Recent advances in the study of microRNAs indicate that they have an important role in regulating cellular activities such as proliferation, morphogenesis, apoptosis and differentiation by regulating the expression of various genes. MiR-199a-3p is highly expressed in hair follicles and in some tumor cells, suggesting its participation in tumor progression, but it is significantly underexpressed in hepatocellular carcinoma and in bladder cancer. The mechanism underlying these effects is not yet known. Here, we dissect the effects of miR-199a-3p on YPEN-1 endothelial cells, and MDA-MB-231 and MT-1 breast cancer cell lines. We found that expression of miR-199a-3p promotes proliferation and survival of endothelial cells as well as breast cancer cells. Remarkably, miR-199a-3p inhibited both endogenous caveolin-2 activity and exogenous caveolin-2 activity, which was confirmed by a reporter construct bearing the 3′-untranslated region of caveolin-2. However, overexpression of caveolin-2 completely counteracted the enhancement of miR-199a-3p-mediated activities on cell proliferation, survival and sensitivity of tumor cells to anticancer drugs. Our findings suggest that MiR-199a-3p targeting of caveolin-2 might have an important role in breast cancer tumor progression, making it a potential candidate for intervention in cancer.

Introduction

MicroRNAs (miRNAs) are a new class of small non-coding endogenous RNA molecules approximately 22 nucleotides in length. They are transcribed from genomic DNA as long primary transcripts (pri-miRNAs), which are then modified by RNase-III-type enzymes Drosha and Dicer to produce pre-miRNAs and subsequently mature miRNAs (Lee et al., 2004; Mansfield et al., 2004). miRNAs can function as a guide molecule in post-transcriptional repression of protein synthesis by partially pairing with the 3′-untranslated region (UTR) of target mRNAs (Seitz et al., 2003). miRNAs have key roles in diverse regulatory pathways, including control of development (Shan et al., 2009; Wienholds et al., 2005; Zhao et al., 2005), cell proliferation (Corney et al., 2007; Fang et al., 2011; Johnson et al., 2007), differentiation (Kahai et al., 2009; Li and Carthew, 2005; Naguibneva et al., 2006; Wang et al., 2008), apoptosis (Chan et al., 2005; Chen and Stallings, 2007), cell cycle progression (Brennecke et al., 2003; O'Donnell et al., 2005), immune response (Stern-Ginossar et al., 2007; Wu et al., 2007), protein secretion (Mello and Czech, 2004; Poy et al., 2004), and many other physiological and pathological processes (Hansen et al., 2007; Wu et al., 2007).

A recent study demonstrated that more than 50% of miRNA genes are located in cancer-associated genomic regions or in fragile sites, suggesting that miRNAs have an important role in the pathogenesis of cancers (Calin et al., 2004). Some studies have also found that miRNAs might function as oncogenes or tumor suppressor genes (Zhang et al., 2007). Normally, oncogenic miRNAs are overexpressed in cancers and they can target tumor suppressor genes, whereas tumor-suppressor-like miRNAs are underexpressed in cancers and they might target oncogenes.

MiRNA-199 was determined by computer analysis of mouse and Fugu rubripes sequences by Lim and colleagues in 2003 (Lim et al., 2003). In the same year, it was cloned from the human osteoblast sarcoma cell line Saos-2 and identified from mouse skin cells (Lagos-Quintana et al., 2003). The two putative hairpin precursors reside in chromosome 19 and chromosome 1 in the human genome. More recent microarray analysis revealed that miR-199a-3p is highly expressed in hair follicles (Yi et al., 2006) and in some tumor cells (such as ovarian and breast cancer cells) (Chen et al., 2008), suggesting its possible involvement in tumor progression, but it was also significantly underexpressed in hepatocellular carcinoma (Murakami et al., 2006) and in bladder cancer (Ichimi et al., 2009). The published work suggests that miR-199a is involved in cancer development directly or indirectly by targeting cancer oncogenes or tumor suppressors, or both. This study was designed to investigate the functional role of miR-199a in normal cells, as well as in neoplastic cells. Although miR-199a precursor produces mature miRNAs miR-199a-5p and miR-199a-3p, here we focused on miR-199a-3p because it potentially targets caveolin-2, a protein that is involved in cell cycle progression.

Caveolin-2 is a scaffolding protein of the caveolae family that coats plasma membrane invaginations. As the key structural protein that organizes caveolae, caveolins have been shown to have an important role in regulating endocytosis and other aspects of cellular signaling (Krajewska and Maslowska, 2004; Williams and Lisanti, 2004). Caveolins interact directly with a number of caveolae-associated signaling molecules, such as H-Ras, hetero-trimeric G-proteins, epidermal growth factor receptor, protein kinase C, Src-family tyrosine kinases and nitric oxide synthase isoforms. It has been documented that caveolin-binding can effectively inhibit the enzymatic activity of these signaling molecules. Compared with the other two members of the caveolin family, caveolin-1 and caveolin-3, the role of caveolin-2 is less well defined. Recent studies have alluded to cell- and tissue-specific roles of caveolin-2. There is also evidence that caveolin-2 can regulate proliferation of lung endothelial cells and rat fibroblast cell line Hirc-B (Kim and Pak, 2005; Kwon et al., 2009a; Kwon et al., 2009b). Caveolin-2 was shown to be expressed at high levels in normal breast-like cancer and in the majority of basal-like cancer (Perou et al., 2000), but at low levels in non-microdissected breast cancer. In fact, levels of caveolin-2 were found to be inversely correlated with tumor size (Sagara et al., 2004).

Results

The effect of miR-199a-3p on cell proliferation

We examined miR-199a-3p expression in human breast carcinoma tissue and found that miR-199a-3p was expressed at higher levels in carcinoma tissue than in normal breast tissue or tissue adjacent to the tumor, using RNAs purchased from Ambion (Applied Biosystems/Ambion, Austin, TX) (supplementary material Fig. S1A). To study the role of miR-199a-3p, we generated a construct expressing the miR-199a precursor, which can produce both miR-199a-3p and miR-199a-5p (Fig. 1A, supplementary material Fig. S1B). The construct was transfected into a number of cell lines including YPEN-1 cells and MT-1 and MDA-MB-231 breast carcinoma cell lines. We have successfully used this plasmid to express different miRNAs in vitro (Lee et al., 2007; Wang et al., 2008). Analysis of miR-199a-3p expression was performed by RT-PCR and real-time PCR. We detected increased expression of miR-199a-3p in both cell types to different levels, perhaps because of varying transfection and expression efficiency (Fig. 1B,C).

We tested the roles of miR-199a-3p in regulating cell growth. Cells stably transfected with miR-199a were subjected to proliferation assays along with cells transfected with an empty vector, which thus acted as a control. Cell proliferation was determined by MTT and cell number counting on the second and third days after cell inoculation. The experiments revealed that expression of miR-199a-3p increased proliferative activity of endothelial cells and breast cancer cells (Fig. 2A–C).

We generated an anti-miR-199a-3p expression construct to study the activity of endogenous miR-199a-3p in cell proliferation. Stable transfection of anti-miR-199a-3p plasmid into breast cancer cells MB-231 and MT1 originally expressing moderate and high levels of miR-199a-3p, respectively, led to suppression of proliferative activity (Fig. 2D). Anti-miR-199a-3p exerted a similar effect on cell survival, and this was observed in transient transfection of the anti-miR-199a-3p plasmid into YPEN-1 cells, and MB-231 and MT-1 breast cancer cells (Fig. 2E, supplementary material Fig. S2).

In wound healing assays there was no difference observed in the migration of YPEN-1 cells between vector-transfected and miR-199a-3p-transfected cells. However, the miR-199a-3p-transfected MB-231 cells migrated into the wound areas much faster than the vector-transfected cells (supplementary material Fig. S3).

Effect of miR-199a-3p on expression of Cav-2

To identify the potential targets of miR-199a-3p that would facilitate cell growth, we used bioinformatic search tools (PicTar, Berlin), and found that a great number of genes could be potential targets of miR-199a-3p. Caveolin-2 was selected for analysis. Computational screening showed that there were two potential target sites of miR-199a-3p in the 3′UTR of rat (GenBank accession number NM_131914) and human (GenBank accession number NM_001233) caveolin-2. Caveolin-2 is a member of a family of scaffolding proteins that coats plasma membrane invaginations (caveolae). The two potential target sites for mir-199a-3p interaction are located at the nucleotides 627–649 and 664–684 of rat caveoloin-2 3′UTR (Fig. 3A) and at the nucleotides 887–918 and 1476–1500 of human caveolin-2 (Fig. 3B). Because expression of miR-199a-3p had similar roles in rat and human cell lines, the conserved target sites in rat and human suggests that caveolin-2 can potentially mediate miR-199a-3p functions in cell proliferation.

Fig. 1.

Construction and expression of miR-199a-3p. (A) Diagram of a construct expressing GFP, a neomycin-resistance gene, and two hairpin structures of pre-miR-199a-3p. Two restriction sites (underlined), two pre-miR-199a-3p (capital letters), a linker (lowercase), and the termination sequence (tttttt) are shown. (B) RT-PCR of pre-miR-199a-3p using RNA prepared from YPEN-1 endothelial cells stably transfected with miR-199a and a control vector, confirming expression of pre-miR-199a-3p. GAPDH was amplified as a control. (C) Graph of results from real-time PCR of mature miR-199a-3p from breast cancer cell line MB-231 confirming proper processing of miR-199a-3p. Error bars represent s.d.; *P<0.05.

Fig. 1.

Construction and expression of miR-199a-3p. (A) Diagram of a construct expressing GFP, a neomycin-resistance gene, and two hairpin structures of pre-miR-199a-3p. Two restriction sites (underlined), two pre-miR-199a-3p (capital letters), a linker (lowercase), and the termination sequence (tttttt) are shown. (B) RT-PCR of pre-miR-199a-3p using RNA prepared from YPEN-1 endothelial cells stably transfected with miR-199a and a control vector, confirming expression of pre-miR-199a-3p. GAPDH was amplified as a control. (C) Graph of results from real-time PCR of mature miR-199a-3p from breast cancer cell line MB-231 confirming proper processing of miR-199a-3p. Error bars represent s.d.; *P<0.05.

To test targeting of caveolin-2 by miR-199a-3p, we examined caveolin-2 expression in cells stably transfected with miR-199a using an anti-caveolin-2 monoclonal antibody. Cell lysates from miR-199a- and vector-transfected YPEN-1 and MB-231 cells were analyzed by western blotting. We observed that caveolin-2 expression was repressed in cells transfected with miR-199a compared with vector-transfected cells (Fig. 3C). When caveolin-2 expression was assayed by immunocytochemistry staining, lower levels of caveolin-2 were observed in the miR-199a-transfected cells compared with the controls (Fig. 3D). However, transfection of MT1 cells with anti-miR-199a expression construct promoted caveolin-2 expression.

Fig. 2.

Effects of miR-199a-3p on endothelial cell proliferation. (A) YPEN-1 endothelial cells stably transfected with miR-199a or a control vector GFP were seeded on tissue culture plates and cultured for 2–3 days. Cell numbers were counted. Expression of miR-199a-3p enhanced cell proliferation. (B) Cell proliferation was also measured using MTT assay kits. Cells were incubated with MTT for either 0.5 or 1 hour. Cells expressing miR-199a-3p exhibited an increase in growth rate. Error bars represent s.d. (n=8); *P<0.01. (C) MDA-MB231 breast cancer cells stably transfected with miR-199a or a control vector GFP were seeded on tissue culture plates and cultured for 2–3 days. Cell numbers were counted. Expression of miR-199a-3p enhanced cell proliferation. Error bars represent s.d. (n=6); *P<0.01. (D) MT1and MDA-MB231 cells stably transfected with miR-199a, empty vector or anti-miR-199a-3p were seeded at a density of 1–4×105 cells per well in six-well plates, with 2 ml of culture medium containing serum. Transfection of anti-miR-199a-3p led to suppression of proliferation. Error bars represent s.d. (n=9); *P<0.05 (E) Transient transfection of anti-miR-199a-3p plasmid into endothelial and breast cancer cells for 48 hours led to suppression of cell survival. Error bars represent s.d. (n=9); *P<0.01.

Fig. 2.

Effects of miR-199a-3p on endothelial cell proliferation. (A) YPEN-1 endothelial cells stably transfected with miR-199a or a control vector GFP were seeded on tissue culture plates and cultured for 2–3 days. Cell numbers were counted. Expression of miR-199a-3p enhanced cell proliferation. (B) Cell proliferation was also measured using MTT assay kits. Cells were incubated with MTT for either 0.5 or 1 hour. Cells expressing miR-199a-3p exhibited an increase in growth rate. Error bars represent s.d. (n=8); *P<0.01. (C) MDA-MB231 breast cancer cells stably transfected with miR-199a or a control vector GFP were seeded on tissue culture plates and cultured for 2–3 days. Cell numbers were counted. Expression of miR-199a-3p enhanced cell proliferation. Error bars represent s.d. (n=6); *P<0.01. (D) MT1and MDA-MB231 cells stably transfected with miR-199a, empty vector or anti-miR-199a-3p were seeded at a density of 1–4×105 cells per well in six-well plates, with 2 ml of culture medium containing serum. Transfection of anti-miR-199a-3p led to suppression of proliferation. Error bars represent s.d. (n=9); *P<0.05 (E) Transient transfection of anti-miR-199a-3p plasmid into endothelial and breast cancer cells for 48 hours led to suppression of cell survival. Error bars represent s.d. (n=9); *P<0.01.

Interestingly, the levels of Cdc42, which, according to computational analysis, is a potential target of miR-199a-3p, were upregulated (Fig. 3E), suggesting that Cdc42 is not a true target of miR-199a-3p. A number of reports indicate that Cdc42 is involved in the molecular control of diverse cellular functions, including gene transcription, cytoskeletal organization, cell proliferation, migration and transformation (Bishop and Hall, 2000). It has been reported that caveolin-1 can function as a Cdc42 guanine nucleotide dissociation inhibitor in pancreatic β-cells, maintaining Cdc42 in an inactive state (Nevins and Thurmond, 2006). Because caveolin-1 and caveolin-2 share structural similarities and are commonly coexpressed, caveolin-2 and Cdc-42 might share a similar relationship to that observed for caveolin-1 and Cdc-42. We also analyzed caveolin-1 expression in different cell lines stably transfected with miR-199a or the control vector, but detected little difference in caveolin-1 expression (supplementary material Fig. S4). There appears to be a possible link between miR-199a-3p, caveolin-2 and Cdc42, which is that miR-199a-3p might be involved in regulation of cell proliferation, survival and cell migration by directly targeting caveolin-2, which then upregulates Cdc42 expression to exert the biological functions of miR-199a-3p.

We analyzed expression of miR-199a-3p, caveolin-2 and Cdc42 in a number of cell lines including A431, A549, C8186, HepG2, OV2008, HT1080, Jurkat, MT1 and A2058. We observed that MT1 cells expressed extremely high levels of miR-199a-3p (Fig. 4A). Interestingly, the level of caveolin-2 was the lowest, whereas the level of CDC42 was the highest in this cell line (Fig. 4B). We also observed that C8186 and A2058 expressed higher levels of miR-199a-3p, whereas the levels of caveolin-2 were lower in these cell lines than the other cell lines. This reversed co-relationship suggests that miR-199a-3p has roles in repressing caveolin-2 expression in these cell lines. To confirm the function of miR-199a-3p in repressing caveolin-2 expression, we transfected an antisense construct anti-miR-199a-3p in MT1 cells, which express extremely high levels of miR-199a-3p and detected a very high increase in caveolin-2 expression (Fig. 4C). However, the effect of anti-miR-199a-3p was not evident in MB-231 cells, possibly because these cells express low levels of miR-199a-3p to start with.

Fig. 3.

Role of miR-199a-3p in the expression of caveolin-2. (A) Computational analysis indicated that miR-199a-3p potentially targets rat caveolin-2 at nucleotides 627–649 and nucleotides 664–684. (B) miR-199a-3p was also found to target human caveolin-2 at nucleotides 887–918 and nucleotides 1476–1500. (C) Cell lysate was prepared from vector (GFP)- and miR-199a-transfected YPEN-1 and MB-231 cells, followed by western blot analysis probed with anti-caveolin-2 antibody. Expression of miR-199a repressed caveolin levels. (D) YPEN-1 and MB-231 cells were transfected with miR-199a and an empty vector, whereas MT1 cells were transfected with anti-miR-199a and an empty vector. Cells were stained for caveolin-2 expression (arrows). The miR-199a-transfected cells expressed lower levels of caveolin-2 than the vector-transfected cells did, whereas expression of the anti-miR-199a construct promoted caveolin-2 expression. (E) The cell lysate from C was also analyzed by western blot probed with anti-Cdc42 antibody. Expression of miR-199a increased Cdc42 levels.

Fig. 3.

Role of miR-199a-3p in the expression of caveolin-2. (A) Computational analysis indicated that miR-199a-3p potentially targets rat caveolin-2 at nucleotides 627–649 and nucleotides 664–684. (B) miR-199a-3p was also found to target human caveolin-2 at nucleotides 887–918 and nucleotides 1476–1500. (C) Cell lysate was prepared from vector (GFP)- and miR-199a-transfected YPEN-1 and MB-231 cells, followed by western blot analysis probed with anti-caveolin-2 antibody. Expression of miR-199a repressed caveolin levels. (D) YPEN-1 and MB-231 cells were transfected with miR-199a and an empty vector, whereas MT1 cells were transfected with anti-miR-199a and an empty vector. Cells were stained for caveolin-2 expression (arrows). The miR-199a-transfected cells expressed lower levels of caveolin-2 than the vector-transfected cells did, whereas expression of the anti-miR-199a construct promoted caveolin-2 expression. (E) The cell lysate from C was also analyzed by western blot probed with anti-Cdc42 antibody. Expression of miR-199a increased Cdc42 levels.

To directly test whether or not miR-199a-3p was able to inhibit gene expression by binding to the 3′UTR of the target mRNA in a sequence-specific manner, a luciferase construct, harboring two potential binding sites for miR-199a-3p, was generated (supplementary material Fig. S5). In addition, a mutant construct was produced wherein both potential target sites were mutated (Fig. 5A). Luciferase activity decreased significantly in the Luc-caveolin-transfected cells when co-transfected with miR-199a-3p. However, there was no significant difference in luciferase activity when cells were co-transfected with the mutated construct and miR-199a-3p (Fig. 5B).

Effect of docetaxel on MT1 breast cancer cells

It has been shown that caveolin-2 expression is associated with highly aggressive tumors such as inflammatory breast carcinoma (Van den Eynden et al., 2006), basal-like (Savage et al., 2008) and triple-negative breast carcinoma (Savage et al., 2008; Tan et al., 2008). Docetaxel has been shown to exert strong cytotoxic effects on advanced breast cancer cells (Fumoleau et al., 1996). Therefore, we investigated whether overexpression of miR-199a-3p and silencing of caveolin-2 could modulate the response of tumor cells to anticancer drug treatment.

Sensitivity to docetaxel was assessed in MT1 cells stably transfected with vector and antisense miR-199a-3p. Low concentrations of docetaxel were able to induce significant growth inhibition in cells transfected with either the empty vector or antisense miR-199a-3p. A high proportion of detached cells were observed after exposure to 1 μM and 2 μM docetaxel. The vector-transfected cells showed higher sensitivity to the drug than cells-transfected with the antisense construct (Fig. 6A). The anti-miR-199a-3p- and vector-transfected cells were also treated with 2 μM docetaxel for 0, 24, 48 and 72 hours. This time-course experiment showed that the cytotoxic effect of docetaxel (2 μM) was highly pronounced in the vector-transfected cells compared with the cells transfected with the antisense construct. Expression of the anti-miR-199a construct enhanced cell survival (supplementary material Fig. S6A).

Fig. 4.

Relationship of miR-199a-3p and caveolin-2 expression. (A) Expression of miR-199a-3p was analyzed by real-time PCR in a number of cancer cell lines as indicated. Error bars represent s.d. (B) Expression of caveolin-2 and Cdc42 were analyzed in cancer cell lines by western blot probed with anti-caveolin-2 and anti-Cdc42 antibodies. (C) Cell lysates prepared from the vector (GFP)-, miR-199a- and anti-miR-199a-transfected YPEN-1 and MT-1 cells were subjected to western blot analysis probed with anti-caveolin-2 antibody. Whereas expression of miR-199a repressed caveolin-2 levels, expression of the anti-miR-199a construct increased caveolin-2 levels.

Fig. 4.

Relationship of miR-199a-3p and caveolin-2 expression. (A) Expression of miR-199a-3p was analyzed by real-time PCR in a number of cancer cell lines as indicated. Error bars represent s.d. (B) Expression of caveolin-2 and Cdc42 were analyzed in cancer cell lines by western blot probed with anti-caveolin-2 and anti-Cdc42 antibodies. (C) Cell lysates prepared from the vector (GFP)-, miR-199a- and anti-miR-199a-transfected YPEN-1 and MT-1 cells were subjected to western blot analysis probed with anti-caveolin-2 antibody. Whereas expression of miR-199a repressed caveolin-2 levels, expression of the anti-miR-199a construct increased caveolin-2 levels.

Next, we analyzed apoptosis and cell cycle profiles of cells treated with docetaxel. Annexin-V staining demonstrated that most of the apoptotic cells in the detached fraction (Annexin-V positive, PI negative and Annexin-V positive, PI positive) were confined to the vector-transfected cells and not in the antisense-transfected cells (Fig. 6B). 14.4±1.02% of the vector-transfected cells were detected in the G2–M phase. This was accompanied by a prominent increase in sub-G1 apoptotic cells to 58±1.02%. The sub-G1 population was represented by cells displaying internucleaosomal DNA fragmentation, as well as chromatin condensation and disintegration, which are all typical features of apoptotic cells. By contrast, 27.8±0.9% of the antisense-transfected cells were found in the G2–M phase and the sub-G1 population was lower (34.4± 0.8%). These results revealed that docetaxel at a concentration of 2 μM could effectively arrest both vector-transfected and anti-miR-199a-3p-transfected MT1 cells at the G1 and G2–M phases. The dramatic increase in sub-G1 accumulation seen in vector-transfected cells that expressed high levels of miR-199a-3p and low levels of caveolin-2 demonstrates that they are much more sensitive to docetaxel treatment compared with antisense-transfected cells with reverse expression of miR-199a-3p and caveolin-2. As a result, docetaxel treatment produced more apoptotic cells in the vector-transfected cells than in the anti-miR-199a-3p-transfected cells (Fig. 6C).

Effect of caveolin-2 suppression on cell proliferative activity and cell survival

To demonstrate that high proliferative activity and survival in cells are caused by suppression of caveolin-2, four different siRNAs complementary to caveolin-2 (siRNA-Cav2) were synthesized and transfected in YPEN-1 cells (supplementary material Fig. S6B). We observed that all siRNAs were able to suppress expression of caveolin-2 (Fig. 7A) and enhance cell proliferation (Fig. 7B). These results suggest that caveolin-2 has an important role in mediating the effect of miR-199a-3p on cell activities.

We then performed rescue experiments by cloning and generating an expression construct of caveolin-2 in the expressing vector pcDNA3, producing the construct pcDNA3-Cav-2. Expression of pcDNA3-Cav-2 plasmid was confirmed by western blotting of cells transfected with the plasmid (supplementary material Fig. S6C). Analysis of cell proliferation and survival in serum-free medium indicated that exogenous expression of caveolin-2 in the miR-199a-transfected cells decreased cell growth (Fig. 7C) and survival (Fig. 7D). However, transfection with caveolin-2 or anti-miR-199a-3p construct increased caveolin-2 expression, which resulted in decreased sensitivities of the cells to docetaxel treatment. Cells expressing increased levels of caveolin-2 had a smaller population of apoptotic cells (Fig. 7E) and sub-G1 cells (Fig. 7F). These results suggest that the slower growing cells are more resistant to docetaxel-induced cell death.

Fig. 5.

Luciferase activity assays. (A) The seed regions of the miR-199a-3p potentially target sites in rat caveolin-2. Mutated regions are shown in bold. (B) Luciferase activities decreased significantly in the Cav2-luc-transfected cells when co-transfected with miR-199a-3p in three independent experiments (Assay 1, 2 and 3). The inhibition of luciferase activities by miR-199a-3p was abolished when the potential target sites were mutated. Error bars represent s.d. (n=3); **P<0.01.

Fig. 5.

Luciferase activity assays. (A) The seed regions of the miR-199a-3p potentially target sites in rat caveolin-2. Mutated regions are shown in bold. (B) Luciferase activities decreased significantly in the Cav2-luc-transfected cells when co-transfected with miR-199a-3p in three independent experiments (Assay 1, 2 and 3). The inhibition of luciferase activities by miR-199a-3p was abolished when the potential target sites were mutated. Error bars represent s.d. (n=3); **P<0.01.

Discussion

MicroRNAs have an important role in regulating cellular activities such as proliferation, morphogenesis, apoptosis and differentiation. They can profoundly affect the expression of a large number of genes that encode proteins either by degradation of mRNA through the RNA interference pathway or by inhibiting protein translation by partially pairing with the 3′UTR of target mRNAs. Recent studies have shown alterations in miR-199a-3p expression in various human cancers. MiR-199a-3p has been found to be highly expressed in ovarian and breast cancer (Chen et al., 2008), but significantly under expressed in hepatocellular carcinoma (Murakami et al., 2006) and in bladder cancer (Ichimi et al., 2009). Moreover, it was reported that miR-199a-3p is involved in tumor progression and chemoresistance in ovarian cancer by regulating IKKβ expression (Chen et al., 2008). Overexpression of miR-199a-3p was found to inhibit the invasiveness of tumor cells (Kim et al., 2008) and to modulate their sensitivity to doxorubicin-induced apoptosis in hepatocellular carcinoma (Fornari et al., 2010) by targeting the Met proto-oncogene.

In this study, we found that expression of miR-199a-3p promoted proliferation and survival of endothelial cells as well as breast cancer cells. To identify the potential targets of miR-199a-3p that would facilitate cell growth, we used bioinformatic search tools. Computational screening showed that there were two potential target sites of miR-199a-3p in the 3′UTR of rat and human caveolin-2. Caveolin-2 is a member of a family of scaffolding proteins that coat plasma membrane invaginations (caveolae). There are three members within the caveolin protein family: caveolin-1, caveolin-2 and caveolin-3 (Williams and Lisanti, 2004). Caveolin-2 is usually co-expressed with caveolin-1 in most cell types and tissues, whereas caveolin-3 expression is restricted to muscle cell types (Williams and Lisanti, 2004). Being key structural proteins that organize caveolae, caveolins have been shown to have an important role in regulating endocytosis and various aspects of cellular signaling (Krajewska and Maslowska, 2004; Williams and Lisanti, 2004). Caveolins interact directly with a number of caveolae-associated signaling molecules. In many of these cases, it has been documented that caveolin-binding can effectively inhibit the enzymatic activity of these signaling molecules in vitro. Relative to caveolin-1 and caveolin-3, the functional role of caveolin-2 is less defined. Recent studies have demonstrated cell- and tissue-specific roles of caveolin-2. For example, obvious pulmonary defects and cell hyperproliferation in caveolin-2-knockout mice suggest that caveolin-2 is involved in regulation of lung endothelial cell proliferation and differentiation. There is also evidence that caveolin-2 regulates proliferation of rat fibroblast cell line Hirc-B (Kim and Pak, 2005; Kwon et al., 2009a; Kwon et al., 2009b). Furthermore, there has been increasingly more coherent data suggesting that caveolin-2 has oncogenic effects in cancers of the breast (Elsheikh et al., 2008), prostate (Yang et al., 1998), bladder (Fong et al., 2003), oesophagus (Ando et al., 2007), thyroid, pancreas, and lung (Wikman et al., 2004). Caveolin-2 has been shown to be expressed at high levels in normal breast-like cancer and in the majority of basal-like cancer (Perou et al., 2000), but at low levels in non-microdissected breast cancer. The caveolin-2 levels were inversely correlated with tumor size (Sagara et al., 2004). These findings indicate that expression of caveolin-2 might have an important role in breast cancer tumor progression and might be correlated with tumor grade and aggressiveness. It suggests that repression of caveolin-2 expression by miR-199a-3p could have a crucial role in cancer development.

Consistent with this, it is interesting that we observed noticeable promotion of cell proliferation and survival accompanied by inhibition of caveolin-2 expression in cells transfected with miR-199a-3p compared with vector-transfected cells. The potential interaction between caveolin-2 and miR-199a-3p was confirmed by reversed expression of miR-199a-3p and caveolin-2 in a number of cell lines including A431, A549, C8186, HepG2, OV2008, HT1080, Jurkat, MT1 and A2058. Also, when the antisense construct anti-miR-199a-3p was transfected into MT1 cells, which express extremely high levels of miR-199a-3p, immense upregulation of caveolin-2 expression was detected followed by cell growth inhibition. However, anti-miR-199a-3p was not detected to affect MB-231 cells, possibly because MB-231 cells express low levels of miR-199a-3p. Finally, MiR-199a-3p was confirmed to inhibit both endogenous caveolin-2 activity and exogenous caveolin-2 activity by using a reporter construct bearing the 3′UTR of caveolin-2.

In addition, we found that inhibition of caveolin-2 expression by miR-199a-3p can modulate sensitivity of breast cancer cells to docetaxel-induced apoptosis. This is consistent with reported results showing that caveolin-2 expression is associated with highly aggressive tumors such as inflammatory (Van den Eynden et al., 2006), basal-like (Savage et al., 2008) and triple-negative breast carcinoma (Savage et al., 2008; Tan et al., 2008).

Fig. 6.

Effect of docetaxel on miR-199a-3p-mediated cell activity. (A) Sensitivity to docetaxel (0–20 μM) was assessed in MT1 cells transfected with the vector or antisense miR-199a-3p. Low concentrations of docetaxel were able to induce significant growth inhibition in both vector- and antisense-transfected cells after 24 hours of exposure. The vector-transfected cells, originally expressed high levels of miR-199a-3p but showed greater sensitivity to the drug than cells transfected with the antisense. Error bars indicate s.d. (n=9); *P<0.01. (B) Apoptosis was evaluated using flow cytometry after treating MT1 cells with 2 μM docetaxel for 48 hours. More Annexin-V positive apoptotic cells were detected in the vector-transfected cells than in the anti-miR-199-3p-transfected cells. (C) DNA content was assessed in growing cells by PI staining and FACS analysis at 48 hours after docetaxel treatment. Percentage of MT1 cells arrested in G1 and G2–M phases as well as cell cycle profile are shown. A prominent increase in subG1 accumulation was detected in the vector-transfected cells compared with cells transfected with anti-miR-199a-3p. Shown is a representation of three independent experiments.

Fig. 6.

Effect of docetaxel on miR-199a-3p-mediated cell activity. (A) Sensitivity to docetaxel (0–20 μM) was assessed in MT1 cells transfected with the vector or antisense miR-199a-3p. Low concentrations of docetaxel were able to induce significant growth inhibition in both vector- and antisense-transfected cells after 24 hours of exposure. The vector-transfected cells, originally expressed high levels of miR-199a-3p but showed greater sensitivity to the drug than cells transfected with the antisense. Error bars indicate s.d. (n=9); *P<0.01. (B) Apoptosis was evaluated using flow cytometry after treating MT1 cells with 2 μM docetaxel for 48 hours. More Annexin-V positive apoptotic cells were detected in the vector-transfected cells than in the anti-miR-199-3p-transfected cells. (C) DNA content was assessed in growing cells by PI staining and FACS analysis at 48 hours after docetaxel treatment. Percentage of MT1 cells arrested in G1 and G2–M phases as well as cell cycle profile are shown. A prominent increase in subG1 accumulation was detected in the vector-transfected cells compared with cells transfected with anti-miR-199a-3p. Shown is a representation of three independent experiments.

It has been shown that the level of caveolin-2 is high in MCF7 drug-resistant breast cancer cells (Lavie et al., 1998). However, knockdown of caveolin-2 hinders the development of drug resistance, which was demonstrated in adenocarcinoma A549 cells. Currently, one of the most effective treatments for advanced breast cancer targets microtubules. Microtubules are polymerized tubulin structures that make up the cytoskeleton, and are involved in cell locomotion, movement of organelles and mitosis. Both actin filaments and microtubules are implicated in membrane trafficking in mitotic cells (Mundy et al., 2002). Docetaxel has been shown to exert strong cytotoxic effects on advanced breast cancer cells (Fumoleau et al., 1996). At the molecular level, docetaxel acts by stabilizing tubulin heterodimers, and impairing mitosis and cell proliferation in tumors (Jordan et al., 1996). The drug also has been implicated in the induction of apoptosis through activation of components in signal transduction cascades. Recent data indicates a connection between cytoskeletal components and caveolae-regulated cellular events such as endocytosis (Parton and Richards, 2003), calcium homeostasis (Isshiki and Anderson, 2003), skeletal muscle transverse tubule formation (Parton et al., 1997), and compartmentalization of receptor-mediated signaling components (Steinberg and Brunton, 2001). According to our results, an increased sensitivity of breast cancer cells to docetaxel was observed upon both overexpression of miR-199a-3p and inhibition of caveolin-2 expression.

In summary, our data demonstrate that miR-199a-3p can enhance proliferation and survival in endothelial cells, as well as in breast cancer cells. Expression of miR-199a-3p produced remarkable inhibition of endogenous caveolin-2 expression and exogenous expression introduced by a reporter construct bearing mRNA encoding the 3′UTR region of caveolin-2. The finding of caveolin-2 as a target of miR-199a-3p is very important for a better understanding of how this miRNA contributes to cancer development. Overexpression of caveolin-2 completely counteracted miR-199a-3p-mediated enhancement of cell proliferative activity, survival and sensitivity of tumor cells to anticancer drugs. In addition, our results suggest that targeting caveolin-2 by MiR-199a-3p could have an important role in breast cancer tumor progression, which could be an interesting concept to apply to cancer intervention.

Fig. 7.

Confirmation of miR-199a-3p function by targeting caveolin-2. (A,B) YPEN-1 cells transiently transfected with the siRNA or the control oligo were grown on six-well tissue culture dishes. Downregulation of caveolin-2 was confirmed by western blotting (A). Cell proliferation was assayed (B). Transfection with siRNA enhanced cell proliferation. Error bars represent s.d. (n=6). (C,D) YPEN-1 and MD-MB-231 cells stably transfected with miR-199a were transiently transfected with caveolin-2 or a control vector, whereas MT1 cells stably transfected with GFP were transiently transfected with caveolin-2 or a control vector. Expression of caveolin-2 was confirmed by western blot probed with anti-caveolin-2 antibody (C, top). The cells were grown on six-well tissue culture dishes, followed by proliferation (C, bottom) and survival (D) assays. Transfection with caveolin-2 reversed the effect of miR-199a resulting in reduced cell proliferation and survival. *P<0.01. Error bars represent s.d. (n=3). (E) MT1 cells stably transfected with GFP were transiently transfected with caveolin-2 or a control vector, whereas MT1 cells stably transfected with anti-miR-199a-3p construct were transiently transfected with the same vector. Apoptosis was evaluated using flow cytometry after the cells were subjected to 2 μM docetaxel for 48 hours. Cells transfected with caveolin-2 and anti-miR-199a-3p were less sensitive to docetaxel-induced cell death than cells transfected with the GFP control. (F) DNA content was assessed by FACS analysis on the same cells as in E with propidium iodide staining 48 hours after docetaxel treatment. There were smaller sub-G1 populations in the cells transfected with caveolin-2 (59.5%) and anti-miR-199a-3p (50.6%) than in the cells transfected with the GFP control (78.9%).

Fig. 7.

Confirmation of miR-199a-3p function by targeting caveolin-2. (A,B) YPEN-1 cells transiently transfected with the siRNA or the control oligo were grown on six-well tissue culture dishes. Downregulation of caveolin-2 was confirmed by western blotting (A). Cell proliferation was assayed (B). Transfection with siRNA enhanced cell proliferation. Error bars represent s.d. (n=6). (C,D) YPEN-1 and MD-MB-231 cells stably transfected with miR-199a were transiently transfected with caveolin-2 or a control vector, whereas MT1 cells stably transfected with GFP were transiently transfected with caveolin-2 or a control vector. Expression of caveolin-2 was confirmed by western blot probed with anti-caveolin-2 antibody (C, top). The cells were grown on six-well tissue culture dishes, followed by proliferation (C, bottom) and survival (D) assays. Transfection with caveolin-2 reversed the effect of miR-199a resulting in reduced cell proliferation and survival. *P<0.01. Error bars represent s.d. (n=3). (E) MT1 cells stably transfected with GFP were transiently transfected with caveolin-2 or a control vector, whereas MT1 cells stably transfected with anti-miR-199a-3p construct were transiently transfected with the same vector. Apoptosis was evaluated using flow cytometry after the cells were subjected to 2 μM docetaxel for 48 hours. Cells transfected with caveolin-2 and anti-miR-199a-3p were less sensitive to docetaxel-induced cell death than cells transfected with the GFP control. (F) DNA content was assessed by FACS analysis on the same cells as in E with propidium iodide staining 48 hours after docetaxel treatment. There were smaller sub-G1 populations in the cells transfected with caveolin-2 (59.5%) and anti-miR-199a-3p (50.6%) than in the cells transfected with the GFP control (78.9%).

Materials and Methods

Generation and expression of miR-199a-3p plasmid

To study the effect of miR-199a-3p on cell function, the miR-199a-3p plasmid was generated by insertion of duplicate miR-199a-3p precursors into a mammalian expression vector, BluGFP, which contained a Bluescript backbone, a CMV promoter driving expression of green fluorescent protein (GFP), and a H1 promoter driving miR-199a-3p between the BglII and HindIII restrictions sites. In brief, the miR-199a precursor, generated by PCR was ligated into the mammalian expression vector BluGFP, as previously described (Lee et al., 2007). The sequence of the construct is given in Fig. 1A.

To define the role of endogenous miR-199a-3p in mediating cell activities, the anti-miR-199a-3p plasmid was engineered. It contained a short RNA sequence complementary to the hairpin sequence of miR-199a-3p molecule. By binding to the miR-199a-3p, the products of this plasmid inhibited miR-199a-3p functionality. In brief, two primers, antihsa-miR-199a* (5′-ccgggagatctaaccaatgtgcagactactgtattttggaaaagctttag; underlined is the anti-miR-199a-3p sequence) and EGFP-700R (5′-ctcctcgcccttgctcaccat), were synthesized. PCR was performed using these two primers and the plasmid BluGFP indicated above. The PCR product was digested with BglII and NheI to get the insert, followed by ligation with the BglII- and NheI-digested BluGFP plasmid. The resulting plasmid anti-miR-199a-3p expressed an anti-miR-199a-3p sequence and GFP unit.

Rat prostate endothelial cells (YPEN-1) and human breast carcinoma cells (MDA-MB-231) were obtained from the American Tissue Culture Collection (ATCC, Manassas, VA). MT1 cells were originally isolated from a breast cancer patient (Naundorf et al., 1992). YPEN-1 cells were grown in Iscove's modified Dulbecco's medium (IMDM), containing 5% fetal bovine serum (FBS), and antibiotics; MB-231 and MT1 cells were cultured in DMEM medium supplemented with 10% FBS, and antibiotics in a 5% CO2 atmosphere at 37°C. 3×105 cells/well in six-well culture plates were transfected with miR-199a or a control vector using Lipofectamine™ 2000 (Invitrogen). Stable transfected cells were selected by G418 antibiotic (Calbiochem, San Diego, CA) at a final concentration of 400 μg/ml. On day 15 after transfection, cells were assayed for reporter gene activity. To confirm overexpression of both pre- and mature miR-199a-3p, RT-PCR was performed using RNA isolated from cells stably transfected with miR-199a-3p and an empty vector.

Cell proliferation assays

MiR-199a- and GFP-transfected cells were seeded in six-well tissue culture plates at 1×105 cells per well. Cell numbers were counted on second and third days to determine cell number. Cell proliferation was also determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Sigma). MiR-199a- and GFP-transfected cells were grown in 96-well cell culture plates in 5% FCS medium and then the medium was replaced with 50 μl of MTT reagent (2 mg/ml) and incubated in 5% CO2 at 37°C for 0.5 and 1 hours. Afterwards, the medium was aspirated and 50 μl of dimethyl sulfoxide (DMSO, Sigma) was added to each well. The optical density was measured using a microplate reader.

For cell cycle analysis, the miR-199a- and GFP-transfected MT1 cells (3×105 cells/six-well tissue plate) were treated with 2 μM docetaxel for 48 hours. The cells were harvested, washed with ice-cold PBS, and resuspended in ice-cold 70% ethanol for 30 minutes. The cells were treated with 10 μg/ml of RNase at 37°C, then spun down and stained with 10 μg/ml of PI for 30 minutes. The DNA content was measured by flow cytometry with FlowJo software (FACS Calibur; Becton Dickinson, CA).

Cell survival assays

MiR-199a- and GFP-transfected YPEN-1, MD-MB231 and MT1 cells were seeded at a density of 2–4×105 cells per well in six-well plates respectively. After 24 hours, cells were washed twice with serum-free culture medium, and then incubated in serum-free conditions. After 3 or 5 days, cells were harvested, and the number of viable cells was determined with Trypan Blue staining.

MT1 cells stably transfected with GFP or miR-199a-3p antisense were cultured in DMEM medium supplemented with 10% FBS, and antibiotics. Docetaxel was obtained from Sanofi-Aventis Canada at a concentration of 10 mg/ml (12.6 mM) and it was used to test the sensitivity of cells to the drug at scalar concentrations from 0 to 20 μM.

After treatment with 2 μM docetaxel for 48 hours, the MT1 cells transfected with GFP and miR-199a-3p antisense were separately washed twice with cold PBS and stained with binding buffer containing fluorescein-labeled Annexin-V and with Propidium Iodide (PI) (APC Annexin V Apoptosis Detection Kit I, BD Pharmingen™) following the manufacturer's instructions. The cells that were positive for apoptosis (APC Annexin-V positive, PI negative or APC Annexin-V positive, PI positive) were analyzed by flow cytometry.

Wound-healing assay

Cells were plated at 3×105/dish in 60-mm-diameter dishes. A plastic pipette tip was drawn across the center of the plates to produce clean 1-mm-wide wound lines after the cells had reached confluence. Cell movement into the wound area was examined and photographed at different time points (3 and 24 hours) using a phase-contrast microscope. The distance between the leading edge of the migrating cells and the edge of the wound was measured to estimate cell mobility.

Putative target analysis

To examine expression of Cdc42 and caveolin-2 in miR-199a- and GFP-transfected cells, 5×105 cells were plated in 100 mm cell culture plates and incubated for 48 and 72 hours. After incubation, cells were collected and resuspended in Tris-HCl buffer, lysed using an equal volume of 4% SDS, and sonicated. Protein concentrations were measured using protein assay reagents (Bio-Rad). Cell extracts were boiled for 5 minutes and subjected to 12% SDS-PAGE, and electrophoretically transferred to a nitrocellulose membrane. Each membrane was incubated with monoclonal Cdc42 and caveolin-2 (1:500, BD) and β-actin (1:10,000, Sigma) antibodies, washed with TTBS and incubated with secondary antibody conjugated with peroxidase. The signal was then detected using chemiluminescent detection system (Pierce).

To visualize caveolin-2 expression, immunocytochemistry was performed. YPEN-1, MD-MB231 and MT1 cells were seeded at a density of 2–4×105 cells per well on glass coverslips placed in six-well plates. After 4 hours, cells were washed twice with serum-free culture medium, and then were fixed with 2% paraformaldehyde. Cells were permeabilized with 0.5% Triton X-100, washed three times and incubated for 10 minutes with 0.6% H2O2 in TBS to quench endogenous peroxidase activity. To suppress non-specific binding of IgG, cells were incubated for 20 minutes in 10% goat serum in TBS and then with antibodies against caveolin-2 (1:200, BD) overnight at 4°C. After washing in TBS, cells were incubated with biotin-conjugated secondary antibody for 45 minutes at 37°C, then with streptavadin–HRP and visualized with fresh DAB solution for 5 minutes. Counterstaining was performed with hematoxylin. Then slides were dehydrated with alcohols followed by processing in xylenes and permanent coverslip mounting. Images of ten randomly selected fields were acquired.

Luciferase assay

To determine whether miR-199a-3p is able to repress gene expression by binding to the 3′UTR of the target mRNA in a sequence-specific manner, two luciferase constructs were generated. One (Luc-Cav-2) contained the 3′UTR of caveolin-2 obtained by PCR using two primers, ratCav2-N3′SpeI (5′-gggactagtacactcagaccccaggtc-3′) and ratCav2-C3′XbaI (5′-gggaagctttctagattcttacgttgagtgttgcc-3′). The PCR products were digested with SacI and MluI and the fragment was inserted into a SacI- and MluI-digested pMir-Report Luciferase plasmid (Ambion). The other (Luc-Cav-mut) contained mutations at the putative binding site, which was generated with two primers, ratCav-2-N3′XbaI and ratCav-2-C3′SpeI-Mut (5′-gggactagtacactcagaccccaggtccaaatatttggaatgacatcaactctgttgatgtgacacaaaagctgatgacatctgttc-3′) with a similar approach.

U343 cells, a cell line that is of high efficiency for gene transfection and resistance to transfection-induced cell death, were used for luciferase activity assays as described (Jeyapalan et al., 2011; Lee et al., 2009). In brief, the cells were seeded onto 12-well tissue culture plates at a density of 1×105 cells/well and co-transfected with the luciferase report constructs and miR-199a-3p construct. The cells were then collected by trypsin and lysed with lysis buffer from Luciferase Assay Kit (Promega). Cells were centrifuged at 3000 r.p.m. for 5 minutes. Supernatant was transferred into a black 96-well plate (3×10 μl) for luciferase activity measurement and into a transparent 96-well plate (3×50 μl) for β-gal activity determination. For the luciferase activity measurement, 70 μl of luciferase assay reagent was added to each well and the luciferase activity was detected by using microplate scintillation and luminescence counter (Packard, Perkin Elmer). For the internal control of β-gal activities, 90 μl of assay reagent (4 mg/ml ONPG, 0.5 M MgSO4, β-mercaptoethanol and 0.4 M sodium phosphate buffer) was added into each well. The plate was then incubated at 37°C for 30 minutes, or until a color change was detectable. The absorbance at 410 nm was measured by using a microplate reader (Bio-Tek Instruments).

Rescue assays

To confirm that the effects of miR-199a-3p on proliferative activity and survival are caused by suppressing caveolin-2, rescue experiments were performed by using pcDNA3-caveolin-2 plasmid construct. The coding sequence of caveolin-2 was cloned by PCR using two primers, ratCave2Kozak-EcoRI (5′-ggggaattcgccgccaccatggggctggagactgagaaggcc-3′) and ratCaveC-XbaI (5′-gggtctagatcagtcatggctcagttg-3′). After digestion with restriction enzymes XbaI and EcoRI, the PCR product was inserted into XbaI- and EcoRI-digested pcDNA3.1. YPEN-1, MD-MB231 and MT1 cells stably transfected with miR-199a-3p and empty vector were seeded at a density of 2–4×105 cells per well in six-well plates. After 24 hours, cells were washed twice with serum-free culture medium, transfected with pcDNA3-Cav-2 using Lipofectamine™ 2000, and subjected to proliferation and survival assays. Cell number was determined 48 hours after transfection.

To confirm that miR199a-3p sensitizes cells subjected to docetaxel to apoptosis by suppressing caveolin-2, MT1 cells stably transfected with an empty vector and an antisense miR construct were transfected with pcDNA3-Cav-2 plasmid construct and pcDNA3 plasmid only using Lipofectamine™ 2000 followed by treatment with 2 μM docetaxel. 48 hours after treatment, cells were analyzed for apoptosis and cell cycle profile. A western blot assay was performed to check for the presence of the desired construct.

siRNA assays

To confirm that caveolin-2 has a role in mediating cell proliferation, migration and survival, four different siRNAs complementary to caveolin-2 sequences were designed and synthesized by GenePharma (Shanghai, China). YPEN-1 cells were seeded at a density of 2×105 cells per well in six-well plates, washed twice with serum-free culture medium after 24 hours after cell inoculation, and incubated with different siRNAs. The cells were harvested 48 hours after the treatment and subjected to western blotting and proliferation assays. The viable cell number was determined.

Acknowledgements

The authors thank Gisele Knowles for assistance in flow cytometry and Jennifer Yang for editing the manuscript. This work was supported by grants from Heart and Stroke Foundation of Ontario (NA6732) to B.B.Y., who is the recipient of a Career Investigator Award (CI 5958) from the Heart and Stroke Foundation of Ontario.

References

Ando
T.
,
Ishiguro
H.
,
Kimura
M.
,
Mitsui
A.
,
Mori
Y.
,
Sugito
N.
,
Tomoda
K.
,
Mori
R.
,
Harada
K.
,
Katada
T.
, et al. 
. (
2007
).
The overexpression of caveolin-1 and caveolin-2 correlates with a poor prognosis and tumor progression in esophageal squamous cell carcinoma
.
Oncol. Rep.
18
,
601
-
609
.
Bishop
A. L.
,
Hall
A.
(
2000
).
Rho GTPases and their effector proteins
.
Biochem. J.
348
,
241
-
255
.
Brennecke
J.
,
Hipfner
D. R.
,
Stark
A.
,
Russell
R. B.
,
Cohen
S. M.
(
2003
).
bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila
.
Cell
113
,
25
-
36
.
Calin
G. A.
,
Sevignani
C.
,
Dumitru
C. D.
,
Hyslop
T.
,
Noch
E.
,
Yendamuri
S.
,
Shimizu
M.
,
Rattan
S.
,
Bullrich
F.
,
Negrini
M.
, et al. 
. (
2004
).
Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers
.
Proc. Natl. Acad. Sci. USA
101
,
2999
-
3004
.
Chan
J. A.
,
Krichevsky
A. M.
,
Kosik
K. S.
(
2005
).
MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells
.
Cancer Res.
65
,
6029
-
6033
.
Chen
R.
,
Alvero
A. B.
,
Silasi
D. A.
,
Kelly
M. G.
,
Fest
S.
,
Visintin
I.
,
Leiser
A.
,
Schwartz
P. E.
,
Rutherford
T.
,
Mor
G.
(
2008
).
Regulation of IKKbeta by miR-199a affects NF-kappaB activity in ovarian cancer cells
.
Oncogene
27
,
4712
-
4723
.
Chen
Y.
,
Stallings
R. L.
(
2007
).
Differential patterns of microRNA expression in neuroblastoma are correlated with prognosis, differentiation, and apoptosis
.
Cancer Res.
67
,
976
-
983
.
Corney
D. C.
,
Flesken-Nikitin
A.
,
Godwin
A. K.
,
Wang
W.
,
Nikitin
A. Y.
(
2007
).
MicroRNA-34b and MicroRNA-34c are targets of p53 and cooperate in control of cell proliferation and adhesion-independent growth
.
Cancer Res.
67
,
8433
-
8438
.
Elsheikh
S. E.
,
Green
A. R.
,
Rakha
E. A.
,
Samaka
R. M.
,
Ammar
A. A.
,
Powe
D.
,
Reis-Filho
J. S.
,
Ellis
I. O.
(
2008
).
Caveolin 1 and Caveolin 2 are associated with breast cancer basal-like and triple-negative immunophenotype
.
Br. J. Cancer
99
,
327
-
334
.
Fang
L.
,
Deng
Z.
,
Shatseva
T.
,
Yang
J.
,
Peng
C.
,
Du
W. W.
,
Yee
A. J.
,
Ang
L. C.
,
He
C.
,
Shan
S. W.
, et al. 
. (
2011
).
MicroRNA miR-93 promotes tumor growth and angiogenesis by targeting integrin-beta8
.
Oncogene
30
,
806
-
821
.
Fong
A.
,
Garcia
E.
,
Gwynn
L.
,
Lisanti
M. P.
,
Fazzari
M. J.
,
Li
M.
(
2003
).
Expression of caveolin-1 and caveolin-2 in urothelial carcinoma of the urinary bladder correlates with tumor grade and squamous differentiation
.
Am. J. Clin. Pathol.
120
,
93
-
100
.
Fornari
F.
,
Milazzo
M.
,
Chieco
P.
,
Negrini
M.
,
Calin
G. A.
,
Grazi
G. L.
,
Pollutri
D.
,
Croce
C. M.
,
Bolondi
L.
,
Gramantieri
L.
(
2010
).
MiR-199a-3p regulates mTOR and c-Met to influence the doxorubicin sensitivity of human hepatocarcinoma cells
.
Cancer Res.
70
,
5184
-
5193
.
Fumoleau
P.
,
Chevallier
B.
,
Kerbrat
P.
,
Krakowski
Y.
,
Misset
J. L.
,
Maugard-Louboutin
C.
,
Dieras
V.
,
Azli
N.
,
Bougon
N.
,
Riva
A.
, et al. 
. (
1996
).
A multicentre phase II study of the efficacy and safety of docetaxel as first-line treatment of advanced breast cancer: report of the Clinical Screening Group of the EORTC
.
Ann. Oncol.
7
,
165
-
171
.
Hansen
T.
,
Olsen
L.
,
Lindow
M.
,
Jakobsen
K. D.
,
Ullum
H.
,
Jonsson
E.
,
Andreassen
O. A.
,
Djurovic
S.
,
Melle
I.
,
Agartz
I.
, et al. 
. (
2007
).
Brain expressed microRNAs implicated in schizophrenia etiology
.
PLoS ONE
2
,
e873
.
Ichimi
T.
,
Enokida
H.
,
Okuno
Y.
,
Kunimoto
R.
,
Chiyomaru
T.
,
Kawamoto
K.
,
Kawahara
K.
,
Toki
K.
,
Kawakami
K.
,
Nishiyama
K.
, et al. 
. (
2009
).
Identification of novel microRNA targets based on microRNA signatures in bladder cancer
.
Int. J. Cancer
125
,
345
-
352
.
Isshiki
M.
,
Anderson
R. G.
(
2003
).
Function of caveolae in Ca2+ entry and Ca2+-dependent signal transduction
.
Traffic
4
,
717
-
723
.
Jeyapalan
Z.
,
Deng
Z.
,
Shatseva
T.
,
Fang
L.
,
He
C.
,
Yang
B. B.
(
2011
).
Expression of CD44 3′-untranslated region regulates endogenous microRNA functions in tumorigenesis and angiogenesis
.
Nucleic Acids Res.
39
,
3026
-
3041
.
Johnson
C. D.
,
Esquela-Kerscher
A.
,
Stefani
G.
,
Byrom
M.
,
Kelnar
K.
,
Ovcharenko
D.
,
Wilson
M.
,
Wang
X.
,
Shelton
J.
,
Shingara
J.
, et al. 
. (
2007
).
The let-7 microRNA represses cell proliferation pathways in human cells
.
Cancer Res.
67
,
7713
-
7722
.
Jordan
M. A.
,
Wendell
K.
,
Gardiner
S.
,
Derry
W. B.
,
Copp
H.
,
Wilson
L.
(
1996
).
Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death
.
Cancer Res.
56
,
816
-
825
.
Kahai
S.
,
Lee
S. C.
,
Lee
D. Y.
,
Yang
J.
,
Li
M.
,
Wang
C. H.
,
Jiang
Z.
,
Zhang
Y.
,
Peng
C.
,
Yang
B. B.
(
2009
).
MicroRNA miR-378 regulates nephronectin expression modulating osteoblast differentiation by targeting GalNT-7
.
PLoS ONE
4
,
e7535
.
Kim
S.
,
Pak
Y.
(
2005
).
Caveolin-2 regulation of the cell cycle in response to insulin in Hirc-B fibroblast cells
.
Biochem. Biophys. Res. Commun.
330
,
88
-
96
.
Kim
S.
,
Lee
U. J.
,
Kim
M. N.
,
Lee
E. J.
,
Kim
J. Y.
,
Lee
M. Y.
,
Choung
S.
,
Kim
Y. J.
,
Choi
Y. C.
(
2008
).
MicroRNA miR-199a* regulates the MET proto-oncogene and the downstream extracellular signal-regulated kinase 2 (ERK2)
.
J. Biol. Chem.
283
,
18158
-
18166
.
Krajewska
W. M.
,
Maslowska
I.
(
2004
).
Caveolins: structure and function in signal transduction
.
Cell. Mol. Biol. Lett.
9
,
195
-
220
.
Kwon
H.
,
Jeong
K.
,
Hwang
E. M.
,
Park
J. Y.
,
Hong
S. G.
,
Choi
W. S.
,
Pak
Y.
(
2009a
).
Caveolin-2 regulation of STAT3 transcriptional activation in response to insulin
.
Biochim. Biophys. Acta
1793
,
1325
-
1333
.
Kwon
H.
,
Jeong
K.
,
Pak
Y.
(
2009b
).
Identification of pY19-caveolin-2 as a positive regulator of insulin-stimulated actin cytoskeleton-dependent mitogenesis
.
J. Cell. Mol. Med.
13
,
1549
-
1564
.
Lagos-Quintana
M.
,
Rauhut
R.
,
Meyer
J.
,
Borkhardt
A.
,
Tuschl
T.
(
2003
).
New microRNAs from mouse and human
.
RNA
9
,
175
-
179
.
Lavie
Y.
,
Fiucci
G.
,
Liscovitch
M.
(
1998
).
Up-regulation of caveolae and caveolar constituents in multidrug-resistant cancer cells
.
J. Biol. Chem.
273
,
32380
-
32383
.
Lee
D. Y.
,
Deng
Z.
,
Wang
C. H.
,
Yang
B. B.
(
2007
).
MicroRNA-378 promotes cell survival, tumor growth, and angiogenesis by targeting SuFu and Fus-1 expression
.
Proc. Natl. Acad. Sci. USA
104
,
20350
-
20355
.
Lee
D. Y.
,
Shatseva
T.
,
Jeyapalan
Z.
,
Du
W. W.
,
Deng
Z.
,
Yang
B. B.
(
2009
).
A 3′-untranslated region (3′UTR) induces organ adhesion by regulating miR-199a* functions
.
PLoS ONE
4
,
e4527
.
Lee
Y. S.
,
Nakahara
K.
,
Pham
J. W.
,
Kim
K.
,
He
Z.
,
Sontheimer
E. J.
,
Carthew
R. W.
(
2004
).
Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways
.
Cell
117
,
69
-
81
.
Li
X.
,
Carthew
R. W.
(
2005
).
A microRNA mediates EGF receptor signaling and promotes photoreceptor differentiation in the Drosophila eye
.
Cell
123
,
1267
-
1277
.
Lim
L. P.
,
Lau
N. C.
,
Weinstein
E. G.
,
Abdelhakim
A.
,
Yekta
S.
,
Rhoades
M. W.
,
Burge
C. B.
,
Bartel
D. P.
(
2003
).
The microRNAs of Caenorhabditis elegans
.
Genes Dev.
17
,
991
-
1008
.
Mansfield
J. H.
,
Harfe
B. D.
,
Nissen
R.
,
Obenauer
J.
,
Srineel
J.
,
Chaudhuri
A.
,
Farzan-Kashani
R.
,
Zuker
M.
,
Pasquinelli
A. E.
,
Ruvkun
G.
, et al. 
. (
2004
).
MicroRNA-responsive ‘sensor’ transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression
.
Nat. Genet.
36
,
1079
-
1083
.
Mello
C. C.
,
Czech
M. P.
(
2004
).
Micromanaging insulin secretion
.
Nat. Med.
10
,
1297
-
1298
.
Mundy
D. I.
,
Machleidt
T.
,
Ying
Y. S.
,
Anderson
R. G.
,
Bloom
G. S.
(
2002
).
Dual control of caveolar membrane traffic by microtubules and the actin cytoskeleton
.
J. Cell Sci.
115
,
4327
-
4339
.
Murakami
Y.
,
Yasuda
T.
,
Saigo
K.
,
Urashima
T.
,
Toyoda
H.
,
Okanoue
T.
,
Shimotohno
K.
(
2006
).
Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues
.
Oncogene
25
,
2537
-
2545
.
Naguibneva
I.
,
Ameyar-Zazoua
M.
,
Polesskaya
A.
,
Ait-Si-Ali
S.
,
Groisman
R.
,
Souidi
M.
,
Cuvellier
S.
,
Harel-Bellan
A.
(
2006
).
The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation
.
Nat. Cell Biol.
8
,
278
-
284
.
Naundorf
H.
,
Rewasowa
E. C.
,
Fichtner
I.
,
Buttner
B.
,
Becker
M.
,
Gorlich
M.
(
1992
).
Characterization of two human mammary carcinomas, MT-1 and MT-3, suitable for in vivo testing of ether lipids and their derivatives
.
Breast Cancer Res. Treat.
23
,
87
-
95
.
Nevins
A. K.
,
Thurmond
D. C.
(
2006
).
Caveolin-1 functions as a novel Cdc42 guanine nucleotide dissociation inhibitor in pancreatic beta-cells
.
J. Biol. Chem.
281
,
18961
-
18972
.
O'Donnell
K. A.
,
Wentzel
E. A.
,
Zeller
K. I.
,
Dang
C. V.
,
Mendell
J. T.
(
2005
).
c-Myc-regulated microRNAs modulate E2F1 expression
.
Nature
435
,
839
-
843
.
Parton
R. G.
,
Richards
A. A.
(
2003
).
Lipid rafts and caveolae as portals for endocytosis: new insights and common mechanisms
.
Traffic
4
,
724
-
738
.
Parton
R. G.
,
Way
M.
,
Zorzi
N.
,
Stang
E.
(
1997
).
Caveolin-3 associates with developing T-tubules during muscle differentiation
.
J. Cell Biol.
136
,
137
-
154
.
Perou
C. M.
,
Sorlie
T.
,
Eisen
M. B.
,
van de Rijn
M.
,
Jeffrey
S. S.
,
Rees
C. A.
,
Pollack
J. R.
,
Ross
D. T.
,
Johnsen
H.
,
Akslen
L. A.
, et al. 
. (
2000
).
Molecular portraits of human breast tumours
.
Nature
406
,
747
-
752
.
Poy
M. N.
,
Eliasson
L.
,
Krutzfeldt
J.
,
Kuwajima
S.
,
Ma
X.
,
Macdonald
P. E.
,
Pfeffer
S.
,
Tuschl
T.
,
Rajewsky
N.
,
Rorsman
P.
, et al. 
. (
2004
).
A pancreatic islet-specific microRNA regulates insulin secretion
.
Nature
432
,
226
-
230
.
Sagara
Y.
,
Mimori
K.
,
Yoshinaga
K.
,
Tanaka
F.
,
Nishida
K.
,
Ohno
S.
,
Inoue
H.
,
Mori
M.
(
2004
).
Clinical significance of Caveolin-1, Caveolin-2 and HER2/neu mRNA expression in human breast cancer
.
Br. J. Cancer
91
,
959
-
965
.
Savage
K.
,
Leung
S.
,
Todd
S. K.
,
Brown
L. A.
,
Jones
R. L.
,
Robertson
D.
,
James
M.
,
Parry
S.
,
Rodrigues Pinilla
S. M.
,
Huntsman
D.
, et al. 
. (
2008
).
Distribution and significance of caveolin 2 expression in normal breast and invasive breast cancer: an immunofluorescence and immunohistochemical analysis
.
Breast Cancer Res. Treat.
110
,
245
-
256
.
Seitz
H.
,
Youngson
N.
,
Lin
S. P.
,
Dalbert
S.
,
Paulsen
M.
,
Bachellerie
J. P.
,
Ferguson-Smith
A. C.
,
Cavaille
J.
(
2003
).
Imprinted microRNA genes transcribed antisense to a reciprocally imprinted retrotransposon-like gene
.
Nat. Genet.
34
,
261
-
262
.
Shan
S. W.
,
Lee
D. Y.
,
Deng
Z.
,
Shatseva
T.
,
Jeyapalan
Z.
,
Du
W. W.
,
Zhang
Y.
,
Xuan
J. W.
,
Yee
S. P.
,
Siragam
V.
, et al. 
. (
2009
).
MicroRNA MiR-17 retards tissue growth and represses fibronectin expression
.
Nat. Cell Biol.
11
,
1031
-
1038
.
Steinberg
S. F.
,
Brunton
L. L.
(
2001
).
Compartmentation of G protein-coupled signaling pathways in cardiac myocytes
.
Annu. Rev. Pharmacol. Toxicol.
41
,
751
-
773
.
Stern-Ginossar
N.
,
Elefant
N.
,
Zimmermann
A.
,
Wolf
D. G.
,
Saleh
N.
,
Biton
M.
,
Horwitz
E.
,
Prokocimer
Z.
,
Prichard
M.
,
Hahn
G.
, et al. 
. (
2007
).
Host immune system gene targeting by a viral miRNA
.
Science
317
,
376
-
381
.
Tan
D. S.
,
Marchio
C.
,
Jones
R. L.
,
Savage
K.
,
Smith
I. E.
,
Dowsett
M.
,
Reis-Filho
J. S.
(
2008
).
Triple negative breast cancer: molecular profiling and prognostic impact in adjuvant anthracycline-treated patients
.
Breast Cancer Res. Treat.
111
,
27
-
44
.
Van den Eynden
G. G.
,
Van Laere
S. J.
,
Van der Auwera
I.
,
Merajver
S. D.
,
Van Marck
E. A.
,
van Dam
P.
,
Vermeulen
P. B.
,
Dirix
L. Y.
,
van Golen
K. L.
(
2006
).
Overexpression of caveolin-1 and -2 in cell lines and in human samples of inflammatory breast cancer
.
Breast Cancer Res. Treat.
95
,
219
-
228
.
Wang
C. H.
,
Lee
D. Y.
,
Deng
Z.
,
Jeyapalan
Z.
,
Lee
S. C.
,
Kahai
S.
,
Lu
W. Y.
,
Zhang
Y.
,
Yang
B. B.
(
2008
).
MicroRNA miR-328 regulates zonation morphogenesis by targeting CD44 expression
.
PLoS ONE
3
,
e2420
.
Wienholds
E.
,
Kloosterman
W. P.
,
Miska
E.
,
Alvarez-Saavedra
E.
,
Berezikov
E.
,
de Bruijn
E.
,
Horvitz
H. R.
,
Kauppinen
S.
,
Plasterk
R. H.
(
2005
).
MicroRNA expression in zebrafish embryonic development
.
Science
309
,
310
-
311
.
Wikman
H.
,
Seppanen
J. K.
,
Sarhadi
V. K.
,
Kettunen
E.
,
Salmenkivi
K.
,
Kuosma
E.
,
Vainio-Siukola
K.
,
Nagy
B.
,
Karjalainen
A.
,
Sioris
T.
, et al. 
. (
2004
).
Caveolins as tumour markers in lung cancer detected by combined use of cDNA and tissue microarrays
.
J. Pathol.
203
,
584
-
593
.
Williams
T. M.
,
Lisanti
M. P.
(
2004
).
The Caveolin genes: from cell biology to medicine
.
Ann. Med.
36
,
584
-
595
.
Wu
H.
,
Neilson
J. R.
,
Kumar
P.
,
Manocha
M.
,
Shankar
P.
,
Sharp
P. A.
,
Manjunath
N.
(
2007
).
miRNA profiling of naive, effector and memory CD8 T cells
.
PLoS ONE
2
,
e1020
.
Yang
G.
,
Truong
L. D.
,
Timme
T. L.
,
Ren
C.
,
Wheeler
T. M.
,
Park
S. H.
,
Nasu
Y.
,
Bangma
C. H.
,
Kattan
M. W.
,
Scardino
P. T.
, et al. 
. (
1998
).
Elevated expression of caveolin is associated with prostate and breast cancer
.
Clin. Cancer Res.
4
,
1873
-
1880
.
Yi
R.
,
O'Carroll
D.
,
Pasolli
H. A.
,
Zhang
Z.
,
Dietrich
F. S.
,
Tarakhovsky
A.
,
Fuchs
E.
(
2006
).
Morphogenesis in skin is governed by discrete sets of differentially expressed microRNAs
.
Nat. Genet.
38
,
356
-
362
.
Zhang
B.
,
Pan
X.
,
Cobb
G. P.
,
Anderson
T. A.
(
2007
).
microRNAs as oncogenes and tumor suppressors
.
Dev. Biol.
302
,
1
-
12
.
Zhao
Y.
,
Samal
E.
,
Srivastava
D.
(
2005
).
Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis
.
Nature
436
,
214
-
220
.

Supplementary information