 cells were analysed for each time point. ***P<0.001 (two-tailed t-test; n=3). Data from three independent experiments are presented as the mean±s.e.m.

Since we observed signs of replication stress in H3.1K27M cells (Fig. S2B), the EdU fluorescence signal (APC. mean) of S-phase cells was then examined. There was ∼20% higher EdU signal in H3.1K27 mutant cells (Fig. S5A), which demonstrated replication stress in these cells. We next examined the recruitment of MCM3 and Chk1 (Ge and Blow, 2010; Ge et al., 2007) by H3.1K27M. MCM3 is a replication licensing factor (RLF) and was previously reported to interact with FANCD2 upon activation of ATR signalling independently of FANCD2 monoubiquitylation (Lossaint et al., 2013), which restrains incorrect DNA synthesis under replication stress (Lossaint et al., 2013). Chk1 is another downstream effector of ATR signalling which blocks progression through S phase and triggers the G2/M checkpoint, thus preventing cells with DNA damage from entering mitosis (Xiao et al., 2003). In concert with the replication stress, an increased binding of MCM3 and Chk1 to mutant H3.1 was indeed observed in our co-immunoprecipitation assay (Fig. 4A). Taken together, these results demonstrate that the presence of H3.1K27M promotes the association of FANCD2 as well as the recruitment of MCM3 and CHK1 on chromatin.

Enhanced association of FANCD2 with hypo-H3K27me2/3 chromatin couples with recruitment of Tip60 and a reduced local level of H4K20me2

It has been reported that the histone acetyltransferase Tip60 constitutively interacts with FANCD2 (Hejna et al., 2008). We wondered whether increased binding of FANCD2 on H3.1K27M promoted the association of Tip60 and change in H4K16ac, which has been suggested to prevent the binding of 53BP1 (Renaud et al., 2016). We therefore performed co-immunoprecipitation assays using nuclear pellets from HDF cells stably expressing H3.1WT or H3.1K27M. As shown in Fig. 4B, more Tip60 was recruited to chromatin-bound H3.1K27M than to chromatin-bound H3.1WT and the corresponding H4K16ac histone modification was upregulated accordingly.

The above results suggest a stronger affinity of H3.1K27M to FANCD2. However, it is unclear whether the enhanced association of these proteins is caused by the exogenous expression of H3.1K27M or the subsequent downregulation of H3K27me3. To resolve this, HDF or HL7702 H3.1WT cells were treated with an EZH2 inhibitor (GSK343) and then subjected to co-immunoprecipitation assays using nuclear extracts or pellets. As shown in Fig. 4C,D, GSK343 reduced H3K27me3 levels on exogenous H3.1WT and promoted the association of FANCD2, MCM3, Chk1 (also known as CHEK1) and Tip60 (KAT5). Moreover, the level of H4K16ac bound to hypo-H3K27me3 was significantly increased, whereas the local level of H4K20me2, a docking site of 53BP1, decreased as expected (Panier and Boulton, 2014) (Fig. 4D). Collectively, these results argue that loss of H3K27me3 is responsible for the enhanced association of FANCD2 with the chromatin and for the recruitment of Tip60. The resulting hypo-H4K20me2 levels and steric inhibition by upregulated H4K16ac levels both impede 53BP1 binding, thus inhibiting NHEJ in hypo-H3K27me3 cells.

We then wondered whether hypo-H3K27me2/3 chromatin altered the general distribution of FANCD2 in the nuclei. To do this, we fractionated the nuclei into chromatin and nucleoplasm (Mendez and Stillman, 2000; Yu et al., 2012) and analysed the distribution of FANCD2. The results showed that more FANCD2 was bound to the chromatin (P3) in H3.1K27M cells compared with H3.1WT cells (Fig. 4E), suggesting the chromatin association of FANCD2 was significantly altered. Furthermore, FANCD2 immunostaining showed that the fluorescence intensity of FANCD2 on fixed chromatin was significantly higher in H3.1K27M cells with or without bleomycin treatment (Fig. 4F,G). Taken together, these results suggested that H3.1K27M promoted the association strength of FANCD2 with the chromatin.

Since FANCD2 has been shown to act as a histone chaperone and maintain the mobility of histone H3 following treatment with an interstrand DNA crosslinker, mitomycin C (MMC) (Sato et al., 2012), we wondered whether the binding of FANCD2 to H3.1K27M could alter the mobility and exchange activity of histone H3. Surprisingly, the results of fluorescence recovery after photobleaching (FRAP) showed that the recovery kinetics of H3.1K27M-incorporated histones were obviously slower than control, with or without MMC treatment (Fig. S6A). The mobility of H3.1K27M-incorporated histones was inhibited without MMC treatment, indicating that it is unlikely to be a consequence of the increased binding of FANCD2 on these chromatins, and that the presence of FANCD2 on H3.1K27M chromatins is not sufficient to promote ICL repair since the mobility of H3.1K27M histones was almost the same before and after MMC treatment (Fig. S6A). To further examine the potential effects of hypo-H3K27me2/3 on ICL repair efficiency, we analysed the sensitivity of control and knockdown cells to MMC. The results showed that both H3.1K27M and shEZH2 cell lines were more sensitive to MMC compared with the control cell lines (HDF, H3.1WT and shNC) (Fig. S6B). Moreover, the monoubiquitylation of FANCD2 and FANCI, a central step in the activation of FA pathway (Smogorzewska et al., 2007; Sims et al., 2007; Garcia-Higuera et al., 2001), was also inhibited in H3.1K27M cells after MMC treatment (Fig. S6C). All these results suggest that ICL repair efficiency is inhibited in hypo-H3K27me2/3 HDF cell lines.

Depletion of FANCD2 rescues NHEJ repair efficiency

To provide further evidence of the role of FANCD2 in 53BP1 distribution in hypo-H3K27me3 cells, we attempted to rescue the formation of 53BP1 foci in H3.1K27M cells by knocking down FANCD2. As shown in Fig. 5A, H3.1K27M cells with siRNA-induced FANCD2 knockdown were more competent at 53BP1 foci formation compared with siNC-treated control cells at 5 min, 30 min and 60 min post bleomycin treatment, which was rescued to a level comparable to that in H3.1WT cells (Fig. 5A). To confirm the results, we analysed NHEJ repair efficiency using the reporter cell line (Fig. 2A), and the results showed that siRNA-mediated FANCD2 knockdown rescued the NHEJ efficiency in hypo-H3K27me2/3 cells (GSK343 treatment, 1 μM for 7 days) (Fig. 5B). We also examined the effect of FANCD2 knockdown on H3.1K27M cell apoptosis, and the apoptosis rate of H3.1K27M cells transfected with siFANCD2 was reduced after bleomycin treatment compared with levels in siNC cells (Fig. 5C; Fig. S5B) (P<0.05), suggesting a recovery of DSB repair efficiency. Interestingly, we performed co-immunoprecipitations and found that FANCD2 knockdown in H3.1K27M cells resulted in reduced association of Tip60 and MCM3; consequently, the K16ac modification decreased while K20me2 levels increased on the associated histone H4 (Fig. 5D). Altogether, these findings confirm that the association between H3.1K27M and FANCD2 is a key player in the inhibition of 53BP1 focus formation, as well as NHEJ efficiency.

Fig. 5.

Depletion of FANCD2 rescues NHEJ repair efficiency. (A) Immunostaining of 53BP1 (red) in the indicated cells at different time points after bleomycin treatment (5 μg/ml for 4 h) (left). The number of 53BP1 foci under each condition was counted, and data from more than 50 cells were used for the statistical analysis (top right). FANCD2 siRNA knockdown efficiency was determined by western blotting (bottom right). (B) Knockdown of FANCD2 partially rescued NHEJ efficiency in hypo-H3K27me2/3 cells. The NHEJ reporter cell line was treated with GSK343 [1 mM DMF for 7 days (blue) was used as a control] to decrease the H3K27me2/3 levels before siRNA-mediated knockdown of FANCD2 (green) [siNC (red) was used as a control]. *P<0.05; ***P<0.001 (two-tailed unpaired t-test; n=3). (C) Statistical analysis of the Annexin-V/propidium iodide assay results from H3.1K27M HDF cell lines transfected with siFANCD2 (green) or siNC (red) and treated with bleomycin (10 μg/ml for 24 h). Typical original FACS data are shown in Fig. S5B. H3.1WT cells (blue) were used as a control. *P<0.05 (two-tailed unpaired t-test; n=3). (D) Co-immunoprecipitation of exogenous H3.1WT and H3.1K27M in nuclear pellets (NPs) using anti-HA gel after siFANCD2 or siNC transfection. Affinity of the indicated proteins was detected by western blotting. *P<0.05; ***P<0.001 (two-tailed unpaired t-test; n=3). Data from three independent experiments are presented as the mean±s.e.m.

Fig. 5.

Depletion of FANCD2 rescues NHEJ repair efficiency. (A) Immunostaining of 53BP1 (red) in the indicated cells at different time points after bleomycin treatment (5 μg/ml for 4 h) (left). The number of 53BP1 foci under each condition was counted, and data from more than 50 cells were used for the statistical analysis (top right). FANCD2 siRNA knockdown efficiency was determined by western blotting (bottom right). (B) Knockdown of FANCD2 partially rescued NHEJ efficiency in hypo-H3K27me2/3 cells. The NHEJ reporter cell line was treated with GSK343 [1 mM DMF for 7 days (blue) was used as a control] to decrease the H3K27me2/3 levels before siRNA-mediated knockdown of FANCD2 (green) [siNC (red) was used as a control]. *P<0.05; ***P<0.001 (two-tailed unpaired t-test; n=3). (C) Statistical analysis of the Annexin-V/propidium iodide assay results from H3.1K27M HDF cell lines transfected with siFANCD2 (green) or siNC (red) and treated with bleomycin (10 μg/ml for 24 h). Typical original FACS data are shown in Fig. S5B. H3.1WT cells (blue) were used as a control. *P<0.05 (two-tailed unpaired t-test; n=3). (D) Co-immunoprecipitation of exogenous H3.1WT and H3.1K27M in nuclear pellets (NPs) using anti-HA gel after siFANCD2 or siNC transfection. Affinity of the indicated proteins was detected by western blotting. *P<0.05; ***P<0.001 (two-tailed unpaired t-test; n=3). Data from three independent experiments are presented as the mean±s.e.m.

DISCUSSION

Previous studies have reported that PRC2 is recruited to laser-induced DNA damage and contributes to DSB repair (Campbell et al., 2013; Chou et al., 2010; Kakarougkas et al., 2014). However, it remained controversial whether the corresponding histone modification, H3K27me2/3, participated in the process (Chou et al., 2010; Campbell et al., 2013). PRC2 has been found to be involved in DSB-induced transcription silencing as well as chromatin-state modulation in FA pathway activation (Kakarougkas et al., 2014; Vierra et al., 2017). However, it remains to be discovered whether PRC2 affects DSB repair by other means than acting as a transcriptional gene repressor. In this study, we constructed specific K-to-M point mutation of lysine 27 on DNA replication-dependent histone variant H3.1, which specifically reduced global H3K27me2/3 levels. Our results provide direct evidence that H3K27me2/3 is required for DSB repair and that loss of this histone modification results in ineffective NHEJ (Figs 1 and 2) as well as higher sensitivity to drug-induced DSBs (Fig. 3A).

We provide multiple lines of evidence that FANCD2 plays a central role in the hypo-H3K27me2/3-mediated inhibition of DSB repair (Figs 4-6). The FA pathway has been suggested to be critical in maintaining the timely, efficient and correct restoration of chromosomal integrity (Moldovan and D'Andrea, 2009), and FA components participate in the replication-dependent repair of multiple types of DNA lesions, via HR, nucleotide excision repair (NER) and translesion synthesis (TLS) (Moldovan and D'Andrea, 2009; Niedzwiedz et al., 2004; Sato et al., 2012).

Fig. 6.

Histone H3K27 tri-methylation promotes NHEJ by modulating FANCD2 on chromatin. When histones are modified with the normal level of H3K27me2/3, DSBs can be rapidly repaired through 53BP1-directed NHEJ pathway (top). However, at H3.1K27M or hypo-H3K27me2/3 modified nucleosomes, increased binding of FANCD2 recruits TIP60 and results in the local hyper-H4K16ac as well as hypo-H4K20me2 status, which impedes 53BP1 recruitment upon DSB damage. This leads to insufficient DSB repair in hypo-H3K27me2/3 cells (bottom).

Fig. 6.

Histone H3K27 tri-methylation promotes NHEJ by modulating FANCD2 on chromatin. When histones are modified with the normal level of H3K27me2/3, DSBs can be rapidly repaired through 53BP1-directed NHEJ pathway (top). However, at H3.1K27M or hypo-H3K27me2/3 modified nucleosomes, increased binding of FANCD2 recruits TIP60 and results in the local hyper-H4K16ac as well as hypo-H4K20me2 status, which impedes 53BP1 recruitment upon DSB damage. This leads to insufficient DSB repair in hypo-H3K27me2/3 cells (bottom).

FANCD2 was also found to interact transiently with MCM proteins and to stabilize stalled replication forks (Lossaint et al., 2013; Karanja et al., 2014). Our results show that the hypo-H3K27me2/3-mediated binding of FANCD2 is accompanied by the recruitment of the DNA replication factors MCM3 and Chk1 (Fig. 4A-D), suggesting that H3K27me2/3 may not only participate in DSB repair. A recent study showed that FANCD2 facilitates replication through common fragile sites (CFSs) (Madireddy et al., 2016), thus contributing to the maintenance of CFS stability. Our studies suggested that hypo-H3K27me2/3 alters the dynamics of FANCD2 binding and increases genome instability (Fig. 4A-D and Fig. 3E-G). The preferential binding of FANCD2 to hypo-H3K27me2/3 chromatin altered its distribution in the nuclei (Fig. 4E-G), which may deplete the pool of free FANCD2 in these cells, creating a phenotype similar to that seen upon loss of FANCD2. The overload of FANCD2 on chromatin may be correlated to the replication stress in hypo-H3K27me2/3 cells, which was accompanied by an involuntary response to p53 checkpoint and increased HR potential (Fig. S2D). HR has been found to be error-prone when rebuilding replisomes under replication stress (Carr and Lambert, 2013), which may also contribute to the genome instability observed in H3.1K27M cells (Fig. 3E-F). In addition, although the increased binding of Tip60 and the resulting heightened H4K16ac have been reported to alter DSB repair pathway choice by restricting the recruitment of 53BP1 and promoting the HR repair pathway (Tang et al., 2013), we found a non-significant increase of HR efficiency in hypo-H3K27me2/3 cells (Fig. S1E-K). We argue that the depletion of ‘free’ FANCD2 in hypo-H3K27me2/3 cells (Fig. 4E-G) might have restrained the HR repair pathway around collapsed replication forks. Rationally, the overall DSB repair capability was not enough to effectively repair DNA damage under hypo-H3K27me2/3 conditions, and the situation became visibly deteriorated once facing external DSB stimulations.

Our study also provides evidence for a novel role of hypo-H3K27me2/3 in tumorigenesis. It was demonstrated that EZH2 loss-of-function mutations or histone H3K27 mutations contribute to tumorigenesis by regulating transcription (Conway et al., 2015; Dawson and Kouzarides, 2012; Ezponda and Licht, 2014; Bender et al., 2013; Piunti et al., 2017; Mohammad et al., 2017), since H3K27me2/3 is a well-known repressor (Cao et al., 2002). Our findings provide a second perspective on the mechanism by which hypo-H3K27me2/3 or the presence of H3.1K27M mutant may contribute to cancer development: they impede effective DNA repair and alter genome homeostasis, as evidenced by genome instability in H3.1K27M cells and its association with a decline in overall DSB repair efficiency (Fig. 3E,F and Fig. S2A). The increased rate of InDel mutations suggest that the genome of H3.1K27M cells is possibly more fragile, with consistent loss of H3K27me2/3, supported by the presence of markers indicating spontaneous replication stress in these cells (Figs S2B and S5A). Replication stress was shown to result in preferential sensitivity for the CFSs (Glover et al., 2017; Irony-Tur Sinai and Kerem, 2018). Meanwhile, our results suggest that the histone H3.1K27M or H3.3K27M mutations are not sufficient to induce cancer (Funato et al., 2014) but rather place cells in a precancerous state characterized by replication stress and spontaneous DNA damage (Fig. S2D and Fig. S5A), where ineffective DSB repair promotes genome instability (Figs 1-3). We argue that cells harbouring more genome aberrations are more likely to die unless important tumour repressors are inactivated or oncogenes are activated (Funato et al., 2014; Castel et al., 2015; Bender et al., 2013); however, extensive adaption to hypo-H3K27me2/3- or H3.1K27M-induced replication stress could largely enhance accessibility to malignancy of the pre-cancerous cells and help them to avoid apoptosis. Indeed, when treated with the p53 inhibitor pifithrin-α, H3.1K27M cells showed decreased apoptosis and increased cell proliferation (Fig. 3C,D). Another line of evidence that supports this conclusion is that although H3.1K27M and H3.3K27M mutations were discovered in over 70% of DIPG patients, exogenous expression of H3.3K27M alone was insufficient to induce neoplastic transformation of neural progenitor cells (Funato et al., 2014). The combined transfection of PDGFRA and knockdown of p53 synergize with H3.3K27M to promote cell proliferation and survival (Funato et al., 2014). Although our HDF model expressing exogenous H3.1K27M may not fully represent the case of the endogenous H3.1K27M mutant regulation in DIPG, both studies at least support a consistent role of H3K27me2/3 in the control of cell survival and proliferation. Our further observation that a decrease in H3K27me2/3 showed enhanced sensitivity to bleomycin treatment (Fig. 3A) might suggest a therapeutic strategy to eliminate aberrant cells with precancerous lesions in such patients. Similar strategies could be applied to the treatment of cancers with aberrant hyper-H3K27me2/3. H3K27me2/3 levels could be reduced using EZH2 inhibitors (such as GSK343) before administration of chemotherapeutic drugs (such as bleomycin) or radiotherapy, which might strengthen the curative effect by promoting the sensitivity of tumour cells.

In summary, our study attempted to provide new insights into the underlying mechanism by which hypo-H3K27me2/3 affects tumorigenesis, thus enabling the development of novel anti-cancer treatments. The results confirm that the maintenance of normal cellular levels of H3K27me2/3 is critical as both overabundance and insufficiency of this histone modification are associated with malignancy.

MATERIALS AND METHODS

Cell culture and treatment

Human cell lines were cultured in DMEM (Gibco) medium supplemented with 10% fetal bovine serum (FBS, Gibco), 100 U/ml penicillin and 100 μg/ml streptomycin (Gibco) at 37°C in 5% CO2. Human primary dermal fibroblasts (HDFs) and the reporter cell lines for NHEJ and HR were kindly provided by Dr Zhiyong Mao (Tongji University, China) (Wang et al., 2015; Mao et al., 2011). HL7702 cell line (Wang et al., 2017) was purchased from the Chinese Academy of Sciences. The two reporter cell lines used for analysing NHEJ and HR, HCA2-I9a and HCA2-H15c, were grown in DMEM (Gibco) medium supplemented with 10% fetal bovine serum (FBS, Gibco), 1% non-essential amino acids (Gibco), and 100 μg/ml streptomycin (Gibco) in a Hera240i incubator with 5% CO2 and 3% O2 at 37°C. For EZH2 inhibition, HDF cells were cultured in growth medium with 1 mM GSK343 (Selleckchem) for 7 days. To induce DSBs, cells were treated with 8Gy X-ray or cultured in growth medium with 5 μg/ml bleomycin (Selleckchem) for 4 h.

Plasmid construction, transfection and virus production

The coding sequence of histone H3.1 was cloned from a human cDNA library and used in point mutagenesis to produce H3.1K27M/A mutants, which were then tagged with HA-coding sequence at the 3′-terminus and cloned into pEF-CSII-IRES-EGFP. These plasmids were used for lentivirus particle production. The H3.1 WT or H3.1K27M/A mutant sequences were cloned into pCAG-EGFP-N1 vector and fused with EGFP at C-termini. The resulting plasmids were used to transfect HL-7702 cells. Short hairpin interference RNA (shRNA) against EZH2 was synthesized and ligated into GV-248 (Genechem), which was driven by a U6 promoter and could be sorted by EGFP as a positive reporter.

shRNA sequence targeting EZH2 is as follows: 5′- GGACTAGGGAGTGTTCGGTG -3′. For siRNA-mediated knockdown, the following target sequences were used: siFANCD2, 5′-UACCUCAAGUGUAUCCAUG-3′; siEZH2-1, 5′- CCCAACAUAGAUGGACCAAAU -3′; siEZH2-2, 5′- GCUAGGUUAAUUGGGACCAAA -3′; siEED, 5′- AGCCAUGGAAAUGCUAUCAAUG -3′; siSUZ12, 5′- ACCTGTATGCTGTTTGTAGAAA -3′. All siRNAs and negative control (NC) siRNA were purchased from GenePharma (Shanghai, China).

The lentivirus vectors and helper vectors (pCMV-dR8.91 and VSV-G) were transfected into HEK293t cells. After 48 h, the cell culture supernatants were harvested, filtered and concentrated. Virus titres were measured and stored at −86°C as aliquots. To generate stable cell lines expressing exogenous HA-tagged H3.1WT or H3.1K27M/A mutants, the concentrated lentiviruses (∼107 IFU) were added to 100 µl HDF or HL7702 single-cell suspensions (105 cells) for 1.5 h at 37°C in 5% CO2. The suspensions were then diluted with 2 ml growth medium and cultured in 3.5 cm dishes for 24 h before replacing with fresh medium. After 5 to 7 days, the transduction-positive cells were sorted by flow cytometry using a GFP reporter (excitation/emission at 488/509 nm) as a selection marker. The percentage of positive cells could reach over 90% after two to three rounds of FACS sorting.

The GFP-tagged vectors with CAG promoters were transduced into HL7702 cells using Lipofectamine 2000 reagent (Invitrogen). 48 h after transfection, positive cells were selected using G418 (3.5 mg/ml, Invitrogen) for 10 to 14 days before sorting. The G418 concentration was reduced to 0.5 mg/ml as selection pressure.

To transfect siRNA into HDF stable cell lines, 5×105 cells were inoculated into 10 cm dishes 48 h prior to transfection with 5 μg siRNA using the electroporation kit (V4XP-2032) on a Lonza 4D-Nucleofector System (Cologne, Germany) (program DT-130). The transfected cells were cultured for 48 h before the second round of transfection and cultivated 48 h later for FACS, immunofluorescence staining or co-immunoprecipitation.

Western blotting

Cells were collected and disrupted in 1.0% NP-40 cell lysis buffer [50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1.0% NP-40, 0.2 mM EDTA, 20% glycerol, 0.1% SDS supplemented with protease and phosphatase inhibitors (Roche)]. After incubation for 30 min on ice, the lysates were combined with 5× loading buffer containing β-2-mercaptoethanol and denatured by boiling. The proteins were separated by SDS-PAGE (He et al., 2016). Primary antibodies against the following proteins were used at the indicated dilutions: HA, 1:1000 (Abcam, ab9110); γ-H2AX, 1:1000 (Abcam, ab20669); Ligase IV 1:1000 (Abclonal, A1743); Ku 70, 1:1000 (Abclonal, A7330); Ku 80, 1:1000 (Abclonal, A5862); XRCC4, 1:1000 (Abclonal, A7539); 53BP1, 1:500 (Novus, NB-100-305); DNA-PKcs, 1:1000 (Abcam, ab70250); RAD51, 1:1000 (Abcam, ab176458); RPA2, 1:1000 (Abclonal, A2389); BRCA1, 1:1000 (Cell Signaling Technology, 9010S); MRE11, 1:1000 (Abclonal, A2559); FANCD2, 1:500 (Bioworld, BS6604) and 1:100 (Santa Cruz Biotechnology, sc-20022); FANCI, 1:100 (Santa Cruz Biotechnology, sc-271316); EZH2, 1:1000 (Cell Signaling Technology, 5246S); GFP, 1:1000 (Abcam, ab290); MCM3, 1:1000 (Abcam, ab4460); CHK1, 1:1000 (Proteintech, 10362-1-AP); TIP60, 1:1000 (Abcam, ab23886); H3, 1:1000 (Abcam ab1791); H3K27me3, 1:1000 (Abcam ab6002); H3K27me2, 1:1000 (Abcam, ab24684); H3K27ac, 1:1000 (Abcam, ab4729); H4K20me2, 1:1000 (Abcam, ab9052); H4K16ac, 1:1000 (Millipore, 17-10101); H3K36me3, 1:1000 (Abcam, ab9050); H3K36me2, 1:1000 (Abcam ab9049). GAPDH at 1:2000 (Novus, NB300-221) and β-actin at 1:5000 (Santa Cruz Biotechnology, SC47778) were used for internal loading control of total proteins.

Immunofluorescence

Cells were plated and cultivated on glass coverslips, fixed in 4% formaldehyde for 15 min at room temperature and permeabilized in 0.2% Triton X-100 for 10 min. After blocking with 3% BSA in PBS, the cells were stained at 4°C overnight with antibodies against: 53BP1 (Novus, 1:400), pDNA-PKcs (phospho T2609) (Abcam, 1:400), γH2AX (Abcam, 1:400) or RAD51 (Abcam, 1:400). Primary antibodies were detected by incubation with anti-rabbit or anti-mouse Alexa Fluor 594 secondary antibodies (Invitrogen) for 30 min at room temperature. The cells were incubated with DAPI (1000×, Invitrogen) for 5 min at room temperature to visualize the nucleus. Slides were examined at 63× magnification using a fluorescence microscope (Leica) with a set parameter for each series of experiments (Pan et al., 2015). Image processing and analysis were performed using Image-Pro Plus software (Media Cybernetics). At least 50 cells were counted for each time point.

FRAP

FRAP was performed as described (Kimura et al., 2006; Sato et al., 2012) using a confocal microscope (Leica TCS SP5 II). Cells were treated with or without 50 ng/ml MMC for 16 h (Sato et al., 2012). Three to five confocal images of a field containing 1-3 nuclei were collected and one half of each nucleus was bleached using 100% transmission at 488 nm. Images were obtained using the setting at 5 min intervals. The relative fluorescence intensity of 6 nuclei were analysed for each group.

MMC sensitivity assay

A total of 5×104 cells were plated in each well of a 6-well plate in triplicate for each cell line. After 24 h, MMC (Selleckchem) was added at final concentrations of 0 nM, 25 nM, 50 nM, 100 nM, 200 nM and 500 nM. Drug-containing medium was replaced 2 h later. Cells were counted after 5 days and the cell numbers at each dose of drug were divided by the cell number in the untreated sample to calculate the percentage survival (Peng et al., 2014; Kim et al., 2013).

Analysis of NHEJ and HR efficiency

In vivo analysis of NHEJ and HR efficiency was performed as described previously (Mao et al., 2011). Briefly, the reporter cell lines were co-transfected with I-Sce1, DsRed and the target siRNA in triplicate for each group. After incubation for 72 h, cells were collected and resuspended in ice-cold PBS for analysis on a FACSVerse (BD BioSciences). At least 20,000 cells were counted, and the data were further analysed using FlowJo software (Ashland).

Apoptosis assay by flow cytometry

Cells were treated in triplicate for each group with or without 10 μg/ml bleomycin (Selleckchem) for 24 h before collection. After washing twice with ice-cold PBS, cells were resuspended in 500 μl 1×Binding Buffer (eBioscience) at a concentration of 1×106 cells/ml, and incubated with 5 μl APC-Annexin V (eBioscience) for 15 min followed by a 5 min incubation with 5 μl propidium iodide (eBioscience) at room temperature in the dark. Flow cytometry was performed within 1 h on a FACSverse (BD Bioscences). At least 10,000 cells were counted and the data was further analysed using FlowJo software (Ashland).

Exome sequencing

For genome DNA extraction, no less than 1×106 cells were collected and DNA was purified using TIANamp genome extract kit (Tiangen Inc, DP304). The resulted genome DNA was tested for integrity by agarose gel electrophoresis and quantified using Qubit (Thermo Fisher Scientific), sheared with a sonicator (Covaris LE220) to generate 150-200 bp fragments and targeted for DNA library construction by SureselectXT reagent kit (Agilent). The enriched DNA libraries were quantified by the Qubit 2.0 fluorometer dsDNA HS Assay (Thermo Fisher Scientific) and analysed for size distribution using a BioAnalyzer 2100 (Agilent). Finally, the libraries were sequenced using an Illumina HiSeq X-10 system following protocols for 2×150 paired-end sequencing using the Genome Center at WuXi App Tec. (Shanghai, China) Sequencing depth was set at 100×.

Sequence reads were mapped to the build hg19 using Burrows-Wheeler Aligner version 0.7.15 (Li and Durbin, 2009). After the duplicated reads were marked using Picard, sequence reads were realigned using GATK (McKenna et al., 2010). IndelRealigner and quality scores were recalibrated by GATK Table Recalibration. InDels were called by VarScan (Koboldt et al., 2012) version 2.4.0 with parameter, min-coverage 10 and only outputting the high-confidence InDels. The false positives of high-confidence InDels were filtered by bam-readcount and fpfilter.pl of the VarScan package. CNVs were called by EXCAVATOR2 (D'Aurizio et al., 2016) using default parameters and the ideogram were drawn by Circos (Krzywinski et al., 2009). Exon sequencing data have been deposited with the European Nucleotide Archive (ENA) under accession number PRJEB21013. Genome Analysis Toolkit (GATK) used for exon-seq data process is available at https://software.broadinstitute.org/gatk/.

RNA sequencing

Total RNA was extracted using RNAiso plus reagent (TAKARA, Cat#9109), dissolved in DEPC-treated water and evaluated by the ratio of 28S/18S (RIN>8, Agilent 2100) for RNA integrity. RNA concentrations were detected by Qubit (Thermo Fisher Scientific) and 2 μg RNA per sample was used as input materials. Sequencing libraries were generated using NEBNext®Ultra™ RNA Library Prep Kit for Illumina® (NEB, USA) following the manual instructions and assessed for quality on the Agilent Bioanalyzer 2100 system. Index codes were added to attribute sequences to each sample, and clustering of the coded samples was performed on a cBot Cluster Generation System using TruSeq SR Cluster Kit v3-cBot-HS (Illumina). After cluster generation, sequencing was performed on an Illumina Hi-seq X-10 platform or HiSeq 2000 instrument (Novogene, Beijing, China) to generate 150 bp pair-ended reads. Sequence reads were trimmed to exclude adaptors and low quality bases using Cutadapt software (version 1.10, parameter: –q 20 –m 50), aligned to mm10 by TopHat software (v.2.0.13) using the default parameter to reserve only the highest MAPQ and paired by samtools view –q 50 –f 0×2 for further analysis. Prediction of differentially expressed genes was performed by Cuffdiff2 (v.2.2.1) with the filtration of fold change ≥2.0 and q-value <0.05. GO term enrichment analysis is an open source collaborative initiative available from David: https://david.ncifcrf.gov. RNA sequencing data have been deposited with the NCBI Gene Expression Omnibus (GEO) under accession number GSE98768.

Chromatin immunoprecipitaion (ChIP) and q-PCR

No less than 1×107 cells were collected and incubated with 37% formaldehyde diluted to a 1% final concentration for 15 min at room temperature in order to crosslink the protein-DNA complex. Formaldehyde was quenched by adding 1 M glycine diluted to a final concentration of 125 mM and samples were rocked for 5 min at room temperature. Cell pellets were resuspended in cell lysis buffer [5 mM HEPES, pH 8.0, 85 mM KCl, 1% NP-40, protease inhibitors (EDTA-free, Roche)] and incubated on ice for 15 min. To enhance nuclei release, the cell suspension was homogenized using a glass Dounce homogenizer (type B) and centrifuged at 1500 rpm for 5 min at 4°C. The pellets were resuspended in nuclei lysis buffer [50 mM Tris-Cl pH 8.1, 10 mM EDTA, 1% SDS, protease inhibitors (EDTA-free, Roche)], sonicated for 30 min (30 s on/30 s off) using a Bioruptor Twin (UCD-400, Diagenode, Denville, NJ) to shear the DNAs to an average length of 200-500 bp, and centrifuged at 20,000 g for 10 min. The supernatants were collected and quantified by Qubit assay (Invitrogen). Suitable amount of chromatins was diluted with 4-fold dilution buffer (50 mM Tris-HCl, pH7.4, 150 mM NaCl, 1%NP-40, 0.25% deoxycholic acid, 1 mM EDTA pH8, protease inhibitors) and incubated on a rocker at 4°C overnight with 2 μg of one of the following antibodies: H3K27me3 (Abcam, ab6002), 53BP1 (Novus, NB-100-305). Protein A/G-agarose (20 μl, Santa Cruz Biotechnology sc-2003) was added and incubation continued for 2 h before extensively washing with wash buffer 1 (50 mM Tris-HCl, pH7.4, 150 mM NaCl, 1%NP-40, 0.25% Deoxycholic acid, 1 mM EDTA pH8), wash buffer 2 (100 mM Tris-Cl pH 9.0, 500 mM LiCl, 1% NP-40, 1% deoxycholic acid), wash buffer 3 (100 mM Tris-HCl, pH 9.0, 500 mM LiCl, 1% NP-40, 1% deoxycholic acid, 150 mM NaCl) and TE buffer. The immune-captured chromatins were eluted with elution buffer (50 mM NaHCO3, 1% SDS) and the resulting DNA reverse-crosslinked by incubating at 65°C overnight. Finally, the immunoprecipated DNA was treated with RNaseA and proteinase K and purified by ethanol precipitation with the assistance of nucleic acid carriers [in house with 5 μg/μl linear polyacrylamide (LPA)].

Quantitative PCR (q-PCR) was performed using a Bio-Rad IQ5 device. The primers used were: forward, 5′- CCTGAAGATTTGGGGGATTGTGCTTC -3′; reverse, 5′- CTTGGAAACACCCATGTTGAAATATC -3′.

Co-immunoprecipitation (co-IP)

Stable cell lines expressing exogenous histone mutants were processed in a required manner before they were cultivated. At least 1×107 cells were collected and resuspended in 5-fold packed-cell volumes of hypotonic buffer [10 mM HEPES, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.2 mM PMSF and proteinase inhibitors (EDTA-free, Roche)]. After incubation on ice for 10 min, the cell suspensions were transferred into a Dounce homogenizer (type A) and lysed with ∼10 strokes before centrifugation at 1000 g for 15 min. The pelleted nuclei were resuspended in low-salt buffer (20 mM HEPES, pH 7.9, 25% glycerol, 20 mM KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF and proteinase inhibitors) and mixed with 1/4 volume of high-salt buffer (20 mM HEPES, pH 7.9, 25% glycerol, 1.2 M KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF and proteinase inhibitors) on a rocker for 30 min at 4°C. Finally, centrifugation was performed at 25,000 g for 15 min at 4°C to separate nuclear extracts (NE, the supernatants) and nuclear pellets (NP, the pellets). The supernatants were further diluted with HEPES-glycerol buffer to level KCl to 150 mM, and the pellets were digested with benzonase buffer [50 mM Tris-HCl, pH 7.4, 0.5% NP-40, 10% glycerol, 150 mM NaCl and 2 mM MgCl2, protease and phosphatase inhibitors, 25 U/ml Benzonase (Sigma)] at 4°C overnight before the co-immunoprecipitation experiments.

Co-IPs were performed by adding GFP-Trap beads (Chromo Tek) or Anti-HA affinity gel (Biotool) to either of the two kinds of nuclear components (NEs or NPs) according to the tags in different cell lines and incubating for 2 h at 4°C. Unbound proteins were extensively cleaned by adding washing buffer (20 mM HEPES, pH 7.9, 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF and proteinase inhibitors). The resulted proteins were subjected to western blot analysis.

Chromatin isolation

Chromatin isolation assay was performed as previously described (Yu et al., 2012; Mendez and Stillman, 2000). Briefly, cells were resuspended in buffer A (10 mM HEPES, pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 0.1% Triton X-100, 1 mM DTT and proteinase inhibitors) for 5 min on ice and then centrifuged (5 min, 1300 g, 4°C) to collect the nuclei. The nuclei were washed once in buffer A and lysed in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT and proteinase inhibitors) for 30 min. After centrifugation (5 min, 1700 g, 4°C), the supernatants (S2) were collected and the pellets were washed once in buffer B and centrifuged again to collect the final chromatin fraction (P3). Both S2 and P3 were subjected to western blot analysis.

Acknowledgements

We thank Prof. Or Gozani (Stanford University, USA) and Prof. Jian-Quan Ni (Tsinghua University, China) for their kind and generous help with manuscript preparation.

Footnotes

Author contributions

Conceptualization: Ye Zhang, J.-F.C., F.-L.S.; Methodology: Ye Zhang, J.-F.C., L.C., Y.-Y.J., X.K., C.W., K.-N.L., F.-L.S.; Software: J.S., H.-Y.T., Y.S., S.-Y.Z., Yong Zhang, C.-Z.J.; Validation: Ye Zhang, J.-F.C.; Formal analysis: Ye Zhang; Investigation: Ye Zhang, L.C., Y.-Y.J.; Resources: J.-F.C., Z.-Y.M.; Data curation: Ye Zhang, J.-F.C., J.S.; Writing - original draft: Ye Zhang; Writing - review & editing: J.-F.C., Z.-M.H., J.-Y.W., H.-M.W., D.-L.W., R.-G.X., R.-B.Z., F.-L.S.; Visualization: Ye Zhang; Supervision: J.-F.C., X.-M.Y., F.-L.S.; Project administration: X.-M.Y., F.-L.S.; Funding acquisition: F.-L.S.

Funding

This work was supported by the National Natural Science Foundation of China (31330043); and the Ministry of Science and Technology of the People's Republic of China (2017YFA0103301, 2015CB856204, 2015CB964802, 2014CB964603).

Data Availability

RNA sequencing data have been deposited with the NCBI Gene Expression Omnibus (GEO) under accession number GSE98768. Exon sequencing data have been deposited with the NCBI Sequence Read Archive under accession number SRA603549.

References

Ai
,
S.
,
Peng
,
Y.
,
Li
,
C.
,
Gu
,
F.
,
Yu
,
X.
,
Yue
,
Y.
,
Ma
,
Q.
,
Chen
,
J.
,
Lin
,
Z.
,
Zhou
,
P.
, et al. 
(
2017
).
EED orchestration of heart maturation through interaction with HDACs is H3K27me3-independent
.
Elife
6
,
e24570
.
Albert
,
M.
and
Helin
,
K.
(
2010
).
Histone methyltransferases in cancer
.
Semin. Cell Dev. Biol.
21
,
209
-
220
.
Allis
,
C. D.
and
Jenuwein
,
T.
(
2016
).
The molecular hallmarks of epigenetic control
.
Nat. Rev. Genet.
17
,
487
-
500
.
An
,
H.
,
Yang
,
L.
,
Wang
,
C.
,
Gan
,
Z.
,
Gu
,
H.
,
Zhang
,
T.
,
Huang
,
X.
,
Liu
,
Y.
,
Li
,
Y.
,
Chang
,
S. J.
, et al. 
(
2017
).
Interactome analysis reveals a novel role for RAD6 in the regulation of proteasome activity and localization in response to DNA damage
.
Mol. Cell. Biol.
37
,
e00419
-
16
.
Aouida
,
M.
and
Ramotar
,
D.
(
2010
).
A new twist in cellular resistance to the anticancer drug bleomycin-A5
.
Curr. Drug Metab.
11
,
595
-
602
.
Aymard
,
F.
,
Bugler
,
B.
,
Schmidt
,
C. K.
,
Guillou
,
E.
,
Caron
,
P.
,
Briois
,
S.
,
Iacovoni
,
J. S.
,
Daburon
,
V.
,
Miller
,
K. M.
,
Jackson
,
S. P.
, et al. 
(
2014
).
Transcriptionally active chromatin recruits homologous recombination at DNA double-strand breaks
.
Nat. Struct. Mol. Biol.
21
,
366
-
374
.
Bender
,
S.
,
Tang
,
Y.
,
Lindroth
,
A. M.
,
Hovestadt
,
V.
,
Jones
,
D. T. W.
,
Kool
,
M.
,
Zapatka
,
M.
,
Northcott
,
P. A.
,
Sturm
,
D.
,
Wang
,
W.
, et al. 
(
2013
).
Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas
.
Cancer Cell
24
,
660
-
672
.
Campbell
,
S.
,
Ismail
,
I. H.
,
Young
,
L. C.
,
Poirier
,
G. G.
and
Hendzel
,
M. J.
(
2013
).
Polycomb repressive complex 2 contributes to DNA double-strand break repair
.
Cell Cycle
12
,
2675
-
2683
.
Cao
,
R.
,
Wang
,
L. J.
,
Wang
,
H. B.
,
Xia
,
L.
,
Erdjument-Bromage
,
H.
,
Tempst
,
P.
,
Jones
,
R. S.
and
Zhang
,
Y.
(
2002
).
Role of histone H3 lysine 27 methylation in polycomb-group silencing
.
Science
298
,
1039
-
1043
.
Carr
,
A. M.
and
Lambert
,
S.
(
2013
).
Replication stress-induced genome instability: the dark side of replication maintenance by homologous recombination
.
J. Mol. Biol.
425
,
4733
-
4744
.
Castel
,
D.
,
Philippe
,
C.
,
Calmon
,
R.
,
Le Dret
,
L.
,
Truffaux
,
N.
,
Boddaert
,
N.
,
Pagès
,
M.
,
Taylor
,
K. R.
,
Saulnier
,
P.
,
Lacroix
,
L.
, et al. 
(
2015
).
Histone H3F3A and HIST1H3B K27M mutations define two subgroups of diffuse intrinsic pontine gliomas with different prognosis and phenotypes
.
Acta Neuropathol.
130
,
815
-
827
.
Chan
,
K.-M.
,
Fang
,
D.
,
Gan
,
H. Y.
,
Hashizume
,
R.
,
Yu
,
C. H.
,
Schroeder
,
M.
,
Gupta
,
N.
,
Mueller
,
S.
,
James
,
C. D.
,
Jenkins
,
R.
, et al. 
(
2013
).
The histone H3.3K27M mutation in pediatric glioma reprograms H3K27 methylation and gene expression
.
Genes Dev.
27
,
985
-
990
.
Chapman
,
J. R.
,
Taylor
,
M. R. G.
and
Boulton
,
S. J.
(
2012
).
Playing the end game: DNA double-strand break repair pathway choice
.
Mol. Cell
47
,
497
-
510
.
Chen
,
S.
,
Wang
,
C.
,
Sun
,
L.
,
Wang
,
D.-L.
,
Chen
,
L.
,
Huang
,
Z.
,
Yang
,
Q.
,
Gao
,
J.
,
Yang
,
X.-B.
,
Chang
,
J.-F.
, et al. 
(
2015
).
RAD6 promotes homologous recombination repair by activating the autophagy-mediated degradation of heterochromatin protein HP1
.
Mol. Cell. Biol.
35
,
406
-
416
.
Chiolo
,
I.
,
Minoda
,
A.
,
Colmenares
,
S. U.
,
Polyzos
,
A.
,
Costes
,
S. V.
and
Karpen
,
G. H.
(
2011
).
Double-strand breaks in heterochromatin move outside of a dynamic HP1a domain to complete recombinational repair
.
Cell
144
,
732
-
744
.
Chou
,
D. M.
,
Adamson
,
B.
,
Dephoure
,
N. E.
,
Tan
,
X.
,
Nottke
,
A. C.
,
Hurov
,
K. E.
,
Gygi
,
S. P.
,
Colaiacovo
,
M. P.
and
Elledge
,
S. J.
(
2010
).
A chromatin localization screen reveals poly (ADP ribose)-regulated recruitment of the repressive polycomb and NuRD complexes to sites of DNA damage
.
Proc. Natl. Acad. Sci. USA
107
,
18475
-
18480
.
Conway
,
E.
,
Healy
,
E.
and
Bracken
,
A. P.
(
2015
).
PRC2 mediated H3K27 methylations in cellular identity and cancer
.
Curr. Opin. Cell Biol.
37
,
42
-
48
.
D'Aurizio
,
R.
,
Pippucci
,
T.
,
Tattini
,
L.
,
Giusti
,
B.
,
Pellegrini
,
M.
and
Magi
,
A.
(
2016
).
Enhanced copy number variants detection from whole-exome sequencing data using EXCAVATOR2
.
Nucleic Acids Res.
44
,
e154
.
Dawson
,
M. A.
and
Kouzarides
,
T.
(
2012
).
Cancer epigenetics: from mechanism to therapy
.
Cell
150
,
12
-
27
.
Eischen
,
C. M.
(
2016
).
Genome stability requires p53
.
Cold Spring Harb. Perspect Med.
6
,
a026096
.
Ernst
,
T.
,
Chase
,
A. J.
,
Score
,
J.
,
Hidalgo-Curtis
,
C. E.
,
Bryant
,
C.
,
Jones
,
A. V.
,
Waghorn
,
K.
,
Zoi
,
K.
,
Ross
,
F. M.
,
Reiter
,
A.
, et al. 
(
2010
).
Inactivating mutations of the histone methyltransferase gene EZH2 in myeloid disorders
.
Nat. Genet.
42
,
722
-
726
.
Ezponda
,
T.
and
Licht
,
J. D.
(
2014
).
Molecular pathways: deregulation of histone h3 lysine 27 methylation in cancer-different paths, same destination
.
Clin. Cancer Res.
20
,
5001
-
5008
.
Federico
,
M. B.
,
Vallerga
,
M. B.
,
Radl
,
A.
,
Paviolo
,
N. S.
,
Bocco
,
J. L.
,
Di Giorgio
,
M.
,
Soria
,
G.
and
Gottifredi
,
V.
(
2016
).
Chromosomal integrity after UV irradiation requires FANCD2-mediated repair of double strand breaks
.
PLoS Genet.
12
,
e1005792
.
Fnu
,
S.
,
Williamson
,
E. A.
,
De Haro
,
L. P.
,
Brenneman
,
M.
,
Wray
,
J.
,
Shaheen
,
M.
,
Radhakrishnan
,
K.
,
Lee
,
S.-H.
,
Nickoloff
,
J. A.
and
Hromas
,
R.
(
2011
).
Methylation of histone H3 lysine 36 enhances DNA repair by nonhomologous end-joining
.
Proc. Natl. Acad. Sci. USA
108
,
540
-
545
.
Funato
,
K.
,
Major
,
T.
,
Lewis
,
P. W.
,
Allis
,
C. D.
and
Tabar
,
V.
(
2014
).
Use of human embryonic stem cells to model pediatric gliomas with H3.3K27M histone mutation
.
Science
346
,
1529
-
1533
.
Garcia-Higuera
,
I.
,
Taniguchi
,
T.
,
Ganesan
,
S.
,
Meyn
,
M. S.
,
Timmers
,
C.
,
Hejna
,
J.
,
Grompe
,
M.
and
D'andrea
,
A. D.
(
2001
).
Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway
.
Mol. Cell
7
,
249
-
262
.
Ge
,
X. Q.
and
Blow
,
J. J.
(
2010
).
Chk1 inhibits replication factory activation but allows dormant origin firing in existing factories
.
J. Cell Biol.
191
,
1285
-
1297
.
Ge
,
X. Q.
,
Jackson
,
D. A.
and
Blow
,
J. J.
(
2007
).
Dormant origins licensed by excess Mcm2-7 are required for human cells to survive replicative stress
.
Genes Dev.
21
,
3331
-
3341
.
Glover
,
T. W.
,
Wilson
,
T. E.
and
Arlt
,
M. F.
(
2017
).
Fragile sites in cancer: more than meets the eye
.
Nat. Rev. Cancer
17
,
489
-
501
.
Goodarzi
,
A. A.
,
Noon
,
A. T.
,
Deckbar
,
D.
,
Ziv
,
Y.
,
Shiloh
,
Y.
,
Löbrich
,
M.
and
Jeggo
,
P. A.
(
2008
).
ATM signaling facilitates repair of DNA double-strand breaks associated with heterochromatin
.
Mol. Cell
31
,
167
-
177
.
Halazonetis
,
T. D.
,
Gorgoulis
,
V. G.
and
Bartek
,
J.
(
2008
).
An oncogene-induced DNA damage model for cancer development
.
Science
319
,
1352
-
1355
.
Hanahan
,
D.
and
Weinberg
,
R. A.
(
2011
).
Hallmarks of cancer: the next generation
.
Cell
144
,
646
-
674
.
He
,
Z.
,
Wu
,
J.
,
Su
,
X.
,
Zhang
,
Y.
,
Pan
,
L.
,
Wei
,
H.
,
Fang
,
Q.
,
Li
,
H.
,
Wang
,
D. L.
and
Sun
,
F. L.
(
2016
).
JMJD5 (Jumonji Domain-containing 5) associates with spindle microtubules and is required for proper mitosis
.
J. Biol. Chem.
291
,
4684
-
4697
.
Hejna
,
J.
,
Holtorf
,
M.
,
Hines
,
J.
,
Mathewson
,
L.
,
Hemphill
,
A.
,
Al-Dhalimy
,
M.
,
Olson
,
S. B.
and
Moses
,
R. E.
(
2008
).
Tip60 is required for DNA interstrand cross-link repair in the Fanconi anemia pathway
.
J. Biol. Chem.
283
,
9844
-
9851
.
Irony-Tur Sinai
,
M.
and
Kerem
,
B.
(
2018
).
DNA replication stress drives fragile site instability
.
Mutat. Res.
808
,
56
-
61
.
Johnson
,
D. P.
,
Spitz
,
G. S.
,
Tharkar
,
S.
,
Quayle
,
S. N.
,
Shearstone
,
J. R.
,
Jones
,
S.
,
Mcdowell
,
M. E.
,
Wellman
,
H.
,
Tyler
,
J. K.
,
Cairns
,
B. R.
, et al. 
(
2015
).
HDAC1,2 inhibition impairs EZH2-and BBAP- mediated DNA repair to overcome chemoresistance in EZH2 gain-of-function mutant diffuse large B-cell lymphoma
.
Oncotarget
6
,
4863
-
4887
.
Jones
,
P. A.
and
Baylin
,
S. B.
(
2007
).
The epigenomics of cancer
.
Cell
128
,
683
-
692
.
Justin
,
N.
,
Zhang
,
Y.
,
Tarricone
,
C.
,
Martin
,
S. R.
,
Chen
,
S. Y.
,
Underwood
,
E.
,
De Marco
,
V.
,
Haire
,
L. F.
,
Walker
,
P. A.
,
Reinberg
,
D.
, et al. 
(
2016
).
Structural basis of oncogenic histone H3K27M inhibition of human polycomb repressive complex 2
.
Nat. Commun.
7
,
11
.
Kais
,
Z.
,
Rondinelli
,
B.
,
Holmes
,
A.
,
O'leary
,
C.
,
Kozono
,
D.
,
D'andrea
,
A. D.
and
Ceccaldi
,
R.
(
2016
).
FANCD2 maintains fork stability in BRCA1/2-deficient tumors and promotes alternative end-joining DNA repair
.
Cell Rep.
15
,
2488
-
2499
.
Kakarougkas
,
A.
,
Ismail
,
A.
,
Chambers
,
A. L.
,
Riballo
,
E.
,
Herbert
,
A. D.
,
Kunzel
,
J.
,
Lobrich
,
M.
,
Jeggo
,
P. A.
and
Downs
,
J. A.
(
2014
).
Requirement for PBAF in transcriptional repression and repair at DNA breaks in actively transcribed regions of chromatin
.
Mol. Cell
55
,
723
-
732
.
Karanja
,
K. K.
,
Lee
,
E. H.
,
Hendrickson
,
E. A.
and
Campbell
,
J. L.
(
2014
).
Preventing over-resection by DNA2 helicase/nuclease suppresses repair defects in Fanconi anemia cells
.
Cell Cycle
13
,
1540
-
1550
.
Kim
,
H.
and
D'andrea
,
A. D.
(
2012
).
Regulation of DNA cross-link repair by the Fanconi anemia/BRCA pathway
.
Genes Dev.
26
,
1393
-
1408
.
Kim
,
Y.
,
Spitz
,
G. S.
,
Veturi
,
U.
,
Lach
,
F. P.
,
Auerbach
,
A. D.
and
Smogorzewska
,
A.
(
2013
).
Regulation of multiple DNA repair pathways by the Fanconi anemia protein SLX4
.
Blood
121
,
54
-
63
.
Kim
,
J.-H.
,
Sharma
,
A.
,
Dhar
,
S. S.
,
Lee
,
S.-H.
,
Gu
,
B.
,
Chan
,
C.-H.
,
Lin
,
H.-K.
and
Lee
,
M. G.
(
2014
).
UTX and MLL4 coordinately regulate transcriptional programs for cell proliferation and invasiveness in breast cancer cells
.
Cancer Res.
74
,
1705
-
1717
.
Kimura
,
H.
,
Takizawa
,
N.
,
Allemand
,
E.
,
Hori
,
T.
,
Iborra
,
F. J.
,
Nozaki
,
N.
,
Muraki
,
M.
,
Hagiwara
,
M.
,
Krainer
,
A. R.
,
Fukagawa
,
T.
, et al. 
(
2006
).
A novel histone exchange factor, protein phosphatase 2Cgamma, mediates the exchange and dephosphorylation of H2A-H2B
.
J. Cell Biol.
175
,
389
-
400
.
Koboldt
,
D. C.
,
Zhang
,
Q.
,
Larson
,
D. E.
,
Shen
,
D.
,
Mclellan
,
M. D.
,
Lin
,
L.
,
Miller
,
C. A.
,
Mardis
,
E. R.
,
Ding
,
L.
and
Wilson
,
R. K.
(
2012
).
VarScan 2: somatic mutation and copy number alteration discovery in cancer by exome sequencing
.
Genome Res.
22
,
568
-
576
.
Kottemann
,
M. C.
and
Smogorzewska
,
A.
(
2013
).
Fanconi anaemia and the repair of Watson and Crick DNA crosslinks
.
Nature
493
,
356
-
363
.
Krzywinski
,
M.
,
Schein
,
J.
,
Birol
,
I.
,
Connors
,
J.
,
Gascoyne
,
R.
,
Horsman
,
D.
,
Jones
,
S. J.
and
Marra
,
M. A.
(
2009
).
Circos: an information aesthetic for comparative genomics
.
Genome Res.
19
,
1639
-
1645
.
Lewis
,
P. W.
,
Muller
,
M. M.
,
Koletsky
,
M. S.
,
Cordero
,
F.
,
Lin
,
S.
,
Banaszynski
,
L. A.
,
Garcia
,
B. A.
,
Muir
,
T. W.
,
Becher
,
O. J.
and
Allis
,
C. D.
(
2013
).
Inhibition of PRC2 activity by a gain-of-function H3 mutation found in pediatric glioblastoma
.
Science
340
,
857
-
861
.
Li
,
H.
and
Durbin
,
R.
(
2009
).
Fast and accurate short read alignment with Burrows-Wheeler transform
.
Bioinformatics
25
,
1754
-
1760
.
Li
,
Z.
,
Zhang
,
W.
,
Chen
,
Y.
,
Guo
,
W.
,
Zhang
,
J.
,
Tang
,
H.
,
Xu
,
Z.
,
Zhang
,
H.
,
Tao
,
Y.
,
Wang
,
F.
, et al. 
(
2016
).
Impaired DNA double-strand break repair contributes to the age-associated rise of genomic instability in humans
.
Cell Death Differ.
23
,
1765
-
1777
.
Lieber
,
M. R.
(
2008
).
The mechanism of human nonhomologous DNA end joining
.
J. Biol. Chem.
283
,
1
-
5
.
Liu
,
Y.
,
Wang
,
D.-L.
,
Chen
,
S.
,
Zhao
,
L.
and
Sun
,
F.-L.
(
2012
).
Oncogene Ras/phosphatidylinositol 3-kinase signaling targets histone H3 acetylation at lysine 56
.
J. Biol. Chem.
287
,
41469
-
41480
.
Lossaint
,
G.
,
Larroque
,
M.
,
Ribeyre
,
C.
,
Bec
,
N.
,
Larroque
,
C.
,
Décaillet
,
C.
,
Gari
,
K.
and
Constantinou
,
A.
(
2013
).
FANCD2 binds MCM proteins and controls replisome function upon activation of s phase checkpoint signaling
.
Mol. Cell
51
,
678
-
690
.
Madireddy
,
A.
,
Kosiyatrakul
,
S. T.
,
Boisvert
,
R. A.
,
Herrera-Moyano
,
E.
,
García-Rubio
,
M. L.
,
Gerhardt
,
J.
,
Vuono
,
E. A.
,
Owen
,
N.
,
Yan
,
Z.
,
Olson
,
S.
, et al. 
(
2016
).
FANCD2 facilitates replication through common fragile sites
.
Mol. Cell
64
,
388
-
404
.
Mao
,
Z.
,
Bozzella
,
M.
,
Seluanov
,
A.
and
Gorbunova
,
V.
(
2008
).
DNA repair by nonhomologous end joining and homologous recombination during cell cycle in human cells
.
Cell Cycle
7
,
2902
-
2906
.
Mao
,
Z.
,
Hine
,
C.
,
Tian
,
X.
,
Van Meter
,
M.
,
Au
,
M.
,
Vaidya
,
A.
,
Seluanov
,
A.
and
Gorbunova
,
V.
(
2011
).
SIRT6 promotes DNA repair under stress by activating PARP1
.
Science
332
,
1443
-
1446
.
Margueron
,
R.
and
Reinberg
,
D.
(
2011
).
The Polycomb complex PRC2 and its mark in life
.
Nature
469
,
343
-
349
.
Mckenna
,
A.
,
Hanna
,
M.
,
Banks
,
E.
,
Sivachenko
,
A.
,
Cibulskis
,
K.
,
Kernytsky
,
A.
,
Garimella
,
K.
,
Altshuler
,
D.
,
Gabriel
,
S.
,
Daly
,
M.
, et al. 
(
2010
).
The genome analysis toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data
.
Genome Res.
20
,
1297
-
1303
.
Mendez
,
J.
and
Stillman
,
B.
(
2000
).
Chromatin association of human origin recognition complex, Cdc6, and minichromosome maintenance proteins during the cell cycle: Assembly of prereplication complexes in late mitosis
.
Mol. Cell. Biol.
20
,
8602
-
8612
.
Mohammad
,
F.
,
Weissmann
,
S.
,
Leblanc
,
B.
,
Pandey
,
D. P.
,
Hojfeldt
,
J. W.
,
Comet
,
I.
,
Zheng
,
C.
,
Johansen
,
J. V.
,
Rapin
,
N.
,
Porse
,
B. T.
, et al. 
(
2017
).
EZH2 is a potential therapeutic target for H3K27M-mutant pediatric gliomas
.
Nat. Med.
23
,
483
-
492
.
Moldovan
,
G.-L.
and
D'andrea
,
A. D.
(
2009
).
How the Fanconi anemia pathway guards the genome
.
Annu. Rev. Genet.
43
,
223
-
249
.
Niedzwiedz
,
W.
,
Mosedale
,
G.
,
Johnson
,
M.
,
Ong
,
C. Y.
,
Pace
,
P.
and
Patel
,
K. J.
(
2004
).
The Fanconi anaemia gene FANCC promotes homologous recombination and error-prone DNA repair
.
Mol. Cell
15
,
607
-
620
.
O'Hagan
,
H. M.
,
Mohammad
,
H. P.
and
Baylin
,
S. B.
(
2008
).
Double strand breaks can initiate gene silencing and SIRT1-dependent onset of DNA methylation in an exogenous promoter CpG island
.
PLoS Genet.
4
,
e1000155
.
Pan
,
L.
,
Xie
,
W.
,
Li
,
K. L.
,
Yang
,
Z.
and
Xu
,
J.
(
2015
).
Heterochromatin remodeling by CDK12 contributes to learning in Drosophila
.
Proc. Natl. Acad. Sci. USA
112
,
13988
-
13993
.
Panier
,
S.
and
Boulton
,
S. J.
(
2014
).
Double-strand break repair: 53BP1 comes into focus
.
Nat. Rev. Mol. Cell Biol.
15
,
7
-
18
.
Peng
,
M.
,
Xie
,
J.
,
Ucher
,
A.
,
Stavnezer
,
J.
and
Cantor
,
S. B.
(
2014
).
Crosstalk between BRCA-Fanconi anemia and mismatch repair pathways prevents MSH2-dependent aberrant DNA damage responses
.
EMBO J.
33
,
1698
-
1712
.
Pirrotta
,
V.
(
1997
).
PcG complexes and chromatin silencing
.
Curr. Opin. Genet. Dev.
7
,
249
-
258
.
Pirrotta
,
V.
(
1998
).
Polycombing the genome: PcG, trxG, and chromatin silencing
.
Cell
93
,
333
-
336
.
Pirrotta
,
V.
(
2009
).
Polycomb repression under the skin
.
Cell
136
,
992
-
994
.
Piunti
,
A.
,
Hashizume
,
R.
,
Morgan
,
M. A.
,
Bartom
,
E. T.
,
Horbinski
,
C. M.
,
Marshall
,
S. A.
,
Rendleman
,
E. J.
,
Ma
,
Q.
,
Takahashi
,
Y.-H.
,
Woodfin
,
A. R.
, et al. 
(
2017
).
Therapeutic targeting of polycomb and BET bromodomain proteins in diffuse intrinsic pontine gliomas
.
Nat. Med.
23
,
493
-
500
.
Polo
,
S. E.
,
Roche
,
D.
and
Almouzni
,
G.
(
2006
).
New histone incorporation marks sites of UV repair in human cells
.
Cell
127
,
481
-
493
.
Powell
,
S. N.
,
Willers
,
H.
and
Xia
,
F.
(
2002
).
BRCA2 keeps Rad51 in line: high-fidelity homologous recombination prevents breast and ovarian cancer?
Mol. Cell
10
,
1262
-
1263
.
Price
,
B. D.
and
D'andrea
,
A. D.
(
2013
).
Chromatin remodeling at DNA double-strand breaks
.
Cell
152
,
1344
-
1354
.
Renaud
,
E.
,
Barascu
,
A.
and
Rosselli
,
F.
(
2016
).
Impaired TIP60-mediated H4K16 acetylation accounts for the aberrant chromatin accumulation of 53BP1 and RAP80 in Fanconi anemia pathway-deficient cells
.
Nucleic Acids Res.
44
,
648
-
656
.
Sato
,
K.
,
Ishiai
,
M.
,
Toda
,
K.
,
Furukoshi
,
S.
,
Osakabe
,
A.
,
Tachiwana
,
H.
,
Takizawa
,
Y.
,
Kagawa
,
W.
,
Kitao
,
H.
,
Dohmae
,
N.
, et al. 
(
2012
).
Histone chaperone activity of Fanconi anemia proteins, FANCD2 and FANCI, is required for DNA crosslink repair
.
EMBO J.
31
,
3524
-
3536
.
Schultz
,
L. B.
,
Chehab
,
N. H.
,
Malikzay
,
A.
,
Ditullio
,
R. A.
,
Stavridi
,
E. S.
and
Halazonetis
,
T. D.
(
2000
).
The DNA damage checkpoint and human cancer
.
Cold Spring Harbor Symp. Quant. Biol.
65
,
489
-
498
.
Schwartzentruber
,
J.
,
Korshunov
,
A.
,
Liu
,
X. Y.
,
Jones
,
D. T. W.
,
Pfaff
,
E.
,
Jacob
,
K.
,
Sturm
,
D.
,
Fontebasso
,
A. M.
,
Quang
,
D. A. K.
,
Tonjes
,
M.
, et al. 
(
2012
).
Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma
.
Nature
482
,
226
-
231
.
Seiler
,
D. M.
,
Rouquette
,
J.
,
Schmid
,
V. J.
,
Strickfaden
,
H.
,
Ottmann
,
C.
,
Drexler
,
G. A.
,
Mazurek
,
B.
,
Greubel
,
C.
,
Hable
,
V.
,
Dollinger
,
G.
, et al. 
(
2011
).
Double-strand break-induced transcriptional silencing is associated with loss of tri-methylation at H3K4
.
Chromosome Res.
19
,
883
-
899
.
Simon
,
J. A.
and
Kingston
,
R. E.
(
2009
).
Mechanisms of polycomb gene silencing: knowns and unknowns
.
Nat. Rev. Mol. Cell Biol.
10
,
697
-
708
.
Simon
,
J. A.
and
Kingston
,
R. E.
(
2013
).
Occupying chromatin: Polycomb mechanisms for getting to genomic targets, stopping transcriptional traffic, and staying put
.
Mol. Cell
49
,
808
-
824
.
Sims
,
A. E.
,
Spiteri
,
E.
,
Sims
,
R. J.
, III
,
Arita
,
A. G.
,
Lach
,
F. P.
,
Landers
,
T.
,
Wurm
,
M.
,
Freund
,
M.
,
Neveling
,
K.
,
Hanenberg
,
H.
, et al. 
(
2007
).
FANCI is a second monoubiquitinated member of the Fanconi anemia pathway
.
Nat. Struct. Mol. Biol.
14
,
564
-
567
.
Smogorzewska
,
A.
,
Matsuoka
,
S.
,
Vinciguerra
,
P.
,
Mcdonald
,
E. R.
, III
,
Hurov
,
K. E.
,
Luo
,
J.
,
Ballif
,
B. A.
,
Gygi
,
S. P.
,
Hofmann
,
K.
,
D'andrea
,
A. D.
, et al. 
(
2007
).
Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair
.
Cell
129
,
289
-
301
.
Tagami
,
H.
,
Ray-Gallet
,
D.
,
Almouzni
,
G.
and
Nakatani
,
Y.
(
2004
).
Histone H3.1 and H3.3 complexes mediate nucleosome assembly pathways dependent or independent of DNA synthesis
.
Cell
116
,
51
-
61
.
Tang
,
J.
,
Cho
,
N. W.
,
Cui
,
G.
,
Manion
,
E. M.
,
Shanbhag
,
N. M.
,
Botuyan
,
M. V.
,
Mer
,
G.
and
Greenberg
,
R. A.
(
2013
).
Acetylation limits 53BP1 association with damaged chromatin to promote homologous recombination
.
Nat. Struct. Mol. Biol.
20
,
317
-
325
.
Van Nuland
,
R.
and
Gozani
,
O.
(
2016
).
Histone H4 lysine 20 (H4K20) methylation, expanding the signaling potential of the proteome one methyl moiety at a time
.
Mol. Cell. Proteomics
15
,
755
-
764
.
Vierra
,
D. A.
,
Garzon
,
J. L.
,
Rego
,
M. A.
,
Adroved
,
M. M.
,
Mauro
,
M.
and
Howlett
,
N. G.
(
2017
).
Modulation of the Fanconi anemia pathway via chemically induced changes in chromatin structure
.
Oncotarget
8
,
76443
-
76457
.
Wang
,
C.
,
Chang
,
J. F.
,
Yan
,
H.
,
Wang
,
D. L.
,
Liu
,
Y.
,
Jing
,
Y.
,
Zhang
,
M.
,
Men
,
Y. L.
,
Lu
,
D.
,
Yang
,
X. M.
, et al. 
(
2015
).
A conserved RAD6-MDM2 ubiquitin ligase machinery targets histone chaperone ASF1A in tumorigenesis
.
Oncotarget
6
,
29599
-
29613
.
Wang
,
Y.
,
Han
,
X.
,
Li
,
Y. D.
,
Wang
,
Y.
,
Zhao
,
S. Y.
,
Zhang
,
D. J.
and
Lu
,
Y.
(
2017
).
Lentinan dose dependence between immunoprophylaxis and promotion of the murine liver cancer
.
Oncotarget
8
,
95152
-
95162
.
Wu
,
G.
,
Broniscer
,
A.
,
Mceachron
,
T. A.
,
Lu
,
C.
,
Paugh
,
B. S.
,
Becksfort
,
J.
,
Qu
,
C. X.
,
Ding
,
L.
,
Huether
,
R.
,
Parker
,
M.
, et al. 
and
St Jude Children's Research Hospital
(
2012
).
Somatic histone H3 alterations in pediatric diffuse intrinsic pontine gliomas and non-brainstem glioblastomas
.
Nat. Genet.
44
,
251
-
253
.
Xiao
,
Z.
,
Chen
,
Z. H.
,
Gunasekera
,
A. H.
,
Sowin
,
T. J.
,
Rosenberg
,
S. H.
,
Fesik
,
S.
and
Zhang
,
H. Y.
(
2003
).
Chk1 mediates S and G(2) arrests through Cdc25A degradation in response to DNA-damaging agents
.
J. Biol. Chem.
278
,
21767
-
21773
.
Xiong
,
J.
,
Zhang
,
Z.
and
Zhu
,
B.
(
2016
).
Polycomb “polypacks” the chromatin
.
Proc. Natl. Acad. Sci. USA
113
,
14878
-
14880
.
Yu
,
Y. X.
,
Song
,
C. Y.
,
Zhang
,
Q. Y.
,
Dimaggio
,
P. A.
,
Garcia
,
B. A.
,
York
,
A.
,
Carey
,
M. F.
and
Grunstein
,
M.
(
2012
).
Histone H3 Lysine 56 Methylation Regulates DNA Replication through Its Interaction with PCNA
.
Mol. Cell
46
,
7
-
17
.
Zhao
,
L.
,
Wang
,
D. L.
,
Liu
,
Y.
,
Chen
,
S.
and
Sun
,
F. L.
(
2013
).
Histone acetyltransferase hMOF promotes S phase entry and tumorigenesis in lung cancer
.
Cell. Signal.
25
,
1689
-
1698
.

Competing interests

The authors declare no competing or financial interests.

Supplementary information