Signaling by the p75 neurotrophin receptor (p75NTR, also known as NGFR) is often referred to as cell‐context dependent, but neuron‐type‐specific signaling by p75NTR has not been systematically investigated. Here, we report that p75NTR signals very differently in hippocampal neurons (HCNs) and cerebellar granule neurons (CGNs), and we present evidence indicating that this is partly controlled by differential proteolytic cleavage. Nerve growth factor (NGF) induced caspase‐3 activity and cell death in HCNs but not in CGNs, whereas it stimulated NFκB activity in CGNs but not in HCNs. HCNs and CGNs displayed different patterns of p75NTR proteolytic cleavage. Whereas the p75NTR carboxy terminal fragment (CTF) was more abundant than the intracellular domain (ICD) in HCNs, CGNs exhibited fully processed ICD with very little CTF. Pharmacological or genetic blockade of p75NTR cleavage by γ‐secretase abolished NGF‐induced upregulation of NFκB activity and enabled induction of CGN death, phenocopying the functional profile of HCNs. Thus, the activities of multifunctional receptors, such as p75NTR, can be tuned into narrower activity profiles by cell‐type‐specific differences in intracellular processes, such as proteolytic cleavage, leading to very different biological outcomes.

INTRODUCTION

The p75 neurotrophin receptor (p75NTR, also known as NGFR), a member of the tumor necrosis factor (TNF) receptor superfamily, can regulate a number of different biological activities in response to ligand binding, including cell death and/or survival, axonal growth and synaptic plasticity (Dechant and Barde, 2002; Roux and Barker, 2002; Underwood and Coulson, 2008). The specific biological outcomes mediated by p75NTR in a given cell depend in part on the type of ligand engaging the receptor. Initially, p75NTR was characterized as a receptor for members of the neurotrophin family, including nerve growth factor (NGF), brain‐derived neurotrophic factor (BDNF), neurotrophin‐3 and neurotrophin‐4 (NT‐3 and NT‐4, respectively). These neurotrophins can also signal through TrkA, B and C (also known as NTRK1, 2 and 3, respectively), members of the receptor tyrosine kinase superfamily (Reichardt, 2006). The two receptor systems can function synergistically, antagonistically or independently of each other in different cell types (Lu et al., 2005). In addition to its function as a receptor for mature neurotrophins, p75NTR has been shown to bind and mediate biological effects when stimulated with unprocessed neurotrophins (pro‐neurotrophins), an interaction that is thought to preferentially result in cell death (Lee et al., 2001). In addition to mature and pro‐neurotrophins, a number of different ligands are known to engage or signal through p75NTR, including myelin‐derived polypeptides, such as myelin‐associated glycoprotein (MAG) or Nogo (also known as reticulon‐4; Wang et al., 2002; Wong et al., 2002), the rabies virus glycoprotein (RVG) (Tuffereau et al., 1998) and the β‐amyloid peptide, a major component of the amyloid plaques in Alzheimer's disease (Knowles et al., 2009; Perini et al., 2002). Some of these ligands, such as mature neurotrophins, RVG and β‐amyloid, can bind p75NTR directly, whereas others require co‐receptor proteins for either binding or downstream signaling. Pro‐neurotrophins engage p75NTR together with members of the Vps10 family, including sortilin, SorL1 and SorCS2 (Nykjaer and Willnow, 2012; Nykjaer et al., 2004). Myelin‐derived ligands require expression of Nogo receptor (NgR, also known as RTN4R) and Lingo‐1 for signaling through p75NTR (Mi et al., 2004; Wang et al., 2002; Wong et al., 2002).

p75NTR is known to engage different signaling pathways in the cell, of which the three most important ones are the JNK or caspase pathway, which mediates cell death (Friedman, 2000; Yoon et al., 1998), the RhoA pathway, which regulates axon growth, collapse and degeneration (Park et al., 2010; Yamashita and Tohyama, 2003; Yamashita et al., 1999) and the NF‐κB pathway, which has been implicated in cell survival (Carter et al., 1996; Khursigara et al., 2001). Structural determinants involved in the regulation of each of these pathways have been mapped onto non‐overlapping epitopes in the p75NTR intracellular death domain, demonstrating that different signaling outputs can be genetically separated in p75NTR (Charalampopoulos et al., 2012). Using this approach, p75NTR mutants that are selectively deficient in one pathway but not others have been generated. As the intracellular domain (ICD) of p75NTR lacks catalytic activity, the receptor engages with downstream signaling pathways by recruitment and release of intracellular components. Several proteins that interact with the p75NTR ICD have been shown to link the receptor to well‐known signaling pathways, such as RIP2 (also known as RIPK2), for the NF‐κB pathway (Khursigara et al., 2001), and RhoGDI, for the RhoA pathway (Yamashita and Tohyama, 2003). However, most of the intracellular proteins that are known to interact with p75NTR, such as NRIF (Casademunt et al., 1999), NRAGE (also known as MAGED1; Salehi et al., 2000), SC‐1 (Chittka and Chao, 1999), Bex1 (Vilar et al., 2006) and several others, are not members of previously established signaling pathways. Moreover, p75NTR undergoes proteolytic cleavage at the plasma membrane. Extracellular cleavage by membrane metalloproteases (often referred to as ‘α‐cleavage’) is followed by intramembrane cleavage by γ‐secretase (referred to as ‘γ‐cleavage’), leading to release of the p75NTR ICD in the cytoplasm (Jung et al., 2003; Kanning et al., 2003). Proteolytic processing of p75NTR occurs constitutively in cells, but some studies have indicated that it might also be regulated by ligand binding. Pharmacological experiments have indicated that proteolytic cleavage contributes to p75NTR‐mediated cell death in sympathetic and hippocampal neurons (Kenchappa et al., 2006; Volosin et al., 2008), but the broader significance of p75NTR cleavage for its activities in different neuronal subpopulations is not fully understood.

In summary, a variety of ligands and co‐receptors, together with proteolytic cleavage, can contribute to the diversity of p75NTR signaling. In addition to these mechanisms, several studies have described the activities of p75NTR as being cell‐context dependent, meaning that the receptor is able to elicit distinct responses in different types of cells. However, the extent to which distinct pathways can be regulated by p75NTR in different cell types has not been systematically investigated, and the molecular bases for cell‐type‐specific functions of p75NTR have not been defined. In this study, we investigated signaling and biological activities regulated by p75NTR in response to NGF in two populations of neurons in the developing mammalian brain, namely hippocampal neurons (HCNs) and cerebellar granule neurons (CGNs). Both of these neuronal types express p75NTR in the absence of TrkA receptors. The NGF responses that we have studied are p75NTR‐mediated, as they are abolished in p75NTR‐knockout neurons. We found striking differences in the ability of p75NTR to induce cell death and activation of the NF‐κB pathway in these two neuronal types. We also found important differences in the proteolytic processing of p75NTR between the two classes of neurons, and we present genetic and pharmacological evidence indicating that differences in proteolytic processing machinery contribute to the different biological responses elicited by p75NTR in the two neuronal types.

RESULTS

p75NTR differentially activates cell death and NF‐κB pathways in hippocampal and cerebellar granule neurons

We investigated the ability of p75NTR to induce cell death, assessed by TUNEL assay, in embryonic (E17.5) HCNs and early postnatal (P7) CGNs. Cultures were stimulated with NGF for 24 h, fixed and stained for TUNEL and the neuronal marker β‐III tubulin (Fig. 1A). NGF was able to induce cell death in HCNs but not in CGNs (Fig. 1B). Next, we investigated the ability of p75NTR to engage the NF‐κB and JNK signaling pathways in response to NGF in cultured HCNs and CGNs. For the NF‐κB pathway, we assessed NGF‐induced recruitment of RIP2 to p75NTR, degradation of IκBα (also known as NFKBIA), a negative regulator of the pathway, and nuclear translocation of the p65 NF‐κB subunit (p65NFκB). RIP2–p75NTR interaction was assessed by proximity ligation assay (PLA) in HCNs and CGNs after 0, 15 or 30 min of NGF stimulation. RIP2 was robustly recruited to p75NTR in CGNs but not in HCNs (Fig. 2A). Moreover, NGF stimulated IκB degradation in CGNs but not in HCNs (Fig. 2B). In agreement with these results, NGF induced nuclear translocation of p65NFκB in CGNs but not in HCNs (Fig. 2C). However, interleukin‐1β (IL‐1b) readily induced p65NFκB nuclear translocation in HCNs (Fig. 2C), indicating that the pathway can be activated by means other than NGF–p75NTR signaling in these neurons. For the JNK pathway, we assessed the ability of NGF to induce phosphorylation of c‐jun kinase (JNK) in cultured HCNs and CGNs. Although NGF was capable of inducing JNK phosphorylation in both neuronal types, this was most prominent on the p54 isoform in HCNs, but on the p46 isoform in CGNs (Fig. 2D). Taken together, these data demonstrate a differential ability of p75NTR to induce cell death, NF‐κB activity and phosphorylation of JNK isoforms in HCNs and CGNs.

Fig. 1.

p75NTR can induce cell death in hippocampal neurons but not in cerebellar granule neurons.(A) Cell death in response to NGF treatment was assessed in hippocampal neurons (HCNs) and cerebellar granule neurons (CGNs), identified by β‐III tubulin immunostaining (red), using the TUNEL method (green). Nuclear staining by DAPI is shown in blue. Arrows indicate β‐III tubulin and TUNEL double‐positive cells. Scale bar: 50 µm. (B) Quantification of TUNEL‐positive neurons in HCN and CGN cultures after 24 h treatment with NGF. Results are expressed as the mean±s.e.m. (relative to control) of three independent experiments each performed in triplicate. *P<0.05 versus control (Student's t‐test).

Fig. 1.

p75NTR can induce cell death in hippocampal neurons but not in cerebellar granule neurons.(A) Cell death in response to NGF treatment was assessed in hippocampal neurons (HCNs) and cerebellar granule neurons (CGNs), identified by β‐III tubulin immunostaining (red), using the TUNEL method (green). Nuclear staining by DAPI is shown in blue. Arrows indicate β‐III tubulin and TUNEL double‐positive cells. Scale bar: 50 µm. (B) Quantification of TUNEL‐positive neurons in HCN and CGN cultures after 24 h treatment with NGF. Results are expressed as the mean±s.e.m. (relative to control) of three independent experiments each performed in triplicate. *P<0.05 versus control (Student's t‐test).

Fig. 2.

Differential p75NTR‐mediated activation of NF‐κB and JNK signaling in hippocampal and cerebellar granule neurons.(A) Recruitment of RIP2 to p75NTR in HCNs and CGNs following NGF treatment as assessed by proximity ligation assay (PLA). PLA signal appears as red puncta, neurons were identified by MAP2 staining (green) and nuclei were counterstained with DAPI (blue). Scale bar: 30 µm. The graph shows quantification of PLA puncta density under basal conditions (0') and after 15 and 30 min of NGF treatment. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus 0' (Student's t‐test). (B) Levels of IκBα in HCNs and CGNs following NGF treatment for the indicated times. Fold change was calculated by densitometric scanning of IκBα signals normalized to actin levels. Results shown are representative of three independent experiments. (C) Nuclear translocation of p65NFkB (red) in CGNs identified by MAP2 staining (green) in response to NGF (representative micrographs shown in upper panel). The histogram shows quantification of the proportion of cells showing prominent nuclear p65NFkB signal in CGNs and HCNs following stimulation with NGF or interleukin‐1β (IL‐1b). Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control (Student's t‐test). (D) Levels of phosphorylated c‐jun kinase (P‐JNK) in HCNs and CGNs following NGF treatment for the indicated times. p54 and p46 JNK isoforms are indicated. Fold change was calculated by densitometric scanning of IκBα signals normalized to actin levels. Results shown are representative of two independent experiments.

Fig. 2.

Differential p75NTR‐mediated activation of NF‐κB and JNK signaling in hippocampal and cerebellar granule neurons.(A) Recruitment of RIP2 to p75NTR in HCNs and CGNs following NGF treatment as assessed by proximity ligation assay (PLA). PLA signal appears as red puncta, neurons were identified by MAP2 staining (green) and nuclei were counterstained with DAPI (blue). Scale bar: 30 µm. The graph shows quantification of PLA puncta density under basal conditions (0') and after 15 and 30 min of NGF treatment. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus 0' (Student's t‐test). (B) Levels of IκBα in HCNs and CGNs following NGF treatment for the indicated times. Fold change was calculated by densitometric scanning of IκBα signals normalized to actin levels. Results shown are representative of three independent experiments. (C) Nuclear translocation of p65NFkB (red) in CGNs identified by MAP2 staining (green) in response to NGF (representative micrographs shown in upper panel). The histogram shows quantification of the proportion of cells showing prominent nuclear p65NFkB signal in CGNs and HCNs following stimulation with NGF or interleukin‐1β (IL‐1b). Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control (Student's t‐test). (D) Levels of phosphorylated c‐jun kinase (P‐JNK) in HCNs and CGNs following NGF treatment for the indicated times. p54 and p46 JNK isoforms are indicated. Fold change was calculated by densitometric scanning of IκBα signals normalized to actin levels. Results shown are representative of two independent experiments.

p75NTR‐mediated NF‐κB activity regulates cell survival in cerebellar granule neurons

Activation of the NF‐κB pathway has previously been linked to cell survival in different cell types, including neurons (Beg and Baltimore, 1996; Mattson et al., 1997; Middleton et al., 2000). We speculated that the inability of NGF to induce cell death through p75NTR in CGNs might have been due to activation of the NF‐κB pathway in these cells. Sustained NF‐κB activity is important for CGN cell survival, as blockade of NF‐κB signaling with JSH‐23 [which inhibits nuclear translocation of p65NFκB and its transcriptional activity (Shin et al., 2004)] induced caspase‐3 cleavage in cultured CGNs (Fig. 3A). Our laboratory has recently elucidated a structure‐function map of the p75NTR death domain and identified residues that are important for the selective activation of JNK–caspase‐3 and NF‐κB pathways (Charalampopoulos et al., 2012). p75NTR molecules carrying mutations in these residues can be used to genetically dissect the contribution of different pathways to p75NTR physiology by reconstitution experiments in p75NTR‐deficient cells. As shown in Fig. 3B, a p75NTR mutant with a selective defect in NFκB signaling (p75NFkB) was unable to induce p65NFkB nuclear translocation in CGNs derived from p75NTR‐knockout mice in response to NGF. In contrast, both wild‐type p75NTR and a mutant deficient in JNK signaling (p75JNK) readily induced nuclear translocation of p65NFkB after NGF treatment in these cells (Fig. 3B). We took advantage of the p75NFkB mutant to investigate the contribution of p75NTR‐mediated NF‐κB activity to the regulation of cell death pathways by NGF in HCNs and CGNs. As expected, NGF induced caspase‐3 activation in HCNs (Fig. 4A) but not in CGNs (Fig. 3C) isolated from wild‐type mice, in agreement with the TUNEL assay. p75NTR‐knockout CGNs reconstituted with wild‐type p75NTR behaved as CGNs isolated from wild‐type mice and were refractory to activation of caspase‐3 by NGF (Fig. 3C). In contrast, knockout CGNs reconstituted with a p75NFkB mutant deficient in NF‐κB signaling displayed a significant increase in caspase‐3 activation, which was further enhanced by stimulation with NGF (Fig. 3C). Thus, absence of receptor coupling to the NF‐κB pathway unmasked the ability of p75NTR to induce cell death in CGNs. We speculated that activation of NF‐κB signaling might limit the ability of p75NTR to induce cell death in CGNs, perhaps by inducing a parallel survival pathway in response to NGF. NF‐κB has been shown to induce the expression of several genes encoding a variety of anti‐apoptotic proteins, including many from the Bcl‐2 and IAP families (Karin and Lin, 2002; Kucharczak et al., 2003; Perkins, 2007; Wang et al., 1998). We therefore investigated the induction of a number of anti‐apoptotic NF‐κB target genes in CGNs following stimulation with NGF. We found that NGF treatment for 24 h greatly induced the expression of NIAP (neuronal inhibitor of apoptosis protein, also known as NAIP) and Livin (also known as BIRC7), two anti‐apoptotic genes regulated by the NF‐κB pathway (Fig. 3D; Busuttil et al., 2002; Zhang et al., 2014). NGF did not induce the expression of Bcl‐2, Bcl‐xL (encoded by BCL2L1), cIAP1 (also known as BIRC2), cIAP2 (also known as BIRC3), XIAP, Bruce (also known as BIRC6) or survivin (also known as BIRC5) in cultured CGNs (data not shown).

Fig. 3.

p75NTR‐mediated NF‐κB activity regulates cell survival in cerebellar granule neurons.(A) Activated caspase‐3 in CGNs after overnight treatment with NF‐kB inhibitor JSH‐23. The micrographs show immunofluorescence images of cleaved caspase‐3 (red) and β‐III tubulin (green) with DAPI as nuclear counterstaining (blue). Scale bar: 30 µm. The graph depicts the percentage of cells showing activated caspase‐3 under control conditions (0) and after treatment with two doses of JSH‐23. Results are expressed as the mean±s.e.m. of four independent experiments each performed in triplicate. *P<0.05 versus 0 µM. (B) Nuclear translocation of p65NFkB in p75NTR knockout (KO) CGNs reconstituted with the indicated constructs in response to NGF treatment. p75JNK and p75NFkB denote mutant p75NTR constructs deficient in JNK and NF‐κB signaling, respectively. EGFP plasmid was co‐transfected to allow the recognition of transfected neurons. The graph shows the percentage of GFP‐positive cells showing nuclear p65NFkB staining. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control. (C) Activated caspase‐3 in wild‐type (WT) and p75NTR knockout CGNs in response to NGF. Knockout neurons were reconstituted with the indicated constructs. The micrographs show examples of the responses of knockout neurons. Scale bar: 30 µm. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. #P<0.05 versus wild type; *P<0.05 versus control. (D) Induction of mRNAs encoding pro‐survival NF‐κB target genes NIAP and Livin in CGNs in response to NGF was analyzed by Q‐PCR. Results are expressed as the mean±s.e.m. (N = 5). *P<0.05 versus control. All P‐values were calculated with a Student's t‐test.

Fig. 3.

p75NTR‐mediated NF‐κB activity regulates cell survival in cerebellar granule neurons.(A) Activated caspase‐3 in CGNs after overnight treatment with NF‐kB inhibitor JSH‐23. The micrographs show immunofluorescence images of cleaved caspase‐3 (red) and β‐III tubulin (green) with DAPI as nuclear counterstaining (blue). Scale bar: 30 µm. The graph depicts the percentage of cells showing activated caspase‐3 under control conditions (0) and after treatment with two doses of JSH‐23. Results are expressed as the mean±s.e.m. of four independent experiments each performed in triplicate. *P<0.05 versus 0 µM. (B) Nuclear translocation of p65NFkB in p75NTR knockout (KO) CGNs reconstituted with the indicated constructs in response to NGF treatment. p75JNK and p75NFkB denote mutant p75NTR constructs deficient in JNK and NF‐κB signaling, respectively. EGFP plasmid was co‐transfected to allow the recognition of transfected neurons. The graph shows the percentage of GFP‐positive cells showing nuclear p65NFkB staining. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control. (C) Activated caspase‐3 in wild‐type (WT) and p75NTR knockout CGNs in response to NGF. Knockout neurons were reconstituted with the indicated constructs. The micrographs show examples of the responses of knockout neurons. Scale bar: 30 µm. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. #P<0.05 versus wild type; *P<0.05 versus control. (D) Induction of mRNAs encoding pro‐survival NF‐κB target genes NIAP and Livin in CGNs in response to NGF was analyzed by Q‐PCR. Results are expressed as the mean±s.e.m. (N = 5). *P<0.05 versus control. All P‐values were calculated with a Student's t‐test.

Fig. 4.

p75NTR‐mediated apoptosis in hippocampal neurons can be attenuated by concomitant activation of NF‐κB.(A) Activated caspase‐3 (red) in wild‐type (WT) and p75NTR‐knockout (KO) HCNs in response to NGF. Knockout neurons were reconstituted with the indicated constructs. The micrographs show examples of the responses of knockout neurons. Neurons were identified by MAP2 staining (purple). EGFP plasmid was co‐transfected to allow recognition of transfected neurons (green). Scale bar: 30 µm. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control (Student's t‐test). (B) Activated caspase‐3 in wild‐type HCNs following NGF treatment in the presence or absence of IL‐1b and the NF‐κB inhibitor JSH‐23 (10 µM). The graph shows the percentage of neurons showing activated caspase‐3. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.01 versus no NGF; #P<0.01 versus no IL‐1b; P<0.01 versus control (Student's t‐test).

Fig. 4.

p75NTR‐mediated apoptosis in hippocampal neurons can be attenuated by concomitant activation of NF‐κB.(A) Activated caspase‐3 (red) in wild‐type (WT) and p75NTR‐knockout (KO) HCNs in response to NGF. Knockout neurons were reconstituted with the indicated constructs. The micrographs show examples of the responses of knockout neurons. Neurons were identified by MAP2 staining (purple). EGFP plasmid was co‐transfected to allow recognition of transfected neurons (green). Scale bar: 30 µm. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control (Student's t‐test). (B) Activated caspase‐3 in wild‐type HCNs following NGF treatment in the presence or absence of IL‐1b and the NF‐κB inhibitor JSH‐23 (10 µM). The graph shows the percentage of neurons showing activated caspase‐3. Results are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.01 versus no NGF; #P<0.01 versus no IL‐1b; P<0.01 versus control (Student's t‐test).

In HCNs derived from p75NTR‐knockout mice, reconstitution with wild‐type p75NTR or the p75NFkB mutant resulted in comparable activation of caspase‐3 in response to NGF (Fig. 4A), demonstrating that cell death of HCNs induced by NGF is indeed mediated by p75NTR and that it is unaffected by the mutation that impairs receptor coupling to NF‐κB signaling. In view of the pro‐survival effects of NF‐κB in CGNs, we investigated whether activation of this pathway might have similar effects in HCNs; in particular, whether it could counteract the induction of caspase‐3 activity by NGF in these neurons. To this end, we used IL‐1b, a known stimulator of the NF‐κB pathway in HCNs, in the presence or absence of the NF‐κB inhibitor JSH‐23. As expected, pharmacological blockade of NF‐κB had no effect on the ability of NGF to induce caspase‐3 cleavage in cultured HCNs (Fig. 4B). On its own, IL‐1b had no major effect on caspase‐3 activity, and blockade of NF‐κB promoted a small increase, although still within the range of basal activity levels of naive cells (Fig. 4B). Interestingly, IL‐1b attenuated the activation of caspase‐3 in response to NGF, and this could be reverted by JSH‐23, indicating that the anti‐apoptotic effect of IL‐1b in HCNs was mediated by the NF‐κB pathway (Fig. 4B). These results indicate that, as in CGNs, activation of the NF‐κB pathway is able to intercept the pro‐apoptotic effects of NGF in HCNs. The inability of p75NTR to effectively engage this pathway thereby allows apoptosis and cell death to proceed following NGF stimulation in these neurons.

HCNs and CGNs display different patterns of p75NTR proteolytic cleavage

We compared the patterns of p75NTR cleavage in HCNs and CGNs to assess the possible contribution of this process to the differential activities of p75NTR in these cells. In tissue extracts, as well as in cell culture, the carboxy‐terminal fragment (CTF) of p75NTR – i.e. the product of α‐cleavage in the absence of γ‐cleavage – was significantly more enriched in hippocampus (and cultured HCNs) than in cerebellum (and cultured CGNs) (Fig. 5A,B). Conversely, the intracellular domain (ICD) – i.e. the product of both α‐ and γ‐cleavage − was more abundant in cerebellar extracts and cultured CGNs (Fig. 5A,B), suggesting higher γ‐secretase activity in cerebellar cells compared with hippocampal cells. In agreement with this, cerebellar tissue and cultured cells displayed higher levels of full‐length and proteolytically activated presenilin‐1 (PS‐1) – the catalytically active subunit of the γ‐secretase complex – than their hippocampal counterparts (Fig. 5C,D). These data suggest that differential proteolytic processing of p75NTR in HCNs and CGNs might underlie the different activities of the receptor in these two neuronal cell types.

Fig. 5.

Different patterns of p75NTR proteolytic cleavage in hippocampal and cerebellar granule neurons.(A) Expression of p75NTR and its proteolytic products in tissue extracts of P7 hippocampus (Hipp) and cerebellum (Cbllm). A representative example of a western blot is shown with duplicate samples from two different animals run in parallel for each brain structure. FL, full length; CTF, C‐terminal fragment; ICD, intracellular domain. The blot was reprobed for actin as the loading control. The graph shows quantification of the CTF:ICD ratio. Results are expressed as the mean±s.d. of three independent experiments. *P<0.05 versus Hipp (Student's t‐test). (B) Expression of p75NTR and its proteolytic products in cultured HCNs and CGNs after 7 days in vitro in the presence of epoxomicin. (C) Expression of presenilin‐1 (PS‐1) [full length and carboxy‐terminal fragment (C‐term)] in tissue extracts of P7 hippocampus and cerebellum. A representative example of a western blot is shown with duplicate samples from two different animals run in parallel for each brain structure. (D) Expression of p75NTR and PS‐1 in cultured HCNs and CGNs after the indicated days (d) in vitro.

Fig. 5.

Different patterns of p75NTR proteolytic cleavage in hippocampal and cerebellar granule neurons.(A) Expression of p75NTR and its proteolytic products in tissue extracts of P7 hippocampus (Hipp) and cerebellum (Cbllm). A representative example of a western blot is shown with duplicate samples from two different animals run in parallel for each brain structure. FL, full length; CTF, C‐terminal fragment; ICD, intracellular domain. The blot was reprobed for actin as the loading control. The graph shows quantification of the CTF:ICD ratio. Results are expressed as the mean±s.d. of three independent experiments. *P<0.05 versus Hipp (Student's t‐test). (B) Expression of p75NTR and its proteolytic products in cultured HCNs and CGNs after 7 days in vitro in the presence of epoxomicin. (C) Expression of presenilin‐1 (PS‐1) [full length and carboxy‐terminal fragment (C‐term)] in tissue extracts of P7 hippocampus and cerebellum. A representative example of a western blot is shown with duplicate samples from two different animals run in parallel for each brain structure. (D) Expression of p75NTR and PS‐1 in cultured HCNs and CGNs after the indicated days (d) in vitro.

Proteolytic processing by γ‐secretase regulates p75NTR activities in cerebellar granule neurons

In order to assess the importance of proteolytic processing for the activities of p75NTR in HCNs and CGNs, we first utilized a pharmacological approach based on selective inhibition of α‐ or γ‐cleavage with TAPI or DAPT, respectively. These compounds have previously been reported to effectively disrupt cleavage of p75NTR in sympathetic neurons (Kenchappa et al., 2006; Kraemer et al., 2014), CGNs (Ceni et al., 2010) and HCNs (Volosin et al., 2008). Neither TAPI or DAPT were able to abolish NGF‐induced activation of caspase‐3 in HCNs (Fig. 6A), although a limited attenuating effect of TAPI was observed, in agreement with previously reported results (Volosin et al., 2008). These data suggest that proteolytic cleavage of p75NTR is not obligatory for the induction of cell death by NGF in hippocampal neurons. In CGNs, NGF did not induce caspase‐3 activity, as expected, and TAPI had no effect (Fig. 6B). Surprisingly, however, treatment with DAPT allowed NGF to induce activation of caspase‐3 in CGNs (Fig. 6B). Interestingly, DAPT also prevented NGF‐mediated activation of the NF‐κB pathway in these cells, whereas TAPI had no effect (Fig. 6C), complementary to the observed effects on cell death. Moreover, the activation of caspase‐3 by NGF in the presence of DAPT could be abolished by JNK‐IN‐8 (Fig. 6D), a specific JNK inhibitor (Zhang et al., 2012), indicating the involvement of the JNK pathway in the activation of caspase‐3 in CGNs. Taken together, these results suggest that deficient γ‐cleavage after α‐cleavage, but not proteolytic processing per se, of p75NTR prevents activation of NF‐κB by NGF and allows the induction of cell death in CGNs.

Fig. 6.

Pharmacological inhibition of p75NTR proteolytic cleavage affects receptor activities in cerebellar granule neurons but not in hippocampal neurons.(A) Effects of TAPI and DAPT on NGF‐mediated activation of caspase‐3 in wild‐type hippocampal neurons (HCNs). The graph shows the percentage of neurons showing activated caspase‐3. (B) Effects of TAPI and DAPT on NGF‐mediated activation of caspase‐3 in wild‐type cerebellar granule neurons (CGNs). The graph shows the percentage of neurons showing activated caspase‐3. (C) Effects of TAPI and DAPT on NGF‐mediated nuclear translocation of p65NFkB in wild‐type CGNs. The graph shows the percentage of GFP‐positive cells showing nuclear p65NFkB staining. (D) Effects of DAPT and JNK‐IN‐8 (IN‐8, 3 µM) on NGF‐mediated activation of caspase‐3 in wild‐type CGNs. The graph shows the percentage of neurons showing activated caspase‐3. Results in A–D are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control; #P<0.05 versus no IN‐8 (Student's t‐test).

Fig. 6.

Pharmacological inhibition of p75NTR proteolytic cleavage affects receptor activities in cerebellar granule neurons but not in hippocampal neurons.(A) Effects of TAPI and DAPT on NGF‐mediated activation of caspase‐3 in wild‐type hippocampal neurons (HCNs). The graph shows the percentage of neurons showing activated caspase‐3. (B) Effects of TAPI and DAPT on NGF‐mediated activation of caspase‐3 in wild‐type cerebellar granule neurons (CGNs). The graph shows the percentage of neurons showing activated caspase‐3. (C) Effects of TAPI and DAPT on NGF‐mediated nuclear translocation of p65NFkB in wild‐type CGNs. The graph shows the percentage of GFP‐positive cells showing nuclear p65NFkB staining. (D) Effects of DAPT and JNK‐IN‐8 (IN‐8, 3 µM) on NGF‐mediated activation of caspase‐3 in wild‐type CGNs. The graph shows the percentage of neurons showing activated caspase‐3. Results in A–D are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control; #P<0.05 versus no IN‐8 (Student's t‐test).

A limitation of pharmacological inhibition of α‐ or γ‐secretases is its relative lack of specificity. To address this problem, we developed a genetic approach based on variants of p75NTR carrying point mutations that interfere with α‐ and γ‐cleavage of the receptor. In earlier work, Coulson and colleagues reported that introduction of an N‐glycosylation site at position 243 of the stalk region of the p75NTR extracellular domain effectively blocks α‐cleavage of the receptor (Coulson et al., 2008; Underwood et al., 2008), possibly through a steric hindrance mechanism. In transfected COS‐7 cells, a p75NTR construct carrying this mutation (Val243 to Asn, herein referred to as N‐glyco) was completely resistant to proteolytic cleavage induced by phorbol 12‐myristate 13‐acetate (PMA), in agreement with previous studies (Fig. 7A). As γ‐cleavage is dependent upon a prior α‐cleavage, neither ICD nor CTF can be produced by the p75NTR N‐glyco construct. We also generated a γ‐cleavage‐resistant variant by replacing intramembrane residue Val264 with Ala (herein referred to as γsecmut). This construct can generate the p75NTR CTF but not the ICD in transfected COS‐7 cells (Fig. 7A). In subsequent experiments, constructs expressing wild‐type p75NTR, N‐glyco, γsecmut or empty vector were transfected into neurons derived from p75NTR‐knockout mice. In agreement with the pharmacological experiments, reconstitution of p75NTR‐knockout HCNs with wild type, N‐glyco mutant or γsecmut (but not empty vector) restored the ability of NGF to induce activation of caspase‐3 in these cells (Fig. 7B). This result confirms that proteolytic cleavage of p75NTR is not necessary for hippocampal neuron death in response to NGF. As expected, wild‐type p75NTR did not induce cell death in CGNs and the N‐glyco mutant had no effect on cell death rate (Fig. 7C). In contrast, γsecmut induced cell death of knockout CGNs, both at basal levels and to an even greater extent after stimulation with NGF (Fig. 7C), a result that resembles the activity of the NF‐κB‐deficient p75NTR mutant (compare to Fig. 3C). Taken together, these results confirmed those obtained with the pharmacological approach, indicating that deficient γ‐cleavage after α‐cleavage, but not proteolytic processing per se, of p75NTR allows induction of cell death in CGNs by NGF. As γ‐cleavage depends on prior α‐cleavage, DAPT should not have any effect on knockout CGNs reconstituted with the N‐glyco mutant. Indeed, although DAPT treatment of p75NTR‐knockout CGNs reconstituted with wild‐type p75NTR allowed NGF‐induced cell death, in agreement with our findings on wild‐type neurons, this was not the case if the N‐glyco mutant was introduced instead (Fig. 7D). Finally, we tested whether these results could be explained by the status of NF‐κB activation in these cells. In fact, whereas both wild‐type p75NTR and the N‐glyco mutant were able to reconstitute NGF‐mediated nuclear translocation of p65NFkB in knockout CGNs, γsecmut was unable to do so (Fig. 7E), paralleling the ability of this construct to induce caspase‐3 activity in these cells. Moreover, although DAPT inhibited NGF‐mediated p65NFkB nuclear translocation in knockout neurons reconstituted with wild‐type p75NTR, the N‐glyco mutant retained its ability to activate NF‐κB in the presence of DAPT in (Fig. 7F). We conclude from these results that, although full proteolytic cleavage does not per se affect p75NTR activities in CGNs, incomplete cleavage, i.e. α‐ without γ‐cleavage, inhibits the ability of the receptor to couple to the NF‐κB pathway and allows the induction of cell death in response to NGF, presumably as a result of diminished pro‐survival NF‐κB activity.

Fig. 7.

Proteolytic processing by γ‐secretase regulates p75NTR activities in cerebellar granule neurons.(A) Proteolytic cleavage of wild‐type (WT) p75NTR, N‐glyco and γsecmut mutant variants in transfected COS cells. FL, full length; CTF, C‐terminal fragment; ICD, intracellular domain. Epoxomicin (‘E’) is a proteasomal inhibitor that facilitates detection of the p75NTR ICD. PMA (‘P’) was used to induce p75NTR proteolytic cleavage. DAPT (‘D’) blocks γ‐secretase and prevents formation of the ICD. The blot was reprobed for actin as loading control. (B) Activation of caspase‐3 in p75NTR‐knockout HCNs reconstituted with the indicated constructs in response to NGF treatment. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. (C) Activation of caspase‐3 in p75NTR‐knockout CGNs reconstituted with the indicated constructs in response to NGF treatment. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. (D) NGF‐mediated activation of caspase‐3 in p75NTR‐knockout CGNs reconstituted with the indicated constructs and treated with DAPT or TAPI as indicated. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. (E) Nuclear translocation of p65NFkB in p75NTR‐knockout CGNs reconstituted with the indicated constructs in response to NGF treatment. The graph shows the percentage of GFP‐positive cells showing nuclear p65NFkB staining. (F) NGF‐mediated nuclear translocation of p65NFkB in p75NTR‐knockout CGNs reconstituted with the indicated p75NTR constructs and treated with DAPT or TAPI as indicated. The graph shows the percentage of GFP‐positive cells showing nuclear p65NFkB staining. Results in B–F are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control (Student's t‐test).

Fig. 7.

Proteolytic processing by γ‐secretase regulates p75NTR activities in cerebellar granule neurons.(A) Proteolytic cleavage of wild‐type (WT) p75NTR, N‐glyco and γsecmut mutant variants in transfected COS cells. FL, full length; CTF, C‐terminal fragment; ICD, intracellular domain. Epoxomicin (‘E’) is a proteasomal inhibitor that facilitates detection of the p75NTR ICD. PMA (‘P’) was used to induce p75NTR proteolytic cleavage. DAPT (‘D’) blocks γ‐secretase and prevents formation of the ICD. The blot was reprobed for actin as loading control. (B) Activation of caspase‐3 in p75NTR‐knockout HCNs reconstituted with the indicated constructs in response to NGF treatment. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. (C) Activation of caspase‐3 in p75NTR‐knockout CGNs reconstituted with the indicated constructs in response to NGF treatment. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. (D) NGF‐mediated activation of caspase‐3 in p75NTR‐knockout CGNs reconstituted with the indicated constructs and treated with DAPT or TAPI as indicated. The graph shows the percentage of GFP‐positive cells showing activated caspase‐3. (E) Nuclear translocation of p65NFkB in p75NTR‐knockout CGNs reconstituted with the indicated constructs in response to NGF treatment. The graph shows the percentage of GFP‐positive cells showing nuclear p65NFkB staining. (F) NGF‐mediated nuclear translocation of p65NFkB in p75NTR‐knockout CGNs reconstituted with the indicated p75NTR constructs and treated with DAPT or TAPI as indicated. The graph shows the percentage of GFP‐positive cells showing nuclear p65NFkB staining. Results in B–F are expressed as the mean±s.e.m. of three independent experiments each performed in triplicate. *P<0.05 versus control (Student's t‐test).

DISCUSSION

This study describes differential responses to p75NTR activation in two subpopulations of central nervous system neurons and provides mechanistic evidence for the contribution of proteolytic processing to the regulation of cell‐type‐specific activities in this receptor. In HCNs, p75NTR was able to induce cell death, but not activation of NF‐κB, when stimulated with NGF, in agreement with previous observations (Volosin et al., 2008). RIP2 was previously shown to link p75NTR to the NF‐κB pathway (Khursigara et al., 2001), and we found that NGF induced RIP2 recruitment to the receptor in CGNs but not in HCNs, providing a possible explanation for the inability of p75NTR to regulate NF‐κB signaling in the latter. HCNs might lack components necessary for a stable interaction between RIP2 and p75NTR or, alternatively, the receptor might engage other effector proteins that prevent efficient recruitment of RIP2. Nevertheless, the ability of IL‐1b to activate p65NFkB and counteract the pro‐apoptotic effects of NGF in HCNs suggests that the NF‐κB pathway is capable of inducing a pro‐survival response in these neurons. In contrast to HCNs, p75NTR could not induce cell death in CGNs, but it stimulated NF‐κB nuclear translocation and expression of the pro‐survival NF‐κB target genes NIAP and Livin in a ligand‐dependent manner in these neurons. Interestingly, both genetic (i.e. p75NFkB mutant) and pharmacological (i.e. DAPT) manipulations allowed p75NTR to induce cell death in CGNs, indicating that the receptor is indeed capable of coupling to cell death pathways in these cells. The fact that this apoptotic response could be blocked by JNK‐IN‐8 indicates that JNK activity contributes to CGN apoptosis, as previously shown for HCNs (Friedman, 2000). We suggest that the ability of p75NTR to induce cell death in CGNs in response to NGF is normally suppressed or masked by concurrent activation of NF‐κB signaling, which has pro‐survival effects in these neurons. As NGF was able to induce JNK phosphorylation in CGNs, NF‐κB signaling might intercept the pro‐apoptotic pathway downstream of JNK in these neurons.

Following the discovery of the proteolytic processing of p75NTR (Jung et al., 2003; Kanning et al., 2003), subsequent studies have attempted to elucidate its functional significance and regulation. It is now widely accepted that both endogenous as well as overexpressed p75NTR undergoes proteolytic cleavage by α‐ and γ‐secretases constitutively in cells, indicating that this process is part of the normal lifecycle of the receptor. Proteolytic cleavage is greatly enhanced by PMA, which activates α‐secretases through PKC (Jung et al., 2003; Kanning et al., 2003). There is less consensus, however, as to whether proteolytic cleavage can also be regulated by ligand binding and other agents. The majority of studies have reported that neurotrophin binding to p75NTR does not have a direct effect on the proteolytic processing of the receptor (Ceni et al., 2010; Jung et al., 2003; Kanning et al., 2003; Sykes et al., 2012; Urra et al., 2007). In contrast, Carter and colleagues reported induction of p75NTR cleavage by brain‐derived neurotrophic factor (BDNF) in sympathetic neurons isolated from the rat superior cervical ganglion (Kenchappa et al., 2006; Kenchappa et al., 2010). In our own experiments, we have not been able to detect significant changes in the proteolytic cleavage of p75NTR in either HCNs or CGNs following NGF treatment (data not shown). Other studies have indicated that several other stimuli can influence the proteolytic processing of p75NTR, including interaction with sortilin (Skeldal et al., 2012), ubiquitylation and palmitoylation (Powell et al., 2009; Underwood et al., 2008), activation of Trk receptors (Ceni et al., 2010; Kanning et al., 2003; Urra et al., 2007), myelin‐derived ligands (Domeniconi et al., 2005), β‐amyloid peptide (Sotthibundhu et al., 2008) and oxidative stress (Kraemer et al., 2014; Le Moan et al., 2011). Aside from its regulation, most studies are in agreement that proteolytic cleavage can affect p75NTR‐mediated signaling and biological activities. Based primarily on pharmacological inhibition, these studies have, by and large, reported detrimental effects on p75NTR function following blockade of cleavage, either by α‐ or γ‐secretases. In most cases, interference with either α‐ or γ‐cleavage was reported to have similar consequences on receptor activity, which has been taken as evidence for the functional importance of the ICD fragment.

In our present study, we find that proteolytic processing of p75NTR is not per se required for activation of cell death or NF‐κB pathways in HCNs and CGNs following stimulation with NGF. This conclusion was based on both pharmacological and genetic inhibition of p75NTR cleavage. Although TAPI caused some attenuation of NGF‐induced death of HCNs, these cells remained responsive to NGF. A similar attenuating effect, without complete inhibition, was also reported by Friedman and colleagues (Volosin et al., 2008). This could be due to non‐specific effects of TAPI on other cellular targets, as we could not detect any decrease in the activity of the N‐glyco mutant, which does not undergo proteolytic processing. In CGNs, we found that DAPT blocked activation of NF‐κB in response to NGF. However, this was not a reflection of an overall requirement for receptor cleavage because TAPI, which interrupts both α‐ and γ‐cleavages, had no effect. Based on these findings, we propose that proteolytic cleavage of p75NTR by α‐ and γ‐secretases leading to release of its ICD is not an obligatory step for its bioactivity in either HCNs or CGNs, at least as far as cell death and NF‐κB pathways are concerned. It remains possible that in some circumstances, or in other cell types, receptor cleavage and release of the ICD might play ancillary roles by, for example, amplifying or modulating certain signaling pathways.

Our studies in CGNs revealed an unexpected divergence between the significance of α‐ and γ‐cleavage for p75NTR signaling. Although neither pharmacological nor genetic inhibition of α‐cleavage (which also interrupts γ‐cleavage) had any effect, both DAPT and γsecmut blocked NGF‐mediated activation of NF‐κB signaling and, somewhat paradoxically, allowed induction of cell death. Importantly, NGF‐mediated death of CGNs in the presence of DAPT was prevented by the N‐glyco mutation, indicating that it was not due to non‐specific effects of the compound on other γ‐secretase targets. Taken together, these data indicate that α‐ and γ‐cleavage of p75NTR are not equivalent and can have distinct functional outcomes. Moreover, our results suggest that the CTF, if left uncleaved by γ‐secretase, might negatively affect the ability of the receptor to regulate NF‐κB signaling. Further work will be required to elucidate the mechanisms by which the CTF of p75NTR affects full‐length receptor function.

We found different patterns of p75NTR proteolytic cleavage in HCNs and CGNs, both in vivo and in cell culture. CGNs displayed higher levels of fully processed ICD than HCNs, and this correlated with higher levels of both full‐length and proteolytically activated PS‐1. In a previous study, NGF‐mediated degradation of IκB was found to be compromised in mouse embryo fibroblasts (MEFs) derived from PS‐1‐knockout mice (Powell et al., 2009), which is in agreement with our DAPT and γsecmut results in CGNs. In fact, pharmacological or genetic blockade of p75NTR cleavage by γ‐secretase in these cells phenocopied the functional profile of HCNs, suggesting that differences in proteolytic processing of p75NTR might, in part, underlie the divergent signaling activities of this receptor in the two neuronal types. We propose that cell‐type‐specific differences in intracellular processes, such proteolytic intramembrane cleavage, can skew the activity profiles of p75NTR and other multifunctional receptors to allow different subsets of signaling and biological activities in different cell types.

MATERIALS AND METHODS

Plasmids, antibodies, proteins and chemicals

Full‐length rat p75NTR was expressed from a pCDNA3 vector backbone (Invitrogen). The p75NFkB and p75JNK mutant constructs have been described previously (Charalampopoulos et al., 2012), and correspond to the triple mutant D355A/H359A/E363A and the double mutant D392A/S393A, respectively. N‐glyco (V243N) and γsecmut (V264A) mutations were introduced using QuikChange (Stratagene) and verified by DNA sequencing. Cell surface expression of the mutant constructs was verified by whole‐cell biotinylation and immunoprecipitation experiments. EGFP plasmid was from Clontech. The origins of antibodies were as follows: 9992 anti‐p75NTR (for immunoblotting) from Promega; anti‐cleaved caspase‐3, anti‐IκB and anti‐phospho‐JNK from Cell Signaling; anti‐p65NFkB and anti‐actin from Santa Cruz Biotechnology; anti‐β‐III‐tubulin and anti‐MAP2 from Sigma or Abcam; anti‐PS‐1 from Chemicon; anti‐RIP2 from BD Biosciences. Fluorophore‐conjugated secondary antibodies were from Molecular Probes. NGF was purchased from Alomone Labs and IL‐1 (beta) from R&D. Both were used at 100 ng/ml. The NF‐κB inhibitor JSH‐23 was from Millipore, JNK inhibitor JNK‐IN‐8 was from Millipore, epoxomicin, PMA and DAPT were from Sigma and TAPI‐2 was from Enzo Life Sciences.

Tissue culture and cell transfection

Primary neurons were prepared from wild‐type and p75NTR‐knockout mice (Jackson Labs). Hippocampal neurons (HCNs) were isolated from embryonic day 17.5 mouse embryos. HCNs were maintained in Neurobasal medium supplemented with 2% B27 (Invitrogen), 1 mM glutamine and 50 µg/ml gentamycin (Gibco). Cerebellar granule neurons (CGNs) were isolated from postnatal day 7 (P7) mouse pups. CGNs were maintained in basal medium Eagle (BME) supplemented with 10% fetal calf serum, 25 mM KCl, 1 mM glutamine and 2 mg/ml gentamicin. Transfection was performed after 3 days (HCNs) or 5 days (CGNs) in vitro with Lipofectamine LTX (Invitrogen).

p75NTR cleavage and immunoblotting

PMA was used at 200 nM for 1 h. Epoxomicin was used at 1 µM, TAPI‐2 at 20 µM and DAPT at 2 µM. These compounds have previously been reported to effectively disrupt cleavage of p75NTR in sympathetic neurons (Kenchappa et al., 2006; Kraemer et al., 2014), CGNs (Ceni et al., 2010) and HCNs (Volosin et al., 2008) at concentrations equal to or lower than those used in this study. They were applied 1.5 h prior to PMA as indicated. Immunoblots were developed using the ECL Advance Western blotting detection kit (Life Technologies) and exposed to Kodak X‐Omat AR films. Image analysis and quantification of band intensities was done with ImageQuant (GE Healthcare).

Proximity ligation assay

After 5 days in vitro, CGN cultures were switched to serum‐free medium and 12.5 mM KCl for 2 h prior to treatment. HCNs and CGNs were treated with NGF (100 ng/ml) for 15 or 30 min. Cells were fixed for 20 min in 4% paraformaldehyde (PFA)/4% sucrose, permeabilized for 5 min in ice‐cold methanol, and blocked in 10% normal donkey serum in PBS. Fixed cells were incubated at 4°C overnight with anti‐p75 (1∶300), anti‐RIP2 (1∶100) and anti‐MAP2 (1∶4000) antibodies in PBS supplemented with 3% BSA. The Duolink In Situ Proximity Ligation kit (Sigma) was used as per the manufacturer's instructions with fluorophore‐conjugated secondary antibody to recognize MAP2 (Molecular Probes, 1∶2000) included during the amplification step. MAP2‐positive cells were imaged with an LSM Imager Z2 confocal microscope (Zeiss) to detect PLA puncta, puncta on MAP2‐positive neurons were counted and the number of puncta was normalized to the area of MAP2‐positive cells using ImageJ software.

p65NFkB nuclear translocation

After 5 days in vitro, CGN cultures were switched to serum‐free medium and 12.5 mM KCl for 2 h prior to addition of NGF (100 ng/ml). After 30 min with NGF, cells were fixed for 20 min in 4% PFA, permeabilized for 5 min in ice‐cold methanol and blocked in 10% normal donkey serum. JSH‐23 inhibitor was applied for 24 h. Fixed cells were incubated at 4°C overnight with anti‐p65NFkB (1∶100) and monoclonal anti‐MAP2 (1∶4000) antibodies in PBS supplemented with 3% BSA, followed by incubation with fluorophore‐conjugated secondary antibodies (1∶1500). GFP/MAP2‐positive cells were analyzed with a LSM Imager Z2 confocal microscope (Zeiss) to detect nuclear p65NFkB staining, and normalized to the total number of GFP/MAP2‐positive neurons to estimate the extent of p65NFkB nuclear translocation among transfected neurons.

Quantitative PCR

Total cellular RNA was isolated by using the RNAeasy kit (Qiagen) according to the manufacturer's instructions. Isolated RNA samples were digested with DNase prior to reverse transcription with Superscript II (Invitrogen). Quantitative (Q)‐PCR of cDNA samples was performed on a ABI StepOne Plus instrument (Applied Biosystems) using SYBR Green master mix (Applied Biosystems) and primers as follows: NIAP forward, 5′‐ GGTGAAGAGTCCAGAGAAGATG‐3′; NIAP reverse, 5′‐CTGAGAGTACACGTGGTGATG‐3′; Livin forward, 5′‐ACTAATGAGAAGGGTCCCAAAG‐3′; Livin reverse, 5′‐TGTGCACCTGGAAAGGATAG‐3′. The annealing temperature was 60°C for both templates. Q‐PCR data were normalized using the expression of ribosomal 18 S as indicated previously (Guo et al., 2014).

Cell death assays

NGF (100 ng/ml) was added to cultures after 5 days (HCNs) or 6 days (CGNs) in vitro and kept for an additional 24 h. During this period, CGNs were switched to lower (12.5 mM) KCl and serum‐free medium. TUNEL was assessed using a kit from Roche following the manufacturer's instructions. Activated caspase‐3 was detected by immunocytochemistry. Briefly, cells were washed once with PBS, fixed for 20 min at room temperature with 4% PFA, permeabilized for 10 min at room temperature with PBS plus 0.2% Triton X‐100, and blocked in PBS plus 10% normal donkey serum and 0.2% Triton X‐100. Fixed cells were incubated at 4°C overnight with anti‐cleaved‐caspase‐3 (1∶400) and monoclonal anti‐MAP2 (1∶4000) antibodies, followed by incubation with fluorophore‐conjugated secondary antibodies (Molecular Probes, 1∶2000). GFP/MAP2‐positive cells were analyzed with a LSM Imager Z2 confocal microscope (Zeiss) to detect cleaved caspase‐3, and the data were normalized to the total number of GFP/MAP2‐positive neurons to estimate the extent of cell death among transfected neurons. The results were typically plotted relative to cell death levels under control conditions (e.g. no treatment). Levels of cell death (by either TUNEL assay or caspase‐3 activation) under these conditions varied between 2 and 10% depending on the experiment.

Acknowledgements

We thank Annika Andersson for technical assistance.

Author contributions

A.V., L.K., J.T. and C.K. performed experiments. C.I. designed the research and wrote the paper.

Funding

This work was supported by grants from the European Research Council [grant number 339237‐p75ntr]; Swedish Research Council; Swedish Cancer Society; Knut and Alice Wallenberg Foundation (Wallenberg Scholars Program); National Medical Research Council (NMRC) of Singapore; and the National University of Singapore (NUS). Jason Tann was supported by a fellowship from NUS Graduate School (NGS).

References

References
Beg
AA
,
Baltimore
D
1996
An essential role for NF-κB in preventing TNF-alpha-induced cell death.
Science
274
782
784
Busuttil
V
,
Bottero
V
,
Frelin
C
,
Imbert
V
,
Ricci
J-E
,
Auberger
P
,
Peyron
J-F
2002
Blocking NF-κB activation in Jurkat leukemic T cells converts the survival agent and tumor promoter PMA into an apoptotic effector.
Oncogene
21
3213
3224
Carter
BD
,
Kaltschmidt
C
,
Kaltschmidt
B
,
Offenhäuser
N
,
Böhm-Matthaei
R
,
Baeuerle
PA
,
Barde
Y-A
1996
Selective activation of NF-κ B by nerve growth factor through the neurotrophin receptor p75.
Science
272
542
545
Casademunt
E
,
Carter
BD
,
Benzel
I
,
Frade
JM
,
Dechant
G
,
Barde
YA
1999
The zinc finger protein NRIF interacts with the neurotrophin receptor p75(NTR) and participates in programmed cell death.
EMBO J.
18
6050
6061
Ceni
C
,
Kommaddi
RP
,
Thomas
R
,
Vereker
E
,
Liu
X
,
McPherson
PS
,
Ritter
B
,
Barker
PA
2010
The p75NTR intracellular domain generated by neurotrophin-induced receptor cleavage potentiates Trk signaling.
J. Cell Sci.
123
2299
2307
Charalampopoulos
I
,
Vicario
A
,
Pediaditakis
I
,
Gravanis
A
,
Simi
A
,
Ibáñez
CF
2012
Genetic dissection of neurotrophin signaling through the p75 neurotrophin receptor.
Cell Reports
2
1563
1570
Chittka
A
,
Chao
MV
1999
Identification of a zinc finger protein whose subcellular distribution is regulated by serum and nerve growth factor.
Proc. Natl. Acad. Sci. USA
96
10705
10710
Coulson
EJ
,
May
LM
,
Osborne
SL
,
Reid
K
,
Underwood
CK
,
Meunier
FA
,
Bartlett
PF
,
Sah
P
2008
p75 neurotrophin receptor mediates neuronal cell death by activating GIRK channels through phosphatidylinositol 4,5-bisphosphate.
J. Neurosci.
28
315
324
Dechant
G
,
Barde
YA
2002
The neurotrophin receptor p75(NTR): novel functions and implications for diseases of the nervous system.
Nat. Neurosci.
5
1131
1136
Domeniconi
M
,
Zampieri
N
,
Spencer
T
,
Hilaire
M
,
Mellado
W
,
Chao
MV
,
Filbin
MT
2005
MAG induces regulated intramembrane proteolysis of the p75 neurotrophin receptor to inhibit neurite outgrowth.
Neuron
46
849
855
Friedman
WJ
2000
Neurotrophins induce death of hippocampal neurons via the p75 receptor.
J. Neurosci.
20
6340
6346
Guo
T
,
Marmol
P
,
Moliner
A
,
Björnholm
M
,
Zhang
C
,
Shokat
KM
,
Ibanez
CF
2014
Adipocyte ALK7 links nutrient overload to catecholamine resistance in obesity.
eLife
3
e03245
Jung
K-M
,
Tan
S
,
Landman
N
,
Petrova
K
,
Murray
S
,
Lewis
R
,
Kim
PK
,
Kim
DS
,
Ryu
SH
,
Chao
MV
et al. 
2003
Regulated intramembrane proteolysis of the p75 neurotrophin receptor modulates its association with the TrkA receptor.
J. Biol. Chem.
278
42161
42169
Kanning
KC
,
Hudson
M
,
Amieux
PS
,
Wiley
JC
,
Bothwell
M
,
Schecterson
LC
2003
Proteolytic processing of the p75 neurotrophin receptor and two homologs generates C-terminal fragments with signaling capability.
J. Neurosci.
23
5425
5436
Karin
M
,
Lin
A
2002
NF-κB at the crossroads of life and death.
Nat. Immunol.
3
221
227
Kenchappa
RS
,
Zampieri
N
,
Chao
MV
,
Barker
PA
,
Teng
HK
,
Hempstead
BL
,
Carter
BD
2006
Ligand-dependent cleavage of the P75 neurotrophin receptor is necessary for NRIF nuclear translocation and apoptosis in sympathetic neurons.
Neuron
50
219
232
Kenchappa
RS
,
Tep
C
,
Korade
Z
,
Urra
S
,
Bronfman
FC
,
Yoon
SO
,
Carter
BD
2010
p75 neurotrophin receptor-mediated apoptosis in sympathetic neurons involves a biphasic activation of JNK and up-regulation of tumor necrosis factor-alpha-converting enzyme/ADAM17.
J. Biol. Chem.
285
20358
20368
Khursigara
G
,
Bertin
J
,
Yano
H
,
Moffett
H
,
DiStefano
PS
,
Chao
MV
2001
A prosurvival function for the p75 receptor death domain mediated via the caspase recruitment domain receptor-interacting protein 2.
J. Neurosci.
21
5854
5863
Knowles
JK
,
Rajadas
J
,
Nguyen
T-VV
,
Yang
T
,
LeMieux
MC
,
Vander Griend
L
,
Ishikawa
C
,
Massa
SM
,
Wyss-Coray
T
,
Longo
FM
2009
The p75 neurotrophin receptor promotes amyloid-beta(1-42)-induced neuritic dystrophy in vitro and in vivo.
J. Neurosci.
29
10627
10637
Kraemer
BR
,
Snow
JP
,
Vollbrecht
P
,
Pathak
A
,
Valentine
WM
,
Deutch
AY
,
Carter
BD
2014
A role for the p75 neurotrophin receptor in axonal degeneration and apoptosis induced by oxidative stress.
J. Biol. Chem.
289
21205
21216
Kucharczak
J
,
Simmons
MJ
,
Fan
Y
,
Gélinas
C
2003
To be, or not to be: NF-κB is the answer – role of Rel/NF-κB in the regulation of apoptosis.
Oncogene
22
8961
8982
Le Moan
N
,
Houslay
DM
,
Christian
F
,
Houslay
MD
,
Akassoglou
K
2011
Oxygen-dependent cleavage of the p75 neurotrophin receptor triggers stabilization of HIF-1α.
Mol. Cell
44
476
490
Lee
R
,
Kermani
P
,
Teng
KK
,
Hempstead
BL
2001
Regulation of cell survival by secreted proneurotrophins.
Science
294
1945
1948
Lu
B
,
Pang
PT
,
Woo
NH
2005
The yin and yang of neurotrophin action.
Nat. Rev. Neurosci.
6
603
614
Mattson
MP
,
Goodman
Y
,
Luo
H
,
Fu
W
,
Furukawa
K
1997
Activation of NF-κB protects hippocampal neurons against oxidative stress-induced apoptosis: evidence for induction of manganese superoxide dismutase and suppression of peroxynitrite production and protein tyrosine nitration.
J. Neurosci. Res.
49
681
697
Mi
S
,
Lee
X
,
Shao
Z
,
Thill
G
,
Ji
B
,
Relton
J
,
Levesque
M
,
Allaire
N
,
Perrin
S
,
Sands
B
et al. 
2004
LINGO-1 is a component of the Nogo-66 receptor/p75 signaling complex.
Nat. Neurosci.
7
221
228
Middleton
G
,
Hamanoue
M
,
Enokido
Y
,
Wyatt
S
,
Pennica
D
,
Jaffray
E
,
Hay
RT
,
Davies
AM
2000
Cytokine-induced nuclear factor κ B activation promotes the survival of developing neurons.
J. Cell Biol.
148
325
332
Nykjaer
A
,
Willnow
TE
2012
Sortilin: a receptor to regulate neuronal viability and function.
Trends Neurosci.
35
261
270
Nykjaer
A
,
Lee
R
,
Teng
KK
,
Jansen
P
,
Madsen
P
,
Nielsen
MS
,
Jacobsen
C
,
Kliemannel
M
,
Schwarz
E
,
Willnow
TE
et al. 
2004
Sortilin is essential for proNGF-induced neuronal cell death.
Nature
427
843
848
Park
KJ
,
Grosso
CA
,
Aubert
I
,
Kaplan
DR
,
Miller
FD
2010
p75NTR-dependent, myelin-mediated axonal degeneration regulates neural connectivity in the adult brain.
Nat. Neurosci.
13
559
566
Perini
G
,
Della-Bianca
V
,
Politi
V
,
Della Valle
G
,
Dal-Pra
I
,
Rossi
F
,
Armato
U
2002
Role of p75 neurotrophin receptor in the neurotoxicity by beta-amyloid peptides and synergistic effect of inflammatory cytokines.
J. Exp. Med.
195
907
918
Perkins
ND
2007
Integrating cell-signalling pathways with NF-κB and IKK function.
Nat. Rev. Mol. Cell Biol.
8
49
62
Powell
JC
,
Twomey
C
,
Jain
R
,
McCarthy
JV
2009
Association between Presenilin-1 and TRAF6 modulates regulated intramembrane proteolysis of the p75NTR neurotrophin receptor.
J. Neurochem.
108
216
230
Reichardt
LF
2006
Neurotrophin-regulated signalling pathways.
Philos. Trans. R. Soc. B
361
1545
1564
Roux
PP
,
Barker
PA
2002
Neurotrophin signaling through the p75 neurotrophin receptor.
Prog. Neurobiol.
67
203
233
Salehi
AH
,
Roux
PP
,
Kubu
CJ
,
Zeindler
C
,
Bhakar
A
,
Tannis
LL
,
Verdi
JM
,
Barker
PA
2000
NRAGE, a novel MAGE protein, interacts with the p75 neurotrophin receptor and facilitates nerve growth factor-dependent apoptosis.
Neuron
27
279
288
Shin
H-M
,
Kim
M-H
,
Kim
BH
,
Jung
S-H
,
Kim
YS
,
Park
HJ
,
Hong
JT
,
Min
KR
,
Kim
Y
2004
Inhibitory action of novel aromatic diamine compound on lipopolysaccharide-induced nuclear translocation of NF-κB without affecting IκB degradation.
FEBS Lett.
571
50
54
Skeldal
S
,
Sykes
AM
,
Glerup
S
,
Matusica
D
,
Palstra
N
,
Autio
H
,
Boskovic
Z
,
Madsen
P
,
Castrén
E
,
Nykjaer
A
et al. 
2012
Mapping of the interaction site between sortilin and the p75 neurotrophin receptor reveals a regulatory role for the sortilin intracellular domain in p75 neurotrophin receptor shedding and apoptosis.
J. Biol. Chem.
287
43798
43809
Sotthibundhu
A
,
Sykes
AM
,
Fox
B
,
Underwood
CK
,
Thangnipon
W
,
Coulson
EJ
2008
Beta-amyloid(1-42) induces neuronal death through the p75 neurotrophin receptor.
J. Neurosci.
28
3941
3946
Sykes
AM
,
Palstra
N
,
Abankwa
D
,
Hill
JM
,
Skeldal
S
,
Matusica
D
,
Venkatraman
P
,
Hancock
JF
,
Coulson
EJ
2012
The effects of transmembrane sequence and dimerization on cleavage of the p75 neurotrophin receptor by γ-secretase.
J. Biol. Chem.
287
43810
43824
Tuffereau
C
,
Bénéjean
J
,
Blondel
D
,
Kieffer
B
,
Flamand
A
1998
Low-affinity nerve-growth factor receptor (P75NTR) can serve as a receptor for rabies virus.
EMBO J.
17
7250
7259
Underwood
CK
,
Coulson
EJ
2008
The p75 neurotrophin receptor.
Int. J. Biochem. Cell Biol.
40
1664
1668
Underwood
CK
,
Reid
K
,
May
LM
,
Bartlett
PF
,
Coulson
EJ
2008
Palmitoylation of the C-terminal fragment of p75(NTR) regulates death signaling and is required for subsequent cleavage by gamma-secretase.
Mol. Cell. Neurosci.
37
346
358
Urra
S
,
Escudero
CA
,
Ramos
P
,
Lisbona
F
,
Allende
E
,
Covarrubias
P
,
Parraguez
JI
,
Zampieri
N
,
Chao
MV
,
Annaert
W
et al. 
2007
TrkA receptor activation by nerve growth factor induces shedding of the p75 neurotrophin receptor followed by endosomal gamma-secretase-mediated release of the p75 intracellular domain.
J. Biol. Chem.
282
7606
7615
Vilar
M
,
Murillo-Carretero
M
,
Mira
H
,
Magnusson
K
,
Besset
V
,
Ibáñez
CF
2006
Bex1, a novel interactor of the p75 neurotrophin receptor, links neurotrophin signaling to the cell cycle.
EMBO J.
25
1219
1230
Volosin
M
,
Trotter
C
,
Cragnolini
A
,
Kenchappa
RS
,
Light
M
,
Hempstead
BL
,
Carter
BD
,
Friedman
WJ
2008
Induction of proneurotrophins and activation of p75NTR-mediated apoptosis via neurotrophin receptor-interacting factor in hippocampal neurons after seizures.
J. Neurosci.
28
9870
9879
Wang
CY
,
Mayo
MW
,
Korneluk
RG
,
Goeddel
DV
,
Baldwin
AS
 Jr
1998
NF-κB antiapoptosis: induction of TRAF1 and TRAF2 and c-IAP1 and c-IAP2 to suppress caspase-8 activation.
Science
281
1680
1683
Wang
KC
,
Kim
JA
,
Sivasankaran
R
,
Segal
R
,
He
Z
2002
P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp.
Nature
420
74
78
Wong
ST
,
Henley
JR
,
Kanning
KC
,
Huang
K-H
,
Bothwell
M
,
Poo
M-M
2002
A p75(NTR) and Nogo receptor complex mediates repulsive signaling by myelin-associated glycoprotein.
Nat. Neurosci.
5
1302
1308
Yamashita
T
,
Tohyama
M
2003
The p75 receptor acts as a displacement factor that releases Rho from Rho-GDI.
Nat. Neurosci.
6
461
467
Yamashita
T
,
Tucker
KL
,
Barde
YA
1999
Neurotrophin binding to the p75 receptor modulates Rho activity and axonal outgrowth.
Neuron
24
585
593
Yoon
SO
,
Casaccia-Bonnefil
P
,
Carter
B
,
Chao
MV
1998
Competitive signaling between TrkA and p75 nerve growth factor receptors determines cell survival.
J. Neurosci.
18
3273
3281
Zhang
T
,
Inesta-Vaquera
F
,
Niepel
M
,
Zhang
J
,
Ficarro
SB
,
Machleidt
T
,
Xie
T
,
Marto
JA
,
Kim
N
,
Sim
T
et al. 
2012
Discovery of potent and selective covalent inhibitors of JNK.
Chem. Biol.
19
140
154
Zhang
Y
,
Huang
H
,
Zhou
H
,
Du
T
,
Zeng
L
,
Cao
Y
,
Chen
J
,
Lai
Y
,
Li
J
,
Wang
G
et al. 
2014
Activation of nuclear factor κB pathway and downstream targets survivin and livin by SHARPIN contributes to the progression and metastasis of prostate cancer.
Cancer
120
3208
3218

Competing interests

The authors declare no competing or financial interests.