Summary

In the embryonic zebrafish, skeletal muscle fibres are formed from muscle progenitors in the paraxial mesoderm. The embryonic myotome is mostly constituted of fast-twitch-specific fibres, which are formed from a fast-specific progenitor cell pool. The most lateral fraction of the fast domain in the myotome of zebrafish embryos derives from the Pax7-positive dermomyotome-like cells. In this study, we show that two genes, belonging to the sine oculus class 1 (six1) genes (six1a and six1b), are both essential for the regulation of Pax7+ cell proliferation and, consequently, in their differentiation during the establishment of the zebrafish dermomyotome. In both six1a and six1b morphant embryos, Pax7+ cells are initially formed but fail to proliferate, as detected by reduced levels of the proliferation marker phosphohistone3 and reduced brdU incorporation. In congruence, overexpression of six1a or six1b leads to increased Pax7+ cell number and reduced or alternatively delayed fibre cell differentiation. Bone morphogenetic protein signalling has previously been suggested to inhibit differentiation of Pax7+ cells in the dermomyotome. Here we show that the remaining Pax7+ cells in six1a and six1b morphant embryos also have significantly reduced pSmad1/5/8 levels and propose that this leads to a reduced proliferative activity, which may result in a premature differentiation of Pax7+ cells in the zebrafish dermomyotome. In summary, we show a mechanism for Six1a and Six1b in establishing the Pax7+ cell derived part of the fast muscle and suggest new important roles for Six1 in the regulation of the Pax7+ muscle cell population through pSmad1/5/8 signalling.

Introduction

The formation of muscle cells during zebrafish development depends on the combined function of several signalling pathways. The myotome is derived from the paraxial mesoderm and muscle differentiation is depending on the expression of the myogenic regulatory factors (MRFs), including MyoD, Myf5 and myogenin (reviewed by Bryson-Richardson and Currie, 2008). Initially, the myogenic progenitors have the competence to form both slow and fast fibre cells depending on the signals they receive during their development. Hedgehog signalling induces slow fibre differentiation in the muscle progenitors closest to the notochord known as adaxial cells (Blagden et al., 1997; Du et al., 1997). Fast muscle fibre are formed from non-adaxial myoblasts and will constitute the majority of muscle cells in the zebrafish myotome (Blagden et al., 1997; Devoto et al., 1996). In a subpopulation of cells at the somite anterior border the paired box protein Pax7 can be detected, this region has been referred to as the zebrafish equivalent to the amniote dermomyotome (Devoto et al., 2006; Hollway et al., 2007; Stellabotte et al., 2007), and will give rise to the most laterally positioned fast fibres (Stellabotte et al., 2007). Furthermore, the zebrafish dermomyotome can be divided into two domains, where the central dermomyotome and the peripheral most ventral and dorsal domains of the dermomyotome precursors are suggested to respectively constitute functionally and genetically distinct subpopulations (Windner et al., 2012). The Pax7+ cells have a stem cell like character and part of the Pax7+ cell population has been suggested to remain in an undifferentiated state throughout development and constitute an equivalent to the mammalian muscle satellite cells (Devoto et al., 2006; Hollway et al., 2007). When differentiation of Pax7+ cells is induced, MyoD and subsequently myogenin becomes upregulated (Relaix et al., 2006). The mechanism behind the regulation of differentiation and proliferation within the Pax7+ cell population has however to date not been determined.

The bone morphogenetic protein (BMP) pathway is an important player in zebrafish myogenesis where it defines subdomains within the myotome by counteracting hedgehog signalling from the notochord and floorplate (Dolez et al., 2011; Maurya et al., 2011). BMP receptors signal by phosphorylation of regulatory (R) Smads 1, 5 and 8. The activated R-Smads translocate to the nucleus together with co-Smad4 to regulate BMP target genes (reviewed by Massagué et al., 2005). In mammals BMP signalling has been shown to regulate cell proliferation by activating Smad1/5/8, which can mediate transcriptional regulation and influence cell cycle progression (Pardali and Moustakas, 2007). BMP signalling can influence amniote myogenesis by activating Smad1/5/8 through phosphorylation (Yamamoto et al., 1997) and thereby repress myogenic progenitor differentiation (Amthor et al., 1998; Dahlqvist et al., 2003; Frank et al., 2006). In addition, inhibition of BMP signalling leads to a decreased number of Pax7+ cells during fetal development in chick (Wang et al., 2010), whereas overexpression of BMP leads to increased Pax7+ cell number in zebrafish embryos at 24 hours post fertilization (hpf) (Patterson et al., 2010).

The class of sine oculis (six) 1 and 4 genes have previously been linked to muscle development in several species (Bessarab et al., 2004; Pandur and Moody, 2000; Spitz et al., 1998). Six1 and Six4 are partially redundant in mammals where Six1−/− knock out mice die at birth and show severe muscle hypoplasia, whereas Six1−/− Six4−/− mice completely lack fast muscle (Grifone et al., 2005; Laclef et al., 2003). In zebrafish, there are two six1 genes, named six1a and six1b. Studies have been performed on six1b under the previous name six1a (Bessarab et al., 2008; Lin et al., 2009). In contrast to mammalian Six1, the zebrafish six1b morphant embryos alone show a severe muscle phenotype, in particular in the craniofacial region, where they completely lack fast muscle fibre (Lin et al., 2009). six1b morphants have a reduced expression of several fast muscle markers, such as isoforms of the fast muscle specific myosin heavy chains and a-tropomyosin (tpma) (Bessarab et al., 2008). In addition, Six1b has been shown to be essential for the formation of cranial and pectoral fin muscle (Lin et al., 2009). Six1 in mammals has also been shown to regulate the expression of Pax3 (Grifone et al., 2005), which is expressed together with Pax7 in the majority of the dermomyotomal cells (Relaix et al., 2005), but the specific role of Six1 in the Pax7+ cells in zebrafish has not been determined. The function of zebrafish Six1a (previously called Six1b) has to date not been studied and the potential role of Six1a and Six1b during Pax7+ cell formation, proliferation and differentiation has not been established.

In this study, we show that Six1a and Six1b both are important for proper formation and growth of fast specific skeletal muscle. We also show that Six1a and Six1b are essential for regulating proliferation and consequently the differentiation of Pax7+ cells in the dermomyotome. Finally, we propose a mechanism where Six1 is acting via phosphorylated Smad1/5/8 in Pax7+ cells in the zebrafish peripheral dermomyotome.

Results

Zebrafish Six1 influences fast fibre formation

Skeletal fast specific fibres are formed from the non-adaxial cells in the paraxial mesoderm and genes encoding fast specific components of the sarcomere can be detected in these cells after the 8 somite stage (8 ss) (Burguière et al., 2011). Similarly, expression of six1b can be detected in the same region starting at the 6 ss (Bessarab et al., 2008). The expression of six1a has previously not been studied. We examined the expression patterns of both six1a and six1b in the myotome of zebrafish embryos during the period of fast fibre differentiation and compared them with the expression of the slow myosin heavy chain 1 (smyhc1) to identify adaxial versus non-adaxial muscle progenitors. Expression of both six1a and six1b was detected in the fast muscle progenitors but was absent in the adaxial cells and in the adaxially derived slow fibres (Fig. 1). Interestingly, the expression patterns of six1a and six1b differed within the fast progenitors, where six1a was downregulated in the anteriormost somites and conversely six1b was expressed more intensely (Fig. 1A,B). six1b was also expressed in the presomitic mesoderm and the newly formed somites at 12 ss (Fig. 1B). These expression patterns remained through the 18 ss, but were less pronounced at 24 hpf, where both six1a and six1b were widespread throughout the whole fast domain within the trunk (Fig. 1). At 12 ss, six1a was expressed in the rostral and medial part of the somite (Fig. 1A). six1b was uniformly expressed in the most mature somites, at 12 ss (Fig. 1B), indicating that the expression of both genes was, at least partially, corresponding to the Pax7+ dermomyotome cells (Stellabotte et al., 2007). However, in newly formed somites expression of six1b was restricted to the caudal part of the somite (Fig. 1B), which is consistent to what Bessarab et al. (Bessarab et al., 2008) found at 6 and 9 ss.

Fig. 1.

six1a and six1b are expressed in fast muscle progenitors. (A,B) Whole mount in situ hybridization showing non-overlapping expression of (A) six1a (blue) and smyhc1 (red) and of (B) six1b (blue) and smyhc1 (red), in 12-ss, 18-ss and 24-hpf embryos. Cross-sections are shown below or as an inset; lines indicate the levels of cross-sections. Brackets at 12 ss indicate areas with strongest six1 expression. Dashed lines at 12 ss indicate somitic borders, black arrowheads indicate expression in the rostral part of the somite and white arrowheads indicate expression in the caudal part of the somite. Scale bars: 100 µm.

Fig. 1.

six1a and six1b are expressed in fast muscle progenitors. (A,B) Whole mount in situ hybridization showing non-overlapping expression of (A) six1a (blue) and smyhc1 (red) and of (B) six1b (blue) and smyhc1 (red), in 12-ss, 18-ss and 24-hpf embryos. Cross-sections are shown below or as an inset; lines indicate the levels of cross-sections. Brackets at 12 ss indicate areas with strongest six1 expression. Dashed lines at 12 ss indicate somitic borders, black arrowheads indicate expression in the rostral part of the somite and white arrowheads indicate expression in the caudal part of the somite. Scale bars: 100 µm.

In order to inhibit Six1a and Six1b during skeletal muscle development, we used morpholinos targeting six1a and six1b respectively, both individually and in combination. We used established morpholinos targeting six1b (Bessarab et al., 2008) and designed a new morpholino targeting the six1a exon1/intron1 splice junction. The six1a splice morpholino introduced an early splice site in the six1a transcript and led to an out of frame translation product with a premature translational stop (supplementary material Fig. S1). The efficiency of the six1b morpholino was tested by injection into a transgenic line, six1b:GFP, where part of the six1b promoter drives the expression of GFP (described below). The morpholino is designed to block translational start and thus inhibits translation of GFP in the transgenic line (supplementary material Fig. S1). Knock down of Six1a and Six1b respectively both resulted in embryos with changes in the trunk morphology that indicated impaired skeletal muscle development (supplementary material Fig. S2). In addition to having an imperative effect on cranial muscle formation as previously described for Six1b (Lin et al., 2009), knock down of both Six1a and Six1b reduced the fast muscle domain significantly (Fig. 2A,B). This effect was seen both for Six1a and Six1b respectively, but was found most significant in embryos injected with a combination of six1a and six1b morpholinos (Fig. 2). An indication of a reduction of the fast domain was first observed after 24 hpf, but was found more pronounced after 3 days post fertilization (dpf), where the fast domain was significantly reduced in the morpholino treated embryos (Fig. 2B). Co-injections using p53 morpholinos together with the six1a and six1b morpholinos did not significantly change the six1 morpholino induced phenotypes (Fig. 2B,C). A reduction of cell number in the fast domain was less evident, but still significant in six1a/six1b morpholino treated embryos after 3 dpf (Fig. 2C). However, the number of nuclei per fibre was not affected by the morpholino treatment (data not shown). Neither was the number of slow fibres in the Six1 morphants at 24 hpf, where control embryos had 55.7 slow fibres/somite, six1a and six1b morphants both had 56.0 slow fibres/somite and embryos injected with six1a and six1b morpholino in combination had 55.6 fibres/somite (Fig. 2D). Nor did the six1 impairment significantly affect slow fibres in embryos at 3 dpf; control embryos had 61.8 slow fibres/somite, embryos injected with six1a morpholino had 60.4 slow fibres/somite, six1b morphants had 58.6 slow fibres/somite and embryos injected with six1a and six1b morpholino in combination had 61.0 fibres/somite (Fig. 2D).

Fig. 2.

six1 morphants have a reduced fast muscle area. (A) Ventral and lateral views of head (left two columns) and lateral view and cross-section of the trunk (right two columns) of 3-dpf tg(mylz2:GFP)i135 embryos uninjected and injected with six1a and six1b morpholinos alone or in combination. Cross-sections are stained with F310. (B) F310+ cross-section area of 24-hpf and 3-dpf embryos; the area of uninjected control embryos is set as 100%. Compared with control embryos at 24 hpf (n = 5), six1a morphants have an area of 94.0% (n = 5), six1b morphants 88.4% (n = 5) and six1a and six1b double morphants 92.8% (n = 5). In 3-dpf embryos compared with control embryos, (n = 5) six1a morphants have an area of 84.9% (n = 5), six1b morphants 55.0% (n = 5) and six1a/six1b double morphants 37.2% (n = 6). Compared with uninjected control embryos (n = 4) set as 100%, six1a/p53 morphants have an F310+ cross-section area of 79.7% (n = 4), six1b/p53 morphant embryos 62.1% (n = 5) and six1a/six1b/p53 triple morphants have an area of 55.6% (n = 4). (C) Average number of DAPI-stained nuclei per F310+ (fast muscle specific) cross-section area of 3-dpf embryos. Uninjected control embryos have an average of 151.3 DAPI-stained nuclei per F310+ cross-section area (n = 5), six1a morphants have 156.0 (n = 5), six1b morphants 135.2 (n = 6) and six1a/six1b double morphants 119.5 (n = 7). 3-dpf six1a/p53 morphants have an average number of 156 DAPI-stained nuclei per F310+ cross-section area (n = 4), six1b/p53 morphants 152.2 (n = 5), six1a/six1b/p53 triple morphants 119.3 (n = 4) and control embryos have 159.5 (n = 4). (D) Number of slow fibres per somite in 24-hpf and 3-dpf embryos. fb, fin bud; hh, hyohyoideus; ih, interhyoideus; ima, intermandibular anterior; imp, intermandibular posterior; om, ocular muscles; sh, sternohyoideus; som, somites. Cross-sections were made at somite number 10 for 24-hpf embryos, and at somite number 8 for 3-dpf embryos. *P<0.05, **P<0.01, ***P<0.001. Scale bars: 50 µm.

Fig. 2.

six1 morphants have a reduced fast muscle area. (A) Ventral and lateral views of head (left two columns) and lateral view and cross-section of the trunk (right two columns) of 3-dpf tg(mylz2:GFP)i135 embryos uninjected and injected with six1a and six1b morpholinos alone or in combination. Cross-sections are stained with F310. (B) F310+ cross-section area of 24-hpf and 3-dpf embryos; the area of uninjected control embryos is set as 100%. Compared with control embryos at 24 hpf (n = 5), six1a morphants have an area of 94.0% (n = 5), six1b morphants 88.4% (n = 5) and six1a and six1b double morphants 92.8% (n = 5). In 3-dpf embryos compared with control embryos, (n = 5) six1a morphants have an area of 84.9% (n = 5), six1b morphants 55.0% (n = 5) and six1a/six1b double morphants 37.2% (n = 6). Compared with uninjected control embryos (n = 4) set as 100%, six1a/p53 morphants have an F310+ cross-section area of 79.7% (n = 4), six1b/p53 morphant embryos 62.1% (n = 5) and six1a/six1b/p53 triple morphants have an area of 55.6% (n = 4). (C) Average number of DAPI-stained nuclei per F310+ (fast muscle specific) cross-section area of 3-dpf embryos. Uninjected control embryos have an average of 151.3 DAPI-stained nuclei per F310+ cross-section area (n = 5), six1a morphants have 156.0 (n = 5), six1b morphants 135.2 (n = 6) and six1a/six1b double morphants 119.5 (n = 7). 3-dpf six1a/p53 morphants have an average number of 156 DAPI-stained nuclei per F310+ cross-section area (n = 4), six1b/p53 morphants 152.2 (n = 5), six1a/six1b/p53 triple morphants 119.3 (n = 4) and control embryos have 159.5 (n = 4). (D) Number of slow fibres per somite in 24-hpf and 3-dpf embryos. fb, fin bud; hh, hyohyoideus; ih, interhyoideus; ima, intermandibular anterior; imp, intermandibular posterior; om, ocular muscles; sh, sternohyoideus; som, somites. Cross-sections were made at somite number 10 for 24-hpf embryos, and at somite number 8 for 3-dpf embryos. *P<0.05, **P<0.01, ***P<0.001. Scale bars: 50 µm.

Six1 inhibits differentiation of Pax7+ cells in the dermomyotome

To further study the expression of six1b, we generated a transgenic line, tg(six1b:GFP)J1 where 6.5 kb upstream the six1b translation start drives the expression of GFP. At 12 ss, 15 ss and 18 ss six1b:GFP expression was found strongest in the most anterior somites where the expression partly overlapped with the expression of Pax7 (Fig. 3A). By comparing six1b:GFP expression with six1b mRNA expression at 24 hpf, we found similar expression patterns in the myotome, the lateral line placode and the cranial placodes (Fig. 3B), confirming that the transgenic line phenocopied six1b expression. At 26 hpf, six1b:GFP was expressed in the majority of the dermomyotomal Pax7+ cells as well as in fast muscle fibres (Fig. 3C). At later stages, 48 hpf and 3 dpf, expression of six1b:GFP was found in the otic vesicle, olfactory vesicle, adenohypophyseal placode, lateral line neuromasts and pectoral fins, as well as in the fast muscle fibres (Fig. 3D,E).

Fig. 3.

Expression pattern of six1b:GFPJ1. (A) Expression of Pax7 (red) and GFP (green) in cross-sections at 12 and 15 ss and lateral view of somite number 2–3 at 12, 15 and 18 ss. (B) GFP expression of six1b:GFP at 24 hpf phenocopying mRNA expression of six1b. (C) Cross-section at somite number 10 and lateral view of six1b:GFP (green) stained with Pax7 (red); arrowheads indicate coexpression. (D,E) GFP expression in lateral view of whole embryo; dorsal (top) and ventral (bottom) view of head; and cross-section at somite number 8 and enlargement of trunk of six1b:GFP embryos at 48 hpf (D) and 4 dpf (E). AP, adenohypophyseal placode; LLN, lateral line neuromasts; LLP, lateral line placode; NC, notochord; NT, neural tube; Olf.P, olfactory placode; Olf.V, olfactory vesicle; OV, otic vesicle; SH, sternohyoideus; Som, somites; PF, pectoral fin. Scale bars: 100 µm.

Fig. 3.

Expression pattern of six1b:GFPJ1. (A) Expression of Pax7 (red) and GFP (green) in cross-sections at 12 and 15 ss and lateral view of somite number 2–3 at 12, 15 and 18 ss. (B) GFP expression of six1b:GFP at 24 hpf phenocopying mRNA expression of six1b. (C) Cross-section at somite number 10 and lateral view of six1b:GFP (green) stained with Pax7 (red); arrowheads indicate coexpression. (D,E) GFP expression in lateral view of whole embryo; dorsal (top) and ventral (bottom) view of head; and cross-section at somite number 8 and enlargement of trunk of six1b:GFP embryos at 48 hpf (D) and 4 dpf (E). AP, adenohypophyseal placode; LLN, lateral line neuromasts; LLP, lateral line placode; NC, notochord; NT, neural tube; Olf.P, olfactory placode; Olf.V, olfactory vesicle; OV, otic vesicle; SH, sternohyoideus; Som, somites; PF, pectoral fin. Scale bars: 100 µm.

Muscle differentiation requires the expression of myoD and myf5 (Hinits et al., 2009; Tapscott, 2005; Tapscott et al., 1988). Both slow and fast fibres are significantly reduced or fail to form in embryos where MyoD and Myf5 are knocked down following morpholino treatment (Fig. 4A). Interestingly, we found that the mRNA expression of six1b remained in myoD/myf5 morphant embryos. In cross-sections of 24-hpf myoD/myf5 morphant embryos, the six1b expression was detected in cells surrounding the residual slow and fast fibres (Fig. 4A). The six1b expression domain coincided with the location of the Pax7+ muscle progenitor cells, which was increased in number in the myod/myf5 morphant embryos (Fig. 4A) The six1b:GFP was also expressed in the Pax7+ cells in wt and in the myod/myf5 morphant embryos (Fig. 4B), confirming our previous observations of overlapping Pax7 and six1 expression.

Fig. 4.

six1b expression in Pax7+ cells is independent of MyoD and Myf5. (A) Cross-section of uninjected control embryos and myoD/myf5 morphant embryos at 24 hpf showing mRNA expression of six1b (red) together with slow muscle marker F59 (green) or fast muscle marker F310 (green) and of Pax7 alone. six1b expression in the Pax7+ domain remains in MyoD/Myf5 double morphants. (B) Cross-section of control and myoD/myf5 morphant six1b:GFP embryos at 24 hpf showing expression of Pax7 (red) together with six1b:GFP (green). six1b:GFP and Pax7 expression domains coincide in the myoD/myf5 morphants. Cross-sections were made at somite number 10. Scale bars: 50 µm.

Fig. 4.

six1b expression in Pax7+ cells is independent of MyoD and Myf5. (A) Cross-section of uninjected control embryos and myoD/myf5 morphant embryos at 24 hpf showing mRNA expression of six1b (red) together with slow muscle marker F59 (green) or fast muscle marker F310 (green) and of Pax7 alone. six1b expression in the Pax7+ domain remains in MyoD/Myf5 double morphants. (B) Cross-section of control and myoD/myf5 morphant six1b:GFP embryos at 24 hpf showing expression of Pax7 (red) together with six1b:GFP (green). six1b:GFP and Pax7 expression domains coincide in the myoD/myf5 morphants. Cross-sections were made at somite number 10. Scale bars: 50 µm.

In order to examine a putative function of Six1a and Six1b in the formation of Pax7+ cells, we analysed the expression of Pax7 in six1a and six1b morphant embryos. At 24 hpf the average number of Pax7+ cells was significantly reduced both in six1a and six1b morphants as well as in six1a and six1b combined morphant embryos (Fig. 5A,B). The number of Pax7+ cells was found to be 46.0 per somite in control embryos, six1a morphants had 32.8 Pax7+ cells per somite, in six1b morphants the number of Pax7+ cells was reduced to 27.2 per somite and the six1a/six1b double morphant embryos had 27.1 Pax7+ cells per somite (Fig. 5A,B). To examine if the reduced number of Pax7+ cells was due to a lack of initial cell formation or inhibited cell proliferation we analysed the number of phosphorylated histone H3 positive (pH3+) cells in six1a and b morphants at 24 hpf and found that the number of pH3+ cells was reduced from 6.02 per somite in the control to 3.78 in the six1a morphants, 2.55 in the six1b morphants and 2.30 in the six1a/six1b double morphant embryos (Fig. 5C,D), indicating a lowered cell proliferation following Six1a and/or Six1b inhibition. To verify that the proliferation of Pax7+ cells was affected, embryos were subjected to brdU treatment, which was initiated at 15 ss and was terminated at 24 hpf. Thereafter, the brdU incorporation specifically in Pax7+ cells was analysed. In the control embryos, 67.5% (23.7/35.1) of the Pax7+ cells were brdU+ (Fig. 5E,F). The proportion of cells double labelled with Pax7 and brdU decreased significantly to 32.5% in six1a morphants, 26.3% in six1b morphants and 14.8% in six1a/six1b double morphants (Fig. 5E,F), which indicates that the proliferation of Pax7+ cells is significantly inhibited in the six1 morphant embryos.

Fig. 5.

six1a and six1b morphants have a reduced proliferation of Pax7+ cells. (A) Pax7 immunohistochemistry on 24-hpf embryos uninjected and injected with six1a and six1b morpholinos alone or in combination. (B) The average number of Pax7+ cells/somite in 24-hpf embryos injected with six1a (n = 40) and six1b (n = 37) morpholinos alone or in combination (n = 41) is reduced compared with uninjected control embryos (n = 28). Somite number 10–12 was counted. (C) pH3 immunohistochemistry on 24-hpf embryos uninjected and injected with six1a and six1b morpholinos alone or in combination. (D) Average number of pH3+ cells/somite in 24-hpf embryos injected with six1a (n = 40) and six1b (n = 40) morpholinos alone or in combination (n = 50) is reduced compared with uninjected control embryos (n = 50). Somite number 10–18 was counted. (E) Expression of Pax7 (red) in control embryos and in six1a, six1b and six1a/six1b morphant embryos treated with brdU (green) from 15ss until fixation at 24 hpf. White box indicates area of enlargements shown below; white arrowheads indicate Pax7+/brdU+ cells. (F) Average number of Pax7+/brdU+ cells/somite is reduced and the average number of Pax7+/brdU cells/somite is increased in 24-hpf embryos injected with six1a (n = 20) and six1b (n = 22) morpholinos alone or in combination (n = 29) compared with uninjected control embryos (n = 19). Somite number 10–12 was counted. (G) Expression of Pax7 (red), brdU (blue) and GFP (green) in six1b:GFP embryos treated with brdU from 20 ss until fixation at 24 hpf (n = 11). Arrowheads indicate cells positive for Pax7 only and asterisks indicate cells positive for Pax7, brdU and GFP. Cell counting is presented in H. (H) 20.6 of the Pax7+ cells/somite without GFP have brdU incorporated, whereas 3.6 show no brdU incorporation (arrowheads in G). 17.2 of the Pax7+ cells/somite that are positive for six1b:GFP have incorporated brdU (asterisks in G); however, there are no (0.0) six1b:GFP+ Pax7 cells without brdU incorporated (n = 379). Somite number 10–12 was counted. *P<0.05, **P<0.01, ***P<0.001. Scale bars: 50 µm and 25 µm for enlargements.

Fig. 5.

six1a and six1b morphants have a reduced proliferation of Pax7+ cells. (A) Pax7 immunohistochemistry on 24-hpf embryos uninjected and injected with six1a and six1b morpholinos alone or in combination. (B) The average number of Pax7+ cells/somite in 24-hpf embryos injected with six1a (n = 40) and six1b (n = 37) morpholinos alone or in combination (n = 41) is reduced compared with uninjected control embryos (n = 28). Somite number 10–12 was counted. (C) pH3 immunohistochemistry on 24-hpf embryos uninjected and injected with six1a and six1b morpholinos alone or in combination. (D) Average number of pH3+ cells/somite in 24-hpf embryos injected with six1a (n = 40) and six1b (n = 40) morpholinos alone or in combination (n = 50) is reduced compared with uninjected control embryos (n = 50). Somite number 10–18 was counted. (E) Expression of Pax7 (red) in control embryos and in six1a, six1b and six1a/six1b morphant embryos treated with brdU (green) from 15ss until fixation at 24 hpf. White box indicates area of enlargements shown below; white arrowheads indicate Pax7+/brdU+ cells. (F) Average number of Pax7+/brdU+ cells/somite is reduced and the average number of Pax7+/brdU cells/somite is increased in 24-hpf embryos injected with six1a (n = 20) and six1b (n = 22) morpholinos alone or in combination (n = 29) compared with uninjected control embryos (n = 19). Somite number 10–12 was counted. (G) Expression of Pax7 (red), brdU (blue) and GFP (green) in six1b:GFP embryos treated with brdU from 20 ss until fixation at 24 hpf (n = 11). Arrowheads indicate cells positive for Pax7 only and asterisks indicate cells positive for Pax7, brdU and GFP. Cell counting is presented in H. (H) 20.6 of the Pax7+ cells/somite without GFP have brdU incorporated, whereas 3.6 show no brdU incorporation (arrowheads in G). 17.2 of the Pax7+ cells/somite that are positive for six1b:GFP have incorporated brdU (asterisks in G); however, there are no (0.0) six1b:GFP+ Pax7 cells without brdU incorporated (n = 379). Somite number 10–12 was counted. *P<0.05, **P<0.01, ***P<0.001. Scale bars: 50 µm and 25 µm for enlargements.

Based on our previous observations that six1b:GFP expression was not found in all dermomyotomal Pax7+ cells (Fig. 3), and that the six1 morphants had an inhibited proliferation of Pax7+ cells (Fig. 5A–F) we explored if six1 is expressed specifically in the proliferating Pax7+ cells as opposed to the subset of Pax7+ cells that are non-proliferative. six1b:GFP embryos were incubated in brdU from 20 ss to 24 hpf, whereafter cells positive for Pax7, BrdU and GFP were analysed (Fig. 5G,H). We found that an average of 20.6 cells per somite were brdU+ and 3.6 lacked brdU among the six1b:GFP negative Pax7+ cells. However, among the six1b:GFP positive Pax7+ cells an average of 17.2 cells per somite were brdU+, whereas none (0.0) of the six1b:GFP positive Pax7+ cells (n = 379) were brdU negative, indicating that all Pax7+ cells expressing six1b:GFP had entered the cell cycle (Fig. 5G,H), thus suggesting that six1 is keeping the Pax7+ cells in a proliferative state.

If six1 is promoting Pax7+ cell proliferation, can overexpression of six1 increase the proliferative activity of the Pax7+ cells? To investigate this we injected six1a and six1b mRNA into one-cell stage embryos and analysed the number of Pax7+ cells at 24 hpf (Fig. 6A). Overexpression of six1a resulted in 47.4 Pax7+ cells per somite and embryos injected with six1b RNA had 49.2 Pax7+ cells per somite, which is a moderate but still significant increase compared with control embryos that had 42.7 Pax7+ cells per somite. These results support our hypothesis that six1 is involved in keeping the Pax7+ cells in a proliferative state.

Fig. 6.

Overexpression of six1a and six1b promotes Pax7+ cell proliferation and inhibits fibre differentiation. (A) Average number of Pax7+ cells per somite in control embryos (n = 18) and embryos injected with six1a (n = 19) or six1b RNA (n = 17) at 24 hpf. Control embryos have 42.7 Pax7+ cells/somite whereas the number is increased to 47.4 and 49.2 Pax7+ cells/somite after overexpressing six1a and six1b RNA, respectively. (B) Proportions of GFP+ fibres and GFP+ non-differentiated myotomal cells in 18-ss embryos after injecting a heat-shock-inducible construct driving the expression of gfp, either alone or together with six1a or six1b coding sequences, induced at 70% epiboly. The control GFP construct has 42.7% non-differentiated myotomal cells and 57.3% fibres (n = 6); induction of six1a expression results in 89.0% non-differentiated myotomal cells and only 11.0% fibres (n = 4); six1b overexpression gives a proportion of 95.6% non-differentiated myotomal cells and 4.4% fibres (n = 4). Somite number 8–10 was counted. (C) Expression of GFP (green) and Pax7 (red) in 18-ss embryos after inducing expression of gfp alone or together with six1a or six1b coding sequences at 70% epiboly. Yellow arrowheads indicate GFP+/Pax7+ cells. (D) Expression of GFP and tdTomato at 16 ss in fast-fibre-specific myosin light chain 2:GFP, tg(mylz2:GFP)i135 embryos injected with a heat-shock-inducible construct driving the expression of tdtomato alone or together with six1a or six1b coding sequences, induced at 70% epiboly. Overexpressed six1a or six1b both resulted in a decreased occurrence of fibre-like morphology in the induced cells. Yellow arrowheads indicate GFP+/tdTomato+ fibres, white arrowheads indicate fibres only expressing tdTomato. *P<0.05, ***P<0.001. Scale bars: 50 µm.

Fig. 6.

Overexpression of six1a and six1b promotes Pax7+ cell proliferation and inhibits fibre differentiation. (A) Average number of Pax7+ cells per somite in control embryos (n = 18) and embryos injected with six1a (n = 19) or six1b RNA (n = 17) at 24 hpf. Control embryos have 42.7 Pax7+ cells/somite whereas the number is increased to 47.4 and 49.2 Pax7+ cells/somite after overexpressing six1a and six1b RNA, respectively. (B) Proportions of GFP+ fibres and GFP+ non-differentiated myotomal cells in 18-ss embryos after injecting a heat-shock-inducible construct driving the expression of gfp, either alone or together with six1a or six1b coding sequences, induced at 70% epiboly. The control GFP construct has 42.7% non-differentiated myotomal cells and 57.3% fibres (n = 6); induction of six1a expression results in 89.0% non-differentiated myotomal cells and only 11.0% fibres (n = 4); six1b overexpression gives a proportion of 95.6% non-differentiated myotomal cells and 4.4% fibres (n = 4). Somite number 8–10 was counted. (C) Expression of GFP (green) and Pax7 (red) in 18-ss embryos after inducing expression of gfp alone or together with six1a or six1b coding sequences at 70% epiboly. Yellow arrowheads indicate GFP+/Pax7+ cells. (D) Expression of GFP and tdTomato at 16 ss in fast-fibre-specific myosin light chain 2:GFP, tg(mylz2:GFP)i135 embryos injected with a heat-shock-inducible construct driving the expression of tdtomato alone or together with six1a or six1b coding sequences, induced at 70% epiboly. Overexpressed six1a or six1b both resulted in a decreased occurrence of fibre-like morphology in the induced cells. Yellow arrowheads indicate GFP+/tdTomato+ fibres, white arrowheads indicate fibres only expressing tdTomato. *P<0.05, ***P<0.001. Scale bars: 50 µm.

To further analyse the effects of six1a and six1b overexpression in muscle progenitors during myogenesis, we used a heat-shock inducible construct that drives the expression of six1a or six1b together with a reporter gene upon activation. One-cell stage embryos were microinjected either with an empty control vector expressing only gfp after heat-shocked, or with vectors also bi-directionally driving six1a or six1b expression. At 18 ss the proportions of GFP+ fibres versus GFP+ non-differentiated myotomal cells were quantified (Fig. 6B). Embryos injected with the construct driving GFP expression alone had 57.3% GFP+ fibres and 42.7% non-differentiated GFP+ myotomal cells. When expression of six1a was induced together with GFP, the proportion of GFP+ fibres dramatically decreased to 11% and upon six1b overexpression, only 4.4% of the GFP+ cells had adopted a fibre-like morphology (Fig. 6B,C) indicating that the overexpression of six1a or six1b resulted in an inhibition or delay of fibre differentiation. To further examine the effects of six1 overexpression on fibre differentiation, newly fertilized mylz2:GFP embryos, that express GFP specifically in differentiated fast fibres, were injected with the same heat shock constructs but with tdtomato (tdtom) as the reporter gene. These embryos were analysed at 16 ss where the mylz2:GFP reporter has started to mark newly differentiated fast muscle cells (Fig. 6D). The control construct expressed tdTom in numerous muscle cells that had adopted a fibre-like morphology and several which also expressed the mylz2:GFP (Fig. 6D). In contrast, tdtom+/six1a+ or tdtom+/six1b+ cells rarely had a fibre-like morphology (Fig. 6D), Taken together, these results further strengthens our hypothesis that the role of six1 expression in Pax7+ cells is to keep them proliferating and consequently inhibiting the Pax7+ cells from forming muscle fibres.

Six1 regulates pSmad1/5/8 in Pax7+ cells

Proliferation of Pax7+ cells has previously been linked to BMP signalling, where overexpression of Bmp2b led to an increased number of Pax7+ cells via elevated levels of phosphorylated Smad (pSmad) in the zebrafish embryonic dermomyotome (Patterson et al., 2010). To examine if Six1a and Six1b act on proliferation through the pSmad pathway, we analysed pSmad1/5/8 in six1a and six1b morphant embryos specifically in the Pax7+ cells. We found that 9.0 out of 46.7 Pax7+ cells (19.3%) were pSmad1/5/8+ in uninjected control embryos at 24 hpf (Fig. 7A,B). Most of these cells were situated in the most dorsal and ventral regions, the peripheral dermomyotome, but were excluded from the central dermomyotome (Fig. 7A,C). As described above, the number of Pax7+ cells is significantly decreased in all types of six1 morphant embryos at 24 hpf (Fig. 5A,B; Fig. 7B). In addition, the pSmad1/5/8+ proportion of the Pax7+ cells was significantly decreased to 8.9% (2.5/28.2) in six1a morphants, 7.2% (2.3/31.9) in six1b morphants and 6.1% (1.8/29.6) in six1a/six1b double morphants (Fig. 7B). Interestingly, while pSmad1/5/8 was significantly reduced in Pax7+ cells, we found that the pSmad1/5/8 expression in the Pax7 negative myotomal cells remained unaffected in the six1 morphants (Fig. 7C), indicating that the Six1 effect on pSmad1/5/8 is constrained to cells in the dermomyotome.

Fig. 7.

Six1 is required for pSmad1/5/8 expression in Pax7+ cells in the peripheral dermomyotome and reduced levels of pSmad1/5/8 decrease the number of Pax7+ cells. (A) Expression of Pax7 (red) and pSmad1/5/8 (green) in 24-hpf embryos uninjected and injected with six1a and six1b morpholinos alone or in combination. (B) Average number of Pax7+/pSmad1/5/8 and Pax7+/pSmad1/5/8+ cells per somite in control embryos (n = 6) and in six1a (n = 14), six1b (n = 11) and six1a and six1b double morphants (n = 13). Somite number 10–12 was counted. (C) Cross-sections of 24-hpf control embryos and six1a, six1b and six1a/six1b morphant embryos stained with Pax7 (red), pSmad1/5/8 (green) and DAPI (blue). Enlargements of Pax7+/pSmad1/5/8+ border are presented, with arrowheads indicating coexpression. (D) Expression of six1b (blue) and smyhc1 (red) in embryos treated with DMSO or 15 µM dorsomorphin (DM) from shield stage to 24 hpf, showing a maintained six1b expression; dashed lines indicate the level of cross-section. (E) Pax7 expression in embryos treated with DMSO or 5 µM dorsomorphin from 2–3 hpf to 24 hpf. (F) Pax7 expression in embryos treated with 100 or 200 µM dorsomorphin from 10 ss to 24 hpf. (G) Embryos treated with 5 µM dorsomorphin from 2–3 hpf to 24 hpf have an average number of 32.8 Pax7+ cells/somite (n = 24) and DMSO-treated controls have 46.7 Pax7+ cells/somite (n = 18). Embryos treated with 100 µM dorsomorphin from 10 ss to 24 hpf have an average number of 33.1 Pax7+ cells/somite (n = 19) and DMSO-treated controls have 41.4 Pax7+ cells/somite (n = 17). Embryos treated with 200 µM dorsomorphin from 10 ss to 24 hpf have an average number of 34.8 Pax7+ cells/somite (n = 19) and DMSO-treated control have 41.3 Pax7+ cells/somite (n = 16). Somite number 10–12 was counted and cross-sections were made at somite number 10. *P<0.05, **P<0.01, ***P<0.001. Scale bars: 50 µm and 10 µm for enlargements.

Fig. 7.

Six1 is required for pSmad1/5/8 expression in Pax7+ cells in the peripheral dermomyotome and reduced levels of pSmad1/5/8 decrease the number of Pax7+ cells. (A) Expression of Pax7 (red) and pSmad1/5/8 (green) in 24-hpf embryos uninjected and injected with six1a and six1b morpholinos alone or in combination. (B) Average number of Pax7+/pSmad1/5/8 and Pax7+/pSmad1/5/8+ cells per somite in control embryos (n = 6) and in six1a (n = 14), six1b (n = 11) and six1a and six1b double morphants (n = 13). Somite number 10–12 was counted. (C) Cross-sections of 24-hpf control embryos and six1a, six1b and six1a/six1b morphant embryos stained with Pax7 (red), pSmad1/5/8 (green) and DAPI (blue). Enlargements of Pax7+/pSmad1/5/8+ border are presented, with arrowheads indicating coexpression. (D) Expression of six1b (blue) and smyhc1 (red) in embryos treated with DMSO or 15 µM dorsomorphin (DM) from shield stage to 24 hpf, showing a maintained six1b expression; dashed lines indicate the level of cross-section. (E) Pax7 expression in embryos treated with DMSO or 5 µM dorsomorphin from 2–3 hpf to 24 hpf. (F) Pax7 expression in embryos treated with 100 or 200 µM dorsomorphin from 10 ss to 24 hpf. (G) Embryos treated with 5 µM dorsomorphin from 2–3 hpf to 24 hpf have an average number of 32.8 Pax7+ cells/somite (n = 24) and DMSO-treated controls have 46.7 Pax7+ cells/somite (n = 18). Embryos treated with 100 µM dorsomorphin from 10 ss to 24 hpf have an average number of 33.1 Pax7+ cells/somite (n = 19) and DMSO-treated controls have 41.4 Pax7+ cells/somite (n = 17). Embryos treated with 200 µM dorsomorphin from 10 ss to 24 hpf have an average number of 34.8 Pax7+ cells/somite (n = 19) and DMSO-treated control have 41.3 Pax7+ cells/somite (n = 16). Somite number 10–12 was counted and cross-sections were made at somite number 10. *P<0.05, **P<0.01, ***P<0.001. Scale bars: 50 µm and 10 µm for enlargements.

To examine the effect of six1a and six1b overexpression on pSmad1/5/8 in the dermomyotome, we analysed pSmad1/5/8 in Pax7+ cells at 24 hpf after heat-shock inducing six1a and six1b at 12 ss, but neither six1a nor six1b were able to induce pSmad1/5/8 ectopically (supplementary material Fig. S3), which suggests that zebrafish six1 is required but not sufficient to induce pSmad1/5/8 in Pax7+ cells.

We analysed the effect of dorsomorphin, which is an inhibitor of Smad1/5/8 phosphorylation (Yu et al., 2008), on the Pax7+ cell population. Embryos treated with dorsomorphin from shield stage and onwards until fixation at 24 hpf displayed a dorsalized phenotype (Fig. 7D) where the treated embryos also occasionally exhibited additional tail tissue as previously described in Yu et al. (Yu et al., 2008). However, the six1b expression remained unaffected in the dorsomorphin-treated embryos, indicating that six1b is acting either upstream or in a parallel pathway (Fig. 7D). Furthermore, the number of Pax7+ cells was significantly decreased at 24 hpf in dorsomorphin-treated embryos compared with DMSO treated controls when inhibiting Smad1/5/8 phosphorylation from 2–3 hpf (Fig. 7E,G). To assess if the reduced Pax7+ cell number was caused by inhibition of proliferation of the Pax7+ cells, we also initiated dorsomorphin treatments at 10 ss, when the first Pax7+ cells are already formed (Feng et al., 2006; Hammond et al., 2007). Here, we observed a similar reduction in Pax7+ cell number (Fig. 7F,G), reinforcing our observation that reduced levels of pSmad1/5/8 results in reduced Pax7+ cell number and support our hypothesis that the reduced pSmad1/5/8 influences the proliferation and consequently the differentiation of the Pax7+ cells rather than their initial specification.

To further analyse the relationship between Bmp signalling and Six1 during the proliferation of Pax7+ cells, we analysed six1 overexpression in dorsomorphin-treated embryos. Embryos subjected to dorsomorphin treatment, injected with six1a and six1b mRNA, had significantly higher numbers of Pax7+ cells than the dorsomorphin-treated uninjected embryos (Fig. 8A). We also overexpressed bmp2b in six1a and six1b morphant embryos and found a partial rescue of the Pax7+ population (Fig. 8B). Increased levels of bmp2b did however not lead to complete rescue of the Pax7+ population, leading to the conclusion that the proliferation of Pax7+ cells can be regulated either directly via Six1 or through pSmad1/5/8 (Fig. 8B,C), implying that there are dual Pax7+ populations with differing requirements. Collectively our data indicate that the proliferation of Pax7+ cells in the central dermomyotome, which lack pSmad1/5/8, is directly regulated by Six1, whereas the proliferation is modulated via pSmad1/5/8 in the peripheral dermomyotome cells (Fig. 8C)

Fig. 8.

Dual Pax7+ populations with differing requirements for proliferation. (A) Average number of Pax7+ cells per somite in uninjected control embryos and embryos injected with six1a or six1b RNA treated with 5 µM dorsomorphin or DMSO from 2–3 hpf to 24 hpf. Uninjected embryos treated with dorsomorphin have an average number of 35.9 Pax7+ cells/somite (n = 47); uninjected embryos treated with DMSO have 44.1 Pax7+ cells/somite (n = 36); dorsomorphin-treated embryos injected with six1a RNA have 46.6 Pax7+ cells/somite (n = 15); and dorsomorphin-treated embryos injected with six1b RNA have an average number of 44.8 Pax7+ cells/somite (n = 21). Somite number 10–13 was counted. (B) Average number of Pax7+ cells/somite in uninjected control embryos and embryos injected with six1a, six1b and six1a/six1b morpholino alone or in combination with bmp2b RNA. Uninjected embryos have an average number of 48.6 Pax7+ cells/somite (n = 15); embryos injected with bmp2b RNA have 64.4 Pax7+ cells/somite (n = 16); six1a morphants have 32.8 Pax7+ cells/somite (n = 40) whereas six1a morphants injected with bmp2b RNA have an average number of 48.9 Pax7+ cells/somite (n = 15); six1b morphants have 27.2 Pax7+ cells/somite (n = 37) and together with bmp2b RNA the average number of Pax7+ cells/somite is 37.4 (n = 32); six1a/six1b double morphants have 27.1 Pax7+ cells/somite (n = 41) whereas the average number of Pax7+ cells/somite is 40.5 in six1a/six1b double morphants injected with bmp2b RNA (n = 38). Somite number 10–13 was counted. (C) Representation of the proposed mechanism during the proliferation of Pax7+ muscle progenitors. Proliferation of Pax7+ cells is regulated directly by Six1a/b in the central dermomyotome (blue) and by Six1a/b via pSmad1/5/8 in the peripheral dermomyotome (yellow). Cross-section indicates the different domains. **P<0.01, ***P<0.001.

Fig. 8.

Dual Pax7+ populations with differing requirements for proliferation. (A) Average number of Pax7+ cells per somite in uninjected control embryos and embryos injected with six1a or six1b RNA treated with 5 µM dorsomorphin or DMSO from 2–3 hpf to 24 hpf. Uninjected embryos treated with dorsomorphin have an average number of 35.9 Pax7+ cells/somite (n = 47); uninjected embryos treated with DMSO have 44.1 Pax7+ cells/somite (n = 36); dorsomorphin-treated embryos injected with six1a RNA have 46.6 Pax7+ cells/somite (n = 15); and dorsomorphin-treated embryos injected with six1b RNA have an average number of 44.8 Pax7+ cells/somite (n = 21). Somite number 10–13 was counted. (B) Average number of Pax7+ cells/somite in uninjected control embryos and embryos injected with six1a, six1b and six1a/six1b morpholino alone or in combination with bmp2b RNA. Uninjected embryos have an average number of 48.6 Pax7+ cells/somite (n = 15); embryos injected with bmp2b RNA have 64.4 Pax7+ cells/somite (n = 16); six1a morphants have 32.8 Pax7+ cells/somite (n = 40) whereas six1a morphants injected with bmp2b RNA have an average number of 48.9 Pax7+ cells/somite (n = 15); six1b morphants have 27.2 Pax7+ cells/somite (n = 37) and together with bmp2b RNA the average number of Pax7+ cells/somite is 37.4 (n = 32); six1a/six1b double morphants have 27.1 Pax7+ cells/somite (n = 41) whereas the average number of Pax7+ cells/somite is 40.5 in six1a/six1b double morphants injected with bmp2b RNA (n = 38). Somite number 10–13 was counted. (C) Representation of the proposed mechanism during the proliferation of Pax7+ muscle progenitors. Proliferation of Pax7+ cells is regulated directly by Six1a/b in the central dermomyotome (blue) and by Six1a/b via pSmad1/5/8 in the peripheral dermomyotome (yellow). Cross-section indicates the different domains. **P<0.01, ***P<0.001.

Discussion

By manipulating the cellular levels of Six1a and Six1b during the establishment and differentiation of cells in the zebrafish embryonic somite we have found that both genes have profound effects on fast muscle development and are important regulators of proliferation in the embryonic Pax7+ population.

Inhibition of Six1 leads to impaired muscle formation

We show that the domain in the myotome harbouring the differentiated fast fibres becomes reduced in six1a and six1b morphants (Fig. 2). This reduction is non-significant after 24 hpf, but becomes more evident at 3 dpf. The number of nuclei per fibre was not affected in the morphant embryos and even though the number of fast-twitch fibres decreased in 3-dpf six1a and six1b morphants, the primary cause of the reduced fast domain does not seem to be due to a decreased fibre number, but rather a condense in cell sizes, which links Six1 to functions related to hypertrophy. At 24 hpf six1a and six1b morphant embryos have a reasonably normal morphology and the effects on the myogenic cells in the trunk are not causing any severe phenotypes at this stage. The numbers of surface slow fibres and muscle pioneer cells remain normal (Fig. 2D) and the engrailed positive cells are seemingly unaffected (data not shown). This observation is in line with previous studies using six1b morphant embryos (Bessarab et al., 2008). In addition to the reduced fast muscle domain, we also observed a drastic reduction of cranial muscle using both six1a and six1b morpholinos. The function of Six1b in cranial muscle development has previously been described by Lin et al. (Lin et al., 2009), our data show that inhibition of Six1a has a similar, but less severe effect as that of Six1b in cranial muscle development. The strongest effect, both on the cranial muscle and the fast domain in the myotome, was observed in the six1a/six1b double morphant embryos (Fig. 2), which suggests that there is some redundancy between the zebrafish six1 genes. However, both genes are individually essential for normal muscle development in the craniofacial as well as the myotome region.

We used myoD/myf5 morphant embryos, which essentially lack differentiated muscle fibre, to examine if zebrafish six1b expression is dependent on the MRFs. Here, we found that six1b remains expressed in the somite, even when both the slow and the fast fibres are reduced to a minimum. Many of the remaining cells in the somite, following MyoD/Myf5 inhibition, are Pax7+ progenitor cells (Fig. 4) (Hammond et al., 2007). We found that the region expressing six1b in myoD/myf5 morphants overlapped with the location of the Pax7+ progenitor cells. A transgenic reporter line, where 6.5 kb upstream the six1b ATG drives expression of GFP, was established and analysed together with Pax7. This analysis identified cells coexpressing six1b:GFP and Pax7 and confirmed that zebrafish six1b is expressed in the Pax7+ progenitors (Fig. 3A,C), and collectively our data show that the six1 expression in Pax7+ cells is independent of MyoD and Myf5.

Zebrafish Six1 promotes Pax7+ cell proliferation

To follow up on the potential Six1 function in Pax7+ cells, we first analysed how inhibition of six1a and six1b affected Pax7+ cell number at 24 hpf and found significant reductions of Pax7+ cells using six1a and/or six1b morpholinos (Fig. 5A,B). However, a substantial number of Pax7+ cells was still present in the 24-hpf embryos after Six1 inhibition, which indicated that rather than being involved in the initial formation of the Pax7+ cells, zebrafish Six1 is involved in regulating Pax7+ cell number by either regulating Pax7+ cell proliferation or differentiation. We therefore analysed pHistone3, which marks cells in the M phase, in six1a and six1b morphants and found a general reduction (Fig. 5C,D). Previously, Bessarab et al. (Bessarab et al., 2008) showed that six1b inhibition resulted in minor changes in pH3+ cell number. The lack of effect could be explained by the early stage of the analysis, which was conducted at 9 ss and is very close to the onset of six1b expression. In our experiment, which was conducted at 24 hpf we found a very significant decrease in pH3+ cell number. In order to verify this and, in addition, to specifically analyse proliferation of Pax7+ cells, we brdU treated six1a and six1b morphant embryos between 15 ss to 24 hpf and analysed how many of the Pax7+ cells that had continued to proliferate after their initial formation. Here, we found that the proportion of brdU/Pax7+ versus brdU+/Pax7+ cells increased dramatically in the six1a and six1b and particularly in the six1a/six1b double morphants, which indicates that Six1 is affecting proliferation of the Pax7+ cells (Fig. 5E,F). Control of cell proliferation has previously been established for Six1 in the development of sensory organs (Chen et al., 2009; Zheng et al., 2003) and in metastatic tumours (Coletta et al., 2004; Coletta et al., 2008), where Six1 acts as an activator of proliferation in line with our own findings. By contrast, Six1 has also been suggested to promote differentiation in adult cultured satellite cells (Yajima et al., 2010) and to regenerate muscle tissue and replenish the satellite cell pool following skeletal muscle trauma in adult mice (Le Grand et al., 2012), which indicates that six1 function may vary between cell types and be dependent on the cellular milieu.

In order to study overexpression of six1 during zebrafish muscle development, we used a heat-shock inducible vector, which we activated at late epiboly and analysed at 16 ss, when the first fast fibres have started to form, as marked by the fast muscle specific myosin light chain 2 reporter, tg(mylz2:GFP)i135 (Fig. 6C). In the control experiment, where the heat-shock vector exclusively expresses tdtomato, we found many cells that had an elongated fibre-like morphology, and a large proportion expressing the transgenic GFP as a consequence of their differentiated state. However, this was rarely observed in the six1a or six1b expression constructs, where very few cells in the myotomal region overexpressing six1a or six1b had adopted a fibre morphology, and even fewer coexpressing the mylz2:GFP at the examined stage. This indicated that overexpression of either six1a or six1b both lead to an inhibition or at least a delay of differentiation, which supports our finding that zebrafish Six1 promotes proliferation in a cell autonomous way.

pSmad1/5/8 levels are affected by Six1 in Pax7+ cells in the dermomyotome

Transforming growth factor beta (Tgfβ) signalling, including bone morphogenetic proteins (BMPs) can act on myogenesis through phosphorylated Smad (Yamamoto et al., 1997), which can act as repressors of myogenic progenitor differentiation (Amthor et al., 1998; Dahlqvist et al., 2003; Frank et al., 2006). Further, inhibition of BMP signalling leads to decreased number of Pax7+ cells during fetal development in chick (Wang et al., 2010). In zebrafish, overexpression of Bmp2b leads to upregulated pSmad1/5/8 levels and results in an increased number of Pax7+ cells in the dermomyotome (Patterson et al., 2010). In the six1a and six1b morphant embryos, we found a significant reduction of pSmad1/5/8 specifically in the Pax7+ cells indicating that Six1 is necessary for pSmad1/5/8 expression in Pax7+ cells (Fig. 7). BMP induced pSmad1/5/8 in zebrafish Pax7+ cells has previously been suggested to inhibit differentiation (Patterson et al., 2010), which is in congruence with our finding in the six1a and six1b morphant embryos. However, six1 was not sufficient to activate pSmad1/5/8 ectopically when induced at the 12 ss (supplementary material Fig. S3), which could be explained by the fact that zebrafish six1 is already expressed both in the fast muscle progenitors as well as in the Pax7+ cells in the central part of the dermomyotome and that additional factors are required to induce pSmad1/5/8 in these regions. This also indicates that cells in the central dermomyotome respond differently than cells within the pSmad1/5/8 positive region. However, inhibition of pSmad1/5/8 through dorsomorphin treatment efficiently reduced the number of Pax7+ cells in the dermomyotome, but not to the same extent as to those found in the six1a/six1b double morphants (Figs 5, 7). This supports our hypothesis that Six1 regulates the proliferation and consequently, the differentiation of Pax7+ cells through pSmad1/5/8 in the peripheral dermomyotome region. Previous studies have shown that BMP signalling regulates the proliferation of Pax7+ satellite cells through pSmad1/5/8, where inhibition of pSmad1/5/8 lead to induced differentiation (Ono et al., 2011; Yanagisawa et al., 2011), which further supports our finding in the zebrafish Pax7+ cells.

Interestingly, both six1a and six1b overexpression were able to increase the number of Pax7+ cells in dorsomorphin-treated embryos, indicating that at least some cells are independent of pSmad1/5/8 (Fig. 8). Similarly, overexpression of bmp2b was able to partially rescue the number of Pax7+ cells in six1a and six1b morphant embryos (Fig. 8). Collectively this indicates that there are more than one population of Pax7+ cells with different requirements. A recent study by Windner et al. (Windner et al., 2012) shows that the zebrafish dermomyotome is divided in two domains, a central domain and a more peripheral domain, which is situated ventral and dorsal to the central domain. These domains are suggested to be genetically and functionally distinct, which concurs with our own observations. Our data indicate that Six1 regulates proliferation of Pax7+ cells via pSmad1/5/8 in the peripheral dermomyotome and that Six1 acts directly on proliferation in the central dermomyotome (Fig. 8C).

The function of Six1 during zebrafish muscle development is complex. Here, we show that both of the zebrafish six1 genes are important for normal muscle formation, both in the craniofacial region, the fast domain of the myotome and in the proliferation and differentiation of the Pax7+ dermomyotome cells. We show that zebrafish Six1 is promoting proliferation and simultaneously, as a consequence, inhibiting differentiation of Pax7+ cells into fast fibre through a process where we propose that pSmad1/5/8 is required in the peripheral dermomyotome to maintain the Pax7+ cells in a proliferative state. In addition to the role for Six1 in the Pax7+ cells, six1a and six1b are both expressed in the mature fast fibres. We found that inhibition of Six1 lead to a significant reduction of fibre cell size, which suggests that Six1 affects hypertrophy; however, the role for Six1 in the mature fast fibres is still not clear and remains to be examined further.

Materials and Methods

Zebrafish strains and maintenance

Embryos were obtained from wild-type zebrafish [Danio rerio, London wild type (LWT) and tupfel long fin (TL)]. Zebrafish were maintained by standard procedures in the Umeå University Zebrafish Facility. Embryos were staged up to the 15-somite stage by counting the number of somites, as described previously (Kimmel et al., 1995). Transgenic lines used were tg(mylz2:GFP)i135 (von Hofsten et al., 2008) and tg(six1b:GFP)J1 which was generated by isolating 6.5 kb upstream the six1b ATG (gene bank accession number: BX649231) to generate a stable transgenic line.

Whole-mount in situ hybridization

Zebrafish embryos were fixed in 4% paraformaldehyde (PFA) over night. Whole-mount in situ hybridization was performed as described previously (Thisse et al., 1993) with minor changes; 1% blocking reagent (Roche, IN) was used instead of 2% sheep serum and 2 mg/ml BSA. Two-colour whole-mount RNA in situ hybridization was performed as described previously (Westerfield, 2000) using DIG-labelled and fluorescein-labelled RNA probes, and using Fast Red (Roche, IN) and NBT/BCIP (Roche) for detection. For the fluorescent in situ hybridization anti-DIG POD (1∶10,000; Roche) was used with TSA-Cy3 (Perkin Elmer, Waltham, MA). RNA probes were fMyHC1.3 (gene bank accession number: EU115994), six1a (BC076015) and six1b (BC066396).

Immunohistochemistry

Zebrafish embryos were fixed in 4% PFA over night. Immunohistochemistry was performed using standard procedures. For brdU and pHistone3 detection, rehydrated embryos were treated with proteinase K for 10 minutes (10 µg/ml), re-fixed for 20 minutes in 4% PFA, washed and treated with 2 N HCl for 1 hour, followed by washing, blocking and antibody incubation. Primary antibodies used were F59 (slow myosin heavy chain, DSHB), F310 (myosin light chain 1 and 3F, DSHB) and anti-Pax7 (1∶10, 1∶50 and 1∶10, respectively, DSHB, University of Iowa, IA) anti-p-histone3 (1∶400, Merck Millipore KGaA, Darmstadt, Germany), anti-GFP (1∶200, Aves, OR) and anti-pSMAD1/5/8 (1∶30, Cell Signaling). Nuclei were stained using DAPI (Sigma). For brdU detection, a mouse anti-brdU antibody conjugated to either Alexa Fluor 555 or Alexa Fluor 488 was used (1∶20, BD Biosciences).

Microinjections and morpholino verification

For morpholino treatment, zebrafish embryos were injected at the 1–4 cell stage with 4 nl of myoD (atatccgacaactccatcttttttg, 0.6 nmol/µl) and myf5 (gatctgggatgtggagaatacgtcc, 0.6 nmol/µl), six1a (atgattaacgaagatctcacctctc, 1 nmol/µl) and six1b (tctcctctggatgctacgaaggaag, 1 nmol/µl), p53 (gcgccattgctttgcaagaattg, 1 nmol/µl) morpholinos (GeneTools, Philomath, OR). For double morpholino treatment, 4 nl of a mixture of six1a (0.5 nmol/µl) and six1b (0.5 nmol/µl) was used.

To verify the functionality of the six1a splice morpholino, mRNA from injected and uninjected embryos was isolated using TriZol (Life Technologies). After DNase treatment, extracted RNA was used as template for cDNA synthesis (forward primer 5′-cgcacaacccttatccatct-3′; reverse primer 5′-cgacatcagcgacttcactc-3′). cDNA was cloned into a TOPO vector (Invitrogen), sequenced and analysed.

six1a, six1b and bmp2b (Little and Mullins, 2009) RNA was generated by using mMESSAGE mMACHINE® Kit (Ambion, TX). 4 nl of RNA was microinjected into one-cell stage embryos at a concentration of 1 µg/µl for six1a and six1b and 3 ng/µl for bmp2b, fixed at desired stage in 4% PFA over night, dehydrated in 100% methanol and stored at −20°C until analysis using immunohistochemistry.

BrdU treatment

Embryos were dechorionated and incubated in 10 mM 5-Bromo-2′-deoxyuridine (brdU, Sigma) in embryo medium until they reached the desired developmental stage, fixed in 4% PFA over night, dehydrated in 100% methanol and stored at −20°C until analysis using immunohistochemistry.

Heat shock treatment

For heat-shock-induced expression, the complete six1a and six1b coding sequences were subcloned into a pSGH2 vector containing a bidirectional heat shock promoter (Bajoghli et al., 2004) that drives expression of both the fusion protein and fluorescent proteins tdTomato or GFP. One-cell stage embryos were microinjected with plasmid at a concentration of 40 ng/µl, when the embryos reached 70% epiboly or 12 ss, they were heat-shocked at 38°C for 2 hours. tdTomato/GFP positive embryos were fixed at 16 ss, 18 ss or 24 hpf in 4% PFA over night, dehydrated in 100% methanol and stored at −20°C until analysis using immunohistochemistry.

Dorsomorphin treatment

Dorsomorphin (Sigma) was dissolved in DMSO at a stock concentration of 5 mM and used at a concentration of 5 µM, 15 µM, 100 µM and 200 µM in embryo medium. Embryos were incubated in either dorsomorphin or the same volume of DMSO at 2–3 hpf for 5 µM, shield stage for 15 µM and at 10 ss for 100 µM and 200 µM, then fixed in 4% PFA at 24 hpf.

Cell counting and statistical analysis

To measure the F310+ area, the F310+ area on cross-sections, which excludes all cells but the fast specific fibres of 24-hpf and 3-dpf embryos was marked and measured using Adobe Photoshop CS4, similarly, the DAPI stained nuclei were counted in the F310+ area. Cross-sections were made at somite number 10 for embryos at 24 hpf and at number 8 for embryos at 3 dpf. The average number of cells positive for Pax7, brdU, GFP and pSMAD1/5/8 was determined by counting the average number of stained cells per somite number 10 to 12 or for pHistone3 somite number 10 to 18. The proportion of GFP+ fibres/non-differentiated myotomal cells after heat shock induced six1 overexpression was determined by counting GFP+ fibres and GFP+ non-differentiated myotomal cells at somite number 8 to 10. n = number of embryos or somites where applicable. Significance was determined by Student's t-test where P<0.05 is considered significant; *P<0.05, **P<0.01, ***P<0.001. All error bars represent the standard error of mean (s.e.m.).

Acknowledgements

We thank Mary C. Mullins and James A. Dutko for reagents and Edward Samuel Inbaraj for technical assistance.

Author contributions

H.N, L.S and J.v.H. conducted the experiments. H.N and J.v.H wrote the paper.

Funding

This project was funded by financial support from the Kempe foundation, the Åke Wiberg foundation, the Magnus Bergvall foundation, the Jeansson foundation and the Swedish Royal Academy of Science.

References

Amthor
H.
,
Christ
B.
,
Weil
M.
,
Patel
K.
(
1998
).
The importance of timing differentiation during limb muscle development.
Curr. Biol.
8
,
642
652
.
Bajoghli
B.
,
Aghaallaei
N.
,
Heimbucher
T.
,
Czerny
T.
(
2004
).
An artificial promoter construct for heat-inducible misexpression during fish embryogenesis.
Dev. Biol.
271
,
416
430
.
Bessarab
D. A.
,
Chong
S. W.
,
Korzh
V.
(
2004
).
Expression of zebrafish six1 during sensory organ development and myogenesis.
Dev. Dyn.
230
,
781
786
.
Bessarab
D. A.
,
Chong
S. W.
,
Srinivas
B. P.
,
Korzh
V.
(
2008
).
Six1a is required for the onset of fast muscle differentiation in zebrafish.
Dev. Biol.
323
,
216
228
.
Blagden
C. S.
,
Currie
P. D.
,
Ingham
P. W.
,
Hughes
S. M.
(
1997
).
Notochord induction of zebrafish slow muscle mediated by Sonic hedgehog.
Genes Dev.
11
,
2163
2175
.
Bryson-Richardson
R. J.
,
Currie
P. D.
(
2008
).
The genetics of vertebrate myogenesis.
Nat. Rev. Genet.
9
,
632
646
.
Burguière
A. C.
,
Nord
H.
,
von Hofsten
J.
(
2011
).
Alkali-like myosin light chain-1 (myl1) is an early marker for differentiating fast muscle cells in zebrafish.
Dev. Dyn.
240
,
1856
1863
.
Chen
B.
,
Kim
E. H.
,
Xu
P. X.
(
2009
).
Initiation of olfactory placode development and neurogenesis is blocked in mice lacking both Six1 and Six4.
Dev. Biol.
326
,
75
85
.
Coletta
R. D.
,
Christensen
K.
,
Reichenberger
K. J.
,
Lamb
J.
,
Micomonaco
D.
,
Huang
L.
,
Wolf
D. M.
,
Müller-Tidow
C.
,
Golub
T. R.
,
Kawakami
K.
 et al. (
2004
).
The Six1 homeoprotein stimulates tumorigenesis by reactivation of cyclin A1.
Proc. Natl. Acad. Sci. USA
101
,
6478
6483
.
Coletta
R. D.
,
Christensen
K. L.
,
Micalizzi
D. S.
,
Jedlicka
P.
,
Varella-Garcia
M.
,
Ford
H. L.
(
2008
).
Six1 overexpression in mammary cells induces genomic instability and is sufficient for malignant transformation.
Cancer Res.
68
,
2204
2213
.
Dahlqvist
C.
,
Blokzijl
A.
,
Chapman
G.
,
Falk
A.
,
Dannaeus
K.
,
Ibâñez
C. F.
,
Lendahl
U.
(
2003
).
Functional Notch signaling is required for BMP4-induced inhibition of myogenic differentiation.
Development
130
,
6089
6099
.
Devoto
S. H.
,
Melançon
E.
,
Eisen
J. S.
,
Westerfield
M.
(
1996
).
Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation.
Development
122
,
3371
3380
.
Devoto
S. H.
,
Stoiber
W.
,
Hammond
C. L.
,
Steinbacher
P.
,
Haslett
J. R.
,
Barresi
M. J.
,
Patterson
S. E.
,
Adiarte
E. G.
,
Hughes
S. M.
(
2006
).
Generality of vertebrate developmental patterns: evidence for a dermomyotome in fish.
Evol. Dev.
8
,
101
110
.
Dolez
M.
,
Nicolas
J. F.
,
Hirsinger
E.
(
2011
).
Laminins, via heparan sulfate proteoglycans, participate in zebrafish myotome morphogenesis by modulating the pattern of Bmp responsiveness.
Development
138
,
97
106
.
Du
S. J.
,
Devoto
S. H.
,
Westerfield
M.
,
Moon
R. T.
(
1997
).
Positive and negative regulation of muscle cell identity by members of the hedgehog and TGF-beta gene families.
J. Cell Biol.
139
,
145
156
.
Feng
X.
,
Adiarte
E. G.
,
Devoto
S. H.
(
2006
).
Hedgehog acts directly on the zebrafish dermomyotome to promote myogenic differentiation.
Dev. Biol.
300
,
736
746
.
Frank
N. Y.
,
Kho
A. T.
,
Schatton
T.
,
Murphy
G. F.
,
Molloy
M. J.
,
Zhan
Q.
,
Ramoni
M. F.
,
Frank
M. H.
,
Kohane
I. S.
,
Gussoni
E.
(
2006
).
Regulation of myogenic progenitor proliferation in human fetal skeletal muscle by BMP4 and its antagonist Gremlin.
J. Cell Biol.
175
,
99
110
.
Grifone
R.
,
Demignon
J.
,
Houbron
C.
,
Souil
E.
,
Niro
C.
,
Seller
M. J.
,
Hamard
G.
,
Maire
P.
(
2005
).
Six1 and Six4 homeoproteins are required for Pax3 and Mrf expression during myogenesis in the mouse embryo.
Development
132
,
2235
2249
.
Hammond
C. L.
,
Hinits
Y.
,
Osborn
D. P.
,
Minchin
J. E.
,
Tettamanti
G.
,
Hughes
S. M.
(
2007
).
Signals and myogenic regulatory factors restrict pax3 and pax7 expression to dermomyotome-like tissue in zebrafish.
Dev. Biol.
302
,
504
521
.
Hinits
Y.
,
Osborn
D. P.
,
Hughes
S. M.
(
2009
).
Differential requirements for myogenic regulatory factors distinguish medial and lateral somitic, cranial and fin muscle fibre populations.
Development
136
,
403
414
.
Hollway
G. E.
,
Bryson-Richardson
R. J.
,
Berger
S.
,
Cole
N. J.
,
Hall
T. E.
,
Currie
P. D.
(
2007
).
Whole-somite rotation generates muscle progenitor cell compartments in the developing zebrafish embryo.
Dev. Cell
12
,
207
219
.
Kimmel
C. B.
,
Ballard
W. W.
,
Kimmel
S. R.
,
Ullmann
B.
,
Schilling
T. F.
(
1995
).
Stages of embryonic development of the zebrafish.
Dev. Dyn.
203
,
253
310
.
Laclef
C.
,
Hamard
G.
,
Demignon
J.
,
Souil
E.
,
Houbron
C.
,
Maire
P.
(
2003
).
Altered myogenesis in Six1-deficient mice.
Development
130
,
2239
2252
.
Le Grand
F.
,
Grifone
R.
,
Mourikis
P.
,
Houbron
C.
,
Gigaud
C.
,
Pujol
J.
,
Maillet
M.
,
Pagès
G.
,
Rudnicki
M.
,
Tajbakhsh
S.
 et al. (
2012
).
Six1 regulates stem cell repair potential and self-renewal during skeletal muscle regeneration.
J. Cell Biol.
198
,
815
832
.
Lin
C. Y.
,
Chen
W. T.
,
Lee
H. C.
,
Yang
P. H.
,
Yang
H. J.
,
Tsai
H. J.
(
2009
).
The transcription factor Six1a plays an essential role in the craniofacial myogenesis of zebrafish.
Dev. Biol.
331
,
152
166
.
Little
S. C.
,
Mullins
M.
(
2009
).
Bone morphogenetic protein heterodimers assemble heteromeric type I receptor complexes to pattern the dorsoventral axis.
Nat. Cell Biol.
11
,
637
643
.
Massagué
J.
,
Seoane
J.
,
Wotton
D.
(
2005
).
Smad transcription factors.
Genes Dev.
19
,
2783
2810
.
Maurya
A. K.
,
Tan
H.
,
Souren
M.
,
Wang
X.
,
Wittbrodt
J.
,
Ingham
P. W.
(
2011
).
Integration of Hedgehog and BMP signalling by the engrailed2a gene in the zebrafish myotome.
Development
138
,
755
765
.
Ono
Y.
,
Calhabeu
F.
,
Morgan
J. E.
,
Katagiri
T.
,
Amthor
H.
,
Zammit
P. S.
(
2011
).
BMP signalling permits population expansion by preventing premature myogenic differentiation in muscle satellite cells.
Cell Death Differ.
18
,
222
234
.
Pandur
P. D.
,
Moody
S. A.
(
2000
).
Xenopus Six1 gene is expressed in neurogenic cranial placodes and maintained in the differentiating lateral lines.
Mech. Dev.
96
,
253
257
.
Pardali
K.
,
Moustakas
A.
(
2007
).
Actions of TGF-beta as tumor suppressor and pro-metastatic factor in human cancer.
Biochim. Biophys. Acta
1775
,
21
62
.
Patterson
S. E.
,
Bird
N. C.
,
Devoto
S. H.
(
2010
).
BMP regulation of myogenesis in zebrafish.
Dev. Dyn.
239
,
806
817
.
Relaix
F.
,
Rocancourt
D.
,
Mansouri
A.
,
Buckingham
M.
(
2005
).
A Pax3/Pax7-dependent population of skeletal muscle progenitor cells.
Nature
435
,
948
953
.
Relaix
F.
,
Montarras
D.
,
Zaffran
S.
,
Gayraud-Morel
B.
,
Rocancourt
D.
,
Tajbakhsh
S.
,
Mansouri
A.
,
Cumano
A.
,
Buckingham
M.
(
2006
).
Pax3 and Pax7 have distinct and overlapping functions in adult muscle progenitor cells.
J. Cell Biol.
172
,
91
102
.
Spitz
F.
,
Demignon
J.
,
Porteu
A.
,
Kahn
A.
,
Concordet
J. P.
,
Daegelen
D.
,
Maire
P.
(
1998
).
Expression of myogenin during embryogenesis is controlled by Six/sine oculis homeoproteins through a conserved MEF3 binding site.
Proc. Natl. Acad. Sci. USA
95
,
14220
14225
.
Stellabotte
F.
,
Dobbs-McAuliffe
B.
,
Fernández
D. A.
,
Feng
X.
,
Devoto
S. H.
(
2007
).
Dynamic somite cell rearrangements lead to distinct waves of myotome growth.
Development
134
,
1253
1257
.
Tapscott
S. J.
(
2005
).
The circuitry of a master switch: Myod and the regulation of skeletal muscle gene transcription.
Development
132
,
2685
2695
.
Tapscott
S. J.
,
Davis
R. L.
,
Thayer
M. J.
,
Cheng
P. F.
,
Weintraub
H.
,
Lassar
A. B.
(
1988
).
MyoD1: a nuclear phosphoprotein requiring a Myc homology region to convert fibroblasts to myoblasts.
Science
242
,
405
411
.
Thisse
C.
,
Thisse
B.
,
Schilling
T. F.
,
Postlethwait
J. H.
(
1993
).
Structure of the zebrafish snail1 gene and its expression in wild-type, spadetail and no tail mutant embryos.
Development
119
,
1203
1215
.
von Hofsten
J.
,
Elworthy
S.
,
Gilchrist
M. J.
,
Smith
J. C.
,
Wardle
F. C.
,
Ingham
P. W.
(
2008
).
Prdm1- and Sox6-mediated transcriptional repression specifies muscle fibre type in the zebrafish embryo.
EMBO Rep.
9
,
683
689
.
Wang
H.
,
Noulet
F.
,
Edom-Vovard
F.
,
Tozer
S.
,
Le Grand
F.
,
Duprez
D.
(
2010
).
Bmp signaling at the tips of skeletal muscles regulates the number of fetal muscle progenitors and satellite cells during development.
Dev. Cell
18
,
643
654
.
Westerfield
M.
(
2000
).
The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio)
Eugene, OR
:
University of Oregon Press
.
Windner
S. E.
,
Bird
N. C.
,
Patterson
S. E.
,
Doris
R. A.
,
Devoto
S. H.
(
2012
).
Fss/Tbx6 is required for central dermomyotome cell fate in zebrafish.
Biol. Open
1
,
806
814
.
Yajima
H.
,
Motohashi
N.
,
Ono
Y.
,
Sato
S.
,
Ikeda
K.
,
Masuda
S.
,
Yada
E.
,
Kanesaki
H.
,
Miyagoe-Suzuki
Y.
,
Takeda
S.
 et al. (
2010
).
Six family genes control the proliferation and differentiation of muscle satellite cells.
Exp. Cell Res.
316
,
2932
2944
.
Yamamoto
N.
,
Akiyama
S.
,
Katagiri
T.
,
Namiki
M.
,
Kurokawa
T.
,
Suda
T.
(
1997
).
Smad1 and smad5 act downstream of intracellular signalings of BMP-2 that inhibits myogenic differentiation and induces osteoblast differentiation in C2C12 myoblasts.
Biochem. Biophys. Res. Commun.
238
,
574
580
.
Yanagisawa
M.
,
Mukai
A.
,
Shiomi
K.
,
Song
S. Y.
,
Hashimoto
N.
(
2011
).
Community effect triggers terminal differentiation of myogenic cells derived from muscle satellite cells by quenching Smad signaling.
Exp. Cell Res.
317
,
221
233
.
Yu
P. B.
,
Hong
C. C.
,
Sachidanandan
C.
,
Babitt
J. L.
,
Deng
D. Y.
,
Hoyng
S. A.
,
Lin
H. Y.
,
Bloch
K. D.
,
Peterson
R. T.
(
2008
).
Dorsomorphin inhibits BMP signals required for embryogenesis and iron metabolism.
Nat. Chem. Biol.
4
,
33
41
.
Zheng
W.
,
Huang
L.
,
Wei
Z. B.
,
Silvius
D.
,
Tang
B.
,
Xu
P. X.
(
2003
).
The role of Six1 in mammalian auditory system development.
Development
130
,
3989
4000
.

Supplementary information