Dual localization of proteins in the cell has appeared in recent years to be a more abundant phenomenon than previously reported. One of the mechanisms by which a single translation product is distributed between two compartments, involves retrograde movement of a subset of processed molecules back through the organelle-membrane. Here, we investigated the specific contribution of the mitochondrial targeting sequence (MTS), as a cis element, in the distribution of two proteins, aconitase and fumarase. Whereas the cytosolic presence of fumarase is obvious, the cytosolic amount of aconitase is minute. Therefore, we created (1) MTS-exchange mutants, exchanging the MTS of aconitase and fumarase with each other as well as with those of other proteins and, (2) a set of single mutations, limited to the MTS of these proteins. Distribution of both proteins is affected by mutations, a fact particularly evident for aconitase, which displays extraordinary amounts of processed protein in the cytosol. Thus, we show for the first time, that the MTS has an additional role beyond targeting: it determines the level of retrograde movement of proteins back into the cytosol. Our results suggest that the translocation rate and folding of proteins during import into mitochondria determines the extent to which molecules are withdrawn back into the cytosol.

Introduction

The phenomenon of dual localization of a single translation product in cells has been the subject of a significant number of reports in recent years (reviewed in Karniely and Pines, 2005; Regev-Rudzki et al., 2005). Yet, understanding the various mechanisms that determine the dual localization (distribution) of these single-translation products is far from being achieved. Two known distributed proteins are the tricarboxylic acid (TCA) cycle enzymes aconitase and fumarase. Both proteins are single-translation products, and are distributed in yeast between the cytosol and mitochondria in extremely different patterns. Whereas the cytosolic presence of fumarase is obvious – more than 50% of the protein's molecules are localized in the cytosol (Sass et al., 2001), the cytosolic amount of aconitase is minute (less than 5%) – a situation that has been termed `eclipsed distribution' (Regev-Rudzki et al., 2005; Regev-Rudzki and Pines, 2007; Shlevin et al., 2007). Aconitase [citrate (isocitrate) hydroxylase] employs a [4Fe-4S] cluster to catalyze the stereospecific dehydration-rehydration of citrate to isocitrate via cis-aconitate in both: the TCA cycle of the mitochondria and in the glyoxylate shunt in the cytosol (Beinert et al., 1996; Regev-Rudzki et al., 2005). The glyoxylate shunt enables plant and fungal cells to make four-carbon organic compounds out of two-carbon compounds, thereby allowing them to grow on acetate, ethanol or oleate as their carbon source. The enzyme fumarase (fumarate hydratase) catalyzes the conversion of L-malic acid to fumaric acid. The cytosolic fumarase was suggested to participate in the urea cycle and in metabolism of amino acids (aa) (Ratner et al., 1953).

Studies on the distribution mechanism, particularly of fumarase, reveal that the protein is partially imported into mitochondria so that the N-terminal mitochondrial targeting sequence (MTS) is cleaved by the mitochondrial processing peptidase (MPP). Only after cleavage of the MTS in the mitochondrial matrix, does a subpopulation of the molecules move back by retrograde translocation into the cytosol. This results in dual localization of identically processed proteins in two separate locations: mitochondria and cytosol. For fumarase, the driving force for this retrograde movement, which enables cytosolic localization of processed (mature) protein, appears to be the folding of the mature protein. Such folding impedes fumarase anterograde movement and import (Knox et al., 1998; Stein et al., 1994). Indeed, throughout the coding sequence of fumarase, mutations that alter its conformation do not impair targeting to mitochondria but do cause the loss of the retrograde movement. Thus, the distribution of the protein is impaired and fumarase loses its cytosolic localization (Sass et al., 2003). Two additional lines of evidences support the notion that folding is the driving force of the retrograde movement: (1) cytosolic and mitochondrial isoenzymes of fumarase are, on the basis of mass spectrometry analysis, identical and posses no posttranslational modifications that correspond to the molecular weight of the processed protein (Sass et al., 2001; Sass et al., 2003) and, (2) the level of Hsp70 chaperones in the yeast cytosol and mitochondria affect the subcellular distribution balance (Sass et al., 2003).

Given that folding of fumarase is the driving force for its distribution and that specific MTS cleavage occurs before distribution, it would seem that the MTS is not necessary for acquiring `distribution ability'. Indeed, the MTS itself does not appear to confer `distribution capability' on a passenger protein (Eram Blachinski, Processing of the single translation product of the FUM1 gene (fumarase) and its subcellular distribution in baker's yeast. PhD thesis, Hebrew University, 2001; Karniely et al., 2006; Ratner et al., 1953; Sass et al., 2003). Nevertheless, we asked whether the MTS has a role in this retrograde driven dual distribution, a question that has not been previously addressed.

The MTSs of most mitochondrial preproteins have a typical size of about 20-50 aa residues, which usually reside within the N-terminus (Rapaport, 2003). These targeting sequences have two general features: first, enrichment in basic, hydrophobic and hydroxylated aa and, second, the ability to form an amphiphylic α-helix (Claros et al., 1997). A number of parameters are used to evaluate the characteristics of the MTS: (1) the hydrophobic moment (μH), which is used as a measure of the helical amphiphilicity and the asymmetry of the distribution of hydrophobic side chains, (2) the maximal hydrophobicity of the hydrophobic face of the helical structure (Hmax) and, (3) the number of positively charged residues within the N-terminus (von Heijne, 1986).

The information within these sequences enables the sequential recognition of the proteins by the general import machinery, the outer-membrane TOM complex and the inner-membrane TIM23 complex which in concert with the translocation motor, leads to translocation through the inner membrane into the mitochondrial matrix (Neupert, 1997). During translocation, precursor proteins are fully unfolded and threaded through the import channel (Eilers and Schatz, 1986). Nevertheless, targeting signals appear to contain more information and roles than simply targeting (Hegde and Bernstein, 2006). Variations of signal sequences that target proteins to the endoplasmic reticulum (ER) interact differently either with the translocon (Kim et al., 2002; Plath et al., 1998) or with the cleavage machinery (Kurys et al., 2000). It has been suggested that signal sequences regulate the timing of cleavage as a means of controlling protein folding, protein modification and the translocation across the ER membrane (Hegde and Bernstein, 2006).

Here, we examined the effect of the MTS on subcellular distribution of aconitase and fumarase. We found that exchange of signals and substitution-mutations within the MTS cause changes in the pattern of distribution of both proteins; By introducing specific point mutations limited only to the MTS and that do not impair (1) the targeting of the protein to mitochondria and (2) the processing of the protein in the mitochondrial matrix, we can, nevertheless, significantly remodel the typical distribution patterns. This is the first time that the MTS has been shown to have a specific role in determining the balance of (retrograde driven) dual localization, a function separate from the targeting function of this sequence.

Results

Aconitase- and fumarase-exchange MTS mutants display an altered subcellular distribution pattern

The parameters that allow mitochondrial single-translation products to distribute into additional subcellular localizations remain largely unexplored. Moreover, dual targeted mitochondrial proteins exhibit a wide variety of distribution mechanisms and patterns. As mentioned above, aconitase and fumarase demonstrate a significant difference in their distribution pattern. Fumarase has a significant cytosolic presence, whereas the cytosolic amount of aconitase is minute (Regev-Rudzki et al., 2005; Sass et al., 2001; Shlevin et al., 2007).

To investigate the significance of the MTS in the retrograde-driven distribution of these proteins (both are single-translation products), we exchanged the native MTS of these proteins with the MTS of other mitochondrial proteins and then analyzed the distribution patterns mutant proteins. We generated: (1) constructs in which the full MTS of aconitase was replaced with the full MTS of fumarase and visa versa (Table 1, mutants A and C) and, (2) chimeric constructs where the MTS of fumarase was replaced by the MTS of other mitochondrial proteins, such as Hsp60 (Table 1, mutant B), Nif3, MDH1 or Cytb2 (not shown). Initially, we chose to exchange the MTS of fumarase, a protein with a substantial cytosolic presence, with the MTSs of proteins with eclipsed or no cytosolic presence. The notion was to see whether one can convey the distribution pattern of one protein on the other by exchanging MTSs.

Table 1.

Fumarase- and aconitase-MTS-exchange-mutants

Plasmid Mutant protein MPII Score Hmax μH§ MTS sequence (3′ to 5′) Distribution Mito vs Cyt
WT-FUM1  WT-Fum1   0.9265   4.56   8.38   MLRFTNCSCKTFVKSSYKLNIRRM*NSSFRT   30:70  
A   AcoMTS-Fum1   0.9964   3.02   5.02  MLSARSAIKRPIVRGLATVSSFRT   40:60  
B   Hsp60MTS-Fum1   0.9995   4.96   8.53  MLRSSVVRSRATLRPLLRRAYSSSFRT   58:42  
WT-ACO1  WT-Aco1   0.9950   5.01   6.23   MLSARSAIKRPIVRGL * ATV   94:6  
C   FumMTS-Aco1   0.9653   4.56   8.3  MLRFTNCSCKTFVKSSYKLNIRRMNTV   50:50  
Plasmid Mutant protein MPII Score Hmax μH§ MTS sequence (3′ to 5′) Distribution Mito vs Cyt
WT-FUM1  WT-Fum1   0.9265   4.56   8.38   MLRFTNCSCKTFVKSSYKLNIRRM*NSSFRT   30:70  
A   AcoMTS-Fum1   0.9964   3.02   5.02  MLSARSAIKRPIVRGLATVSSFRT   40:60  
B   Hsp60MTS-Fum1   0.9995   4.96   8.53  MLRSSVVRSRATLRPLLRRAYSSSFRT   58:42  
WT-ACO1  WT-Aco1   0.9950   5.01   6.23   MLSARSAIKRPIVRGL * ATV   94:6  
C   FumMTS-Aco1   0.9653   4.56   8.3  MLRFTNCSCKTFVKSSYKLNIRRMNTV   50:50  

MitoProtII score (Claros et al., 1997)

Maximal hydrophobicity of the hydrophobic face of the helical structure (von Heijne, 1986)

§

Hydrophobic moment (von Heijne, 1986)

Percentage of mitochondrial and cytosolic fractions. Modifications of the amino acid sequences are in bold letters

*

, MPP cleavage site

Since our objective was to examine the effect of the MTS on retrograde-driven dual targeting, two prerequisites were applied before further analysis of the hybrid constructs (1) activity in vivo as verified by complementation of a yeast chromosomal deletion strain and, (2) full import and processing by MPP in vivo. As shown in Fig. 1A, hybrid proteins A, B and C can significantly complement the respective Aco1 or Fum1 chromosomal knockout strains (Δaco1 and Δfum1). These strains express the respective MTS-hybrid proteins and grow on galactose or on non-fermentable medium, such as ethanol-acetate medium, whereas the control Δaco1 or Δfum1 strains do not grow on these same medium. Not all the MTS-exchange hybrids exhibited activity. Nif3MTS-Fum1, Cytb2MTS-Fum1 and Mdh1MTS-Fum1 did not support growth on galactose or on ethanol-acetate (data not shown). The active MTS-exchange mutants were imported and processed efficiently as detected by labeling experiments in the presence (+) and absence (–) of carbonyl cyanide m-chlorophenylhydrazone (CCCP), which dissipates membrane potential and blocks import. As shown in Fig. 1B, in the presence of CCCP the active MTS-exchange mutants appear as higher molecular weight bands corresponding to the precursors (p) of these proteins. In the absence of CCCP, the detected mature proteins (m), are the same size as the corresponding wild-type-processed proteins (Fig. 1B), indicating that these hybrid proteins are fully processed. Worth mentioning is that the non-active mutants we examined appeared unprocessed, as detected by such metabolic labeling experiments (Nif3MTS-Fum1 is shown as an example in Fig. 1B).

The three active MTS-exchange mutants were subjected to subcellular fractionation experiments. The quality of each fractionation was monitored with antibodies against mitochondrial (Hsp60) and cytosolic (hexokinase 1, HK) markers (Fig. 1C). Exchange of the aconitase-MTS for the fumarase-MTS, incurs a highly significant increase in the cytosolic aconitase fraction (from 6% to 50% of the molecules) (mutant C, Fig. 1C and Table 1). Replacing the fumarase MTS with the MTSs of aconitase or Hsp60 caused a small (but reproducible) change in the fumarase-hybrid distribution pattern (mutants A and B, Fig. 1C); a lesser (compared with wild type) amount of fumarase was detected in the cytosol (60% and 42%, respectively, versus 70% in the wild type) (Table 1 and Fig. 1C).

Single mutations in the aconitase MTS cause a major shift to the cytosolic fraction

To further assess the impact of the MTS on protein distribution in the cell, we introduced point mutations within the MTSs of aconitase and fumarase, and analyzed their distribution patterns. As pointed out above, the MTS has two general features: enrichment of specific aa and the ability to form amphiphilic α-helices (von Heijne, 1986). Hence, we picked several candidate aa that, on one hand might have an effect on the MTS but on the other would not abolish the targeting capacity of the signal. In other words, we were in search of additional information within the MTS that can affect distribution but not targeting. In this regard, all the mutant proteins are still predicted with high probability by the MitoProtII program to be targeted to mitochondria [http://ihg.gsf.de/ihg/mitoprot.html (Claros and Vincens, 1996)] (Table 2). We mainly focused on exchanging the positively charged aa residues arginine or lysine; either removing or adding these within the aconitase and fumarase MTS aa sequences.

Table 2.

Aconitase-MTS point mutants

Plasmid Mutant protein MPII Score Hmax μH§ MTS sequence (3′ to 5′) Distribution Mito vs Cyt
WT-ACO1  WT-Aco1   0.9950   5.01   6.23   MLSARSAIKRPIVRGL*ATV   94:6  
E   MTS4Aco1   0.9968   1.86   4.80   MLSRRSAIKRPIVRGLATV   45:55  
F   MTS5Aco1   0.9933   5.82   7.93   MLSASSAIKRPIVRGLATV   92:8  
G   MTS8Aco1   0.9879   1.1   2.46   MLSARSARKRPIVRGLATV   60:40  
H   MTS9Aco1   0.9957   5.01   6.47   MLSARSAICRPIVRGLATV   63:37  
I   MTS456Aco1   0.9900   5.95   8.04   MLSTAYAIKRPIVRGLATV   58:42  
J   MTS910Aco1   0.8963   5.01   2.54   MLSARSAIPIPIVRGLATV   46:54  
K   MTS48Aco1   0.9934   –2.05   3.04   MLSRRSARKRPIVRGLATV   –  
L   MTS91014Aco1   0.3291   5.01   1.37   MLSARSAIPIPIVCGLATV   –  
Plasmid Mutant protein MPII Score Hmax μH§ MTS sequence (3′ to 5′) Distribution Mito vs Cyt
WT-ACO1  WT-Aco1   0.9950   5.01   6.23   MLSARSAIKRPIVRGL*ATV   94:6  
E   MTS4Aco1   0.9968   1.86   4.80   MLSRRSAIKRPIVRGLATV   45:55  
F   MTS5Aco1   0.9933   5.82   7.93   MLSASSAIKRPIVRGLATV   92:8  
G   MTS8Aco1   0.9879   1.1   2.46   MLSARSARKRPIVRGLATV   60:40  
H   MTS9Aco1   0.9957   5.01   6.47   MLSARSAICRPIVRGLATV   63:37  
I   MTS456Aco1   0.9900   5.95   8.04   MLSTAYAIKRPIVRGLATV   58:42  
J   MTS910Aco1   0.8963   5.01   2.54   MLSARSAIPIPIVRGLATV   46:54  
K   MTS48Aco1   0.9934   –2.05   3.04   MLSRRSARKRPIVRGLATV   –  
L   MTS91014Aco1   0.3291   5.01   1.37   MLSARSAIPIPIVCGLATV   –  

MitoProtII score (Claros et al., 1997)

Maximal hydrophobicity of the hydrophobic face of the helical structure (von Heijne, 1986)

§

Hydrophobic moment (von Heijne, 1986)

Percentage of mitochondrial and cytosolic fractions. Modifications of the amino acid sequences are in bold letters

*

, MPP cleavage site

Fig. 1.

MTS-exchange mutants. (A) Growth and complementation of aconitase and fumarase-MTS-exchange mutants. Δaco1 or Δfum1 strains harboring the indicated plasmids that encode MTS-exchange mutants were diluted and grown on galactose or ethanol-acetate medium plates as indicated (B) Aconitase- and fumarase-MTS-exchange mutants are processed. Wild-type, Δaco1 and Δfum1 strains induced for expression the indicated plasmids were labeled with [35S]methionine for 30 minutes, either in the absence (–) or presence (+) of 20 μM CCCP. Total cell extracts were prepared, immunoprecipitated with the indicated antiserum and analyzed using SDS-PAGE. Arrows show positions of precursor (p) and mature proteins (m). (C) MTS-exchange mutants exhibit alterations in the protein subcellular distribution. Yeast cells expressing aconitase and fumarase variants were subjected to subcellular fractionation. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins. Representative examples of mitochondrial (Hsp60) and cytosolic (hexokinase1, HK) controls are shown. Cytosolic and mitochondrial band intensities were quantified densitometrically using TINA Software.

Fig. 1.

MTS-exchange mutants. (A) Growth and complementation of aconitase and fumarase-MTS-exchange mutants. Δaco1 or Δfum1 strains harboring the indicated plasmids that encode MTS-exchange mutants were diluted and grown on galactose or ethanol-acetate medium plates as indicated (B) Aconitase- and fumarase-MTS-exchange mutants are processed. Wild-type, Δaco1 and Δfum1 strains induced for expression the indicated plasmids were labeled with [35S]methionine for 30 minutes, either in the absence (–) or presence (+) of 20 μM CCCP. Total cell extracts were prepared, immunoprecipitated with the indicated antiserum and analyzed using SDS-PAGE. Arrows show positions of precursor (p) and mature proteins (m). (C) MTS-exchange mutants exhibit alterations in the protein subcellular distribution. Yeast cells expressing aconitase and fumarase variants were subjected to subcellular fractionation. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins. Representative examples of mitochondrial (Hsp60) and cytosolic (hexokinase1, HK) controls are shown. Cytosolic and mitochondrial band intensities were quantified densitometrically using TINA Software.

Fig. 2.

Aconitase-MTS point mutations. (A) Growth and complementation of aconitase-MTS point mutants. Δaco1 strain harboring the indicated plasmids encoding MTS point mutants were diluted and grown on galactose or ethanol-acetate medium plates as indicated. (B) Aconitase-MTS point mutants are processed. MTS point mutants of aconitase were labeled and examined for processing as described in the legend to Fig. 1B. (C) MTS point mutants exhibit alterations in the protein subcellular distribution. Yeast cells expressing aconitase variants were subjected to subcellular fractionation. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins.

Fig. 2.

Aconitase-MTS point mutations. (A) Growth and complementation of aconitase-MTS point mutants. Δaco1 strain harboring the indicated plasmids encoding MTS point mutants were diluted and grown on galactose or ethanol-acetate medium plates as indicated. (B) Aconitase-MTS point mutants are processed. MTS point mutants of aconitase were labeled and examined for processing as described in the legend to Fig. 1B. (C) MTS point mutants exhibit alterations in the protein subcellular distribution. Yeast cells expressing aconitase variants were subjected to subcellular fractionation. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins.

We created a total of ten constructs of MTS point mutations in aconitase and three MTS point mutations in fumarase (see below). Tables 2 and 3 display aconitase-MTS mutants. Mutants MTS4Aco1, MTS5Aco1, MTS8Aco1 and MTS9Aco1 (Table 2; mutants E, F, G, H) contain substitution mutations of aa residues 4, 5, 8, 9, respectively. Mutants I and J contain substitution mutations of three or two aa (residues 4, 5, 6 and 9, 10, respectively; Table 2). Mutants MTS48Aco1 (K) and MTS91014Aco1 (L) contain substitution mutation of two and three aa (residues 4, 8 and 9, 10, 14, respectively; Table 2). In essence, in mutants E, G and K we substituted hydrophobic alanine or isolucinea with basic arginine. In the aconitase-MTS mutants F, H, I, J and L we exchanged a basic for a non-charged aa.

Table 3.

Aconitase-MTS elongation mutants

Plasmid Mutant protein MPII Score Hmax μH§ MTS sequence (3′ to 5′) Distribution Mito vs Cyt
WT-ACO1  WT-Aco1   0.9950   5.01   6.23   MLSARSAIKRPIVRGL*ATV   94:6  
N   MTS9aa Fum-Aco1   0.9989   4.26   5.78   MLSARSAIKRPIVRGYKLNIRRMNTV   50:50  
0   MTS9aa Aco-Aco1   0.9996   5.48   8.54   MLSARSAIKRPIVRGKRPIVRGLATV   40:60  
Plasmid Mutant protein MPII Score Hmax μH§ MTS sequence (3′ to 5′) Distribution Mito vs Cyt
WT-ACO1  WT-Aco1   0.9950   5.01   6.23   MLSARSAIKRPIVRGL*ATV   94:6  
N   MTS9aa Fum-Aco1   0.9989   4.26   5.78   MLSARSAIKRPIVRGYKLNIRRMNTV   50:50  
0   MTS9aa Aco-Aco1   0.9996   5.48   8.54   MLSARSAIKRPIVRGKRPIVRGLATV   40:60  

MitoProtII score (Claros et al., 1997)

Maximal hydrophobicity of the hydrophobic face of the helical structure (von Heijne, 1986)

§

Hydrophobic moment (von Heijne, 1986)

Percentage of mitochondrial and cytosolic fractions. Modifications of the amino acid sequences are in bold letters

*

, MPP cleavage site

We constructed two additional aconitase mutants in which the MTS was lengthened (Table 3) by repeating the last nine aa (9-17) of the aconitase-MTS (MTS9aaAco-Aco1, mutant O) or by adding the last fumarase-MTS 9 aa (MTS9aaFum-Aco1, mutant N). Again, all the aconitase-MTS point mutants were subjected to the two prerequisites: enzymatic activity in vivo and full processing in mitochondria. As illustrated in Fig. 2A and Fig. 3A, the MTS-mutant proteins (except mutants K and L, see below) can complement a Δaco1 chromosomal knockout strain.

To examine whether the mutant proteins are processed, yeast cells expressing them were labeled in the presence or absence of CCCP. As shown in Fig. 2B the mutants (except mutants K and L) are processed efficiently as deduced from the apparent size shift (compare p with m) of the proteins in the presence (+) or absence (–) of CCCP. These experiments indicate that, although the native MTS sequences were modified, the N-termini of these proteins were still imported into mitochondria and processed by the MPP. Two mutants MTS48Aco1 (K) and MTS91014Aco1 (L), in which the amphiphilic helix was most probably excessively damaged, were not imported and processed (Fig. 2B). Accordingly, these mutants did not fully complement the aconitase cytosolic activity in a Δaco1 strain and do not support growth on EtOH-acetate plates (Fig. 2A) (Regev-Rudzki et al., 2005).

To investigate the distribution patterns of aconitase-MTS point mutants, subcellular fractionation experiments were employed. Five out of the six active and processed aconitase-MTS mutants expressed in a Δaco1 background displayed significantly different distribution patterns. Mutants E, G, H, I and J exhibited 37-55 percent of their aconitase isoenzyme in the cytosol compared to about 6% for the wild type (Fig. 2C and Table 2). Thus, these mutations abolish the natural eclipsed distribution of aconitase without impairing processing by MPP, and cause a shift of a significant portion of the molecules from mitochondria to the cytosol. Mutant MTS5Aco1 (F) exhibited a distribution pattern similar to that of the wild type protein with more than 90% of the protein localized to mitochondria (Table 2, Fig. 2C).

Fig. 3.

Aconitase-MTS-elongated mutants. (A) Growth and complementation of aconitase-MTS elongated mutants. Δaco1 strains harboring the indicated plasmids encoding MTS elongated mutants were diluted and grown on galactose or ethanol-acetate medium plates as indicated. (B) Aconitase elongated mutants are processed. MTS-elongated mutants of aconitase were labeled and examined for processing as described in the legend to Fig. 1B. (C) Aconitase elongated mutants exhibit alterations in the protein subcellular distribution. Subcellular fractionations of yeast cells expressing aconitase elongated mutants. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins.

Fig. 3.

Aconitase-MTS-elongated mutants. (A) Growth and complementation of aconitase-MTS elongated mutants. Δaco1 strains harboring the indicated plasmids encoding MTS elongated mutants were diluted and grown on galactose or ethanol-acetate medium plates as indicated. (B) Aconitase elongated mutants are processed. MTS-elongated mutants of aconitase were labeled and examined for processing as described in the legend to Fig. 1B. (C) Aconitase elongated mutants exhibit alterations in the protein subcellular distribution. Subcellular fractionations of yeast cells expressing aconitase elongated mutants. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins.

Of interest are the constructs in which the aconitase MTS was elongated with wild-type sequences of the aconitase or the fumarase MTS. These constructs (mutants N and O, Table 3) were active and processed (Fig. 3A,B) and behaved similarly to most of the point mutations in that more protein is diverted to the cytosol (Fig. 3C). Thus, it is not simply the sequence of the MTS but also, maybe, its compatibility with the mature portion of the protein and/or possibly interaction with trans-acting elements.

Single mutations in the fumarase MTS cause a minor shift to the mitochondrial fraction

A limited but similar analysis to that described in the previous section was carried out for fumarase. Table 4 displays fumarase-MTS mutants; MTS3Fum1, MTS5Fum1 and MTS9Fum1 which are substitution mutants of aa 3, 5 and 9, respectively, in the fumarase MTS (Table 4, mutants R, S and T, respectively). In MTS5Fum1 (S) and MTS9Fum1 (T) a basic arginine replaces a non-charged aa, whereas in mutant MTS3Fum1 (R) a non-charged aa was added instead of a positively charged one.

Table 4.

Fumarase-MTS point mutants

Plasmids Mutant protein MPII Score Hmax μH§ MTS sequence (3′ to 5′) Distribution Mito vs Cyt
WT-FUM1  WT-Fum1   0.9265   4.56   8.38   MLRFTNCSCKTFVKSSYKLNIRRM*N   30:70  
R   MTS3Fum1   0.9291   4.56   6.08   MLSFTNCSCKTFVKSSYKLNIRRMN   58:42  
S   MTS5Fum1   0.9546   2.11   5.94   MLRFRNCSCKTFVKSSYKLNIRRMN   58:42  
T   MTS9Fum1   0.8856   3.04   7.33   MLRFTNCSKKTFVKSSYKLNIRRMN   50:50  
Plasmids Mutant protein MPII Score Hmax μH§ MTS sequence (3′ to 5′) Distribution Mito vs Cyt
WT-FUM1  WT-Fum1   0.9265   4.56   8.38   MLRFTNCSCKTFVKSSYKLNIRRM*N   30:70  
R   MTS3Fum1   0.9291   4.56   6.08   MLSFTNCSCKTFVKSSYKLNIRRMN   58:42  
S   MTS5Fum1   0.9546   2.11   5.94   MLRFRNCSCKTFVKSSYKLNIRRMN   58:42  
T   MTS9Fum1   0.8856   3.04   7.33   MLRFTNCSKKTFVKSSYKLNIRRMN   50:50  

MitoProtII score (Claros et al., 1997)

Maximal hydrophobicity of the hydrophobic face of the helical structure (von Heijne, 1986)

§

Hydrophobic moment (von Heijne, 1986)

Percentage of mitochondrial and cytosolic fractions. Modifications of the amino acid sequences are in bold letters

*

, MPP cleavage site

These fumarase-MTS point mutants were active similarly to the wild-type protein and can fully complement a Δfum1 chromosomal knockout strain (Fig. 4A). As shown in Fig. 4B fumarase-MTS mutants are also processed efficiently, similar to the wild-type protein; as deduced from the apparent size shift of the proteins in the presence (+) or absence (–) of CCCP. Fractionation of Δfum1 cells expressing the mutants MTS3Fum1, MTS5Fum1 and MTS9Fum1 (Table 4; mutants R, S and T, respectively), revealed a slight but reproducible enrichment of the protein in mitochondria when compared with wild-type fumarase (50-58% versus 30% respectively, Fig. 4C, Table 4).

Slowed down translocation affects the subcellular distribution of aconitase

We have previously shown that protein folding and translocation efficiency affect dual targeting of fumarase (Sass et al., 2003; Karniely et al., 2006). Prior to addressing the possibility that the MTS mutations might exert their effects through the above, we wished to rule out a more trivial possibility, which is that cytosolic aconitase and fumarase might be less stable, thereby affecting the apparent distribution of the proteins. Both fumarase and aconitase appear to be stable, as previous studies have suggested (Karniely et al., 2006; Regev-Rudzki et al., 2005; Sass et al., 2003; Shlevin et al., 2007; Yogev et al., 2007). Here we examined, using pulse-chase labeling (Fig. 5), the stability of aconitase and fumarase, and the stability of their cytosolic derivatives that lack their respective MTS (ΔMTS-Aco1 and ΔMTS-Fum1). Both fumarase and aconitase appear to be stable – in contrast to a non-stable aconitase fused to a degron (ΔMTS-Aco1-SL17), which is recognized and degraded by the ubiquitin-proteasome system (Shlevin et al., 2007). This ΔMTS-Aco1-SL17 is rapidly degraded and, within 30 minutes, is reduced to less than a half of its initial amount (Fig. 5, third panel). Additionally, it is important to note that the MTS-mutant precursors, and mature forms of aconitase and fumarase analyzed in this study also appear to be stable in vivo, as can be deduced from pulse-labeling experiments in the presence and absence of CCCP (Fig. 2B, Fig. 3B and Fig. 4B). Thus, protein turnover is not likely to be the reason for MTS-mutation effects on distribution.

Fig. 4.

Fumarase-MTS point mutations. (A) Growth and complementation of fumarase. MTS point mutants–Δfum1 strain harboring the indicated plasmids encoding MTS point mutants ware diluted and grown on galactose or ethanol-acetate medium plates as indicated. (B) Fumarase-MTS point mutants are processed. MTS point mutants of fumarase were labeled and examined for processing as described in the legend to Fig. 1B. (C) Aconitase-MTS point mutants exhibit alterations in the protein subcellular distribution. Yeast cells expressing fumarase variants were subjected to subcellular fractionation. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins.

Fig. 4.

Fumarase-MTS point mutations. (A) Growth and complementation of fumarase. MTS point mutants–Δfum1 strain harboring the indicated plasmids encoding MTS point mutants ware diluted and grown on galactose or ethanol-acetate medium plates as indicated. (B) Fumarase-MTS point mutants are processed. MTS point mutants of fumarase were labeled and examined for processing as described in the legend to Fig. 1B. (C) Aconitase-MTS point mutants exhibit alterations in the protein subcellular distribution. Yeast cells expressing fumarase variants were subjected to subcellular fractionation. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins.

Fig. 5.

Aconitase and fumarase and their cytosolic derivates are stable. Yeast strains harboring plasmids encoding the indicated proteins were induced in galactose medium and pulse-labeled with [35S]methionine-cysteine for 15 minutes, followed by a chase (addition of unlabeled methionine-cysteine and cycloheximide) for the times indicated. Total cell extracts were prepared, immunoprecipitated with aconitase or fumarase antiserum and analyzed by SDS-PAGE and autoradiography.

Fig. 5.

Aconitase and fumarase and their cytosolic derivates are stable. Yeast strains harboring plasmids encoding the indicated proteins were induced in galactose medium and pulse-labeled with [35S]methionine-cysteine for 15 minutes, followed by a chase (addition of unlabeled methionine-cysteine and cycloheximide) for the times indicated. Total cell extracts were prepared, immunoprecipitated with aconitase or fumarase antiserum and analyzed by SDS-PAGE and autoradiography.

The possibility that folding of the passenger protein is involved in dual localization is referred to in the discussion section. Here, we address the possibility that the effect of the MTS-mutations on distribution in vivo occurs through slowing down of import. We have recently shown that slowed down translocation can affect fumarase distribution (Yogev et al., 2007). Here, we asked whether the relationship between the distribution and translocation holds true for aconitase. We performed subcellular fractionations on strains harboring mutations that affect the inner and outer membrane translocases (Δmim1, tom40ts and tim23ts). These mutations have been recently shown to slow down translocation of fumarase under specific growth conditions (Waizenegger et al., 2005; Yogev et al., 2007). As shown in Fig. 6A, temperature-sensitive mutations in Tim23 and Tom40, and a deletion of Mim1, lead – under the semi permissive growth conditions (30°C) – to an apparent larger fraction of aconitase (up to 50% of the molecules) in the cytosol, when compared with wild-type cells (or corresponding wild-type strains of the tom40ts, tim23ts and Δmim1 mutants; not shown). These results indicate that mutations that affect the translocation rate can in turn change the aconitase distribution pattern.

Further evidence showing that translocation rate affects the protein distribution pattern was obtained by growth-temperature experiments. We have previously shown that, when yeast cells are grown at low temperatures, the rate of fumarase translocation into mitochondria is reduced (Yogev et al., 2007). If this is also true for aconitase, a reduction of the translocation rate at low temperatures should then affect the distribution pattern of aconitase. Wild-type S. cerevisiae was grown at 20°C or 30°C on galactose medium and examined by subcellular fractionation. As presented in Fig. 6B, cells grown at 20°C exhibit a significant presence of aconitase in the cytosol, in contrast to cells grown at 30°C.

Fig. 6.

(A) Translocation machinery mutant strains exhibit alterations in protein subcellular distribution. Indicated mutant strains were grown at the permissive temperature. The strains were subjected to subcellular fractionation. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins. (B) Growth at low temperature increases the aconitase cytosolic presence. Wild-type yeast cells were grown at 20°C or at 30°C and subjected to subcellular fractionation as described above.

Fig. 6.

(A) Translocation machinery mutant strains exhibit alterations in protein subcellular distribution. Indicated mutant strains were grown at the permissive temperature. The strains were subjected to subcellular fractionation. Equivalent portions from the total (Tot) cytosolic (Cyt) and mitochondrial (Mit) fractions were analyzed by western blotting using antibodies against the indicated proteins. (B) Growth at low temperature increases the aconitase cytosolic presence. Wild-type yeast cells were grown at 20°C or at 30°C and subjected to subcellular fractionation as described above.

To gain direct evidence that the aconitase-MTS mutations slows down the translocation process in vivo, we performed a metabolic-labeling experiment. The approach we took was first to block the mitochondrial import in vivo (using CCCP) and then reverse the import block (using DTT). Under these conditions, the fully translated precursor is accumulated in the cytosol and only then is it translocated posttranslationally. This allowed us to examine the rate of the appearance of aconitase in processed form as an indication of the translocation rate. We find that, in contrast to the wild-type protein – for which we find that 50% of the molecules are processed within 10 minutes – the MTS mutants MTS4Aco1 (E), MTS9Aco1 (H) and MTS910Aco1 (J) were hardly processed (Fig. 7). Taken together, these results suggest that slowed down translocation leads to a larger cytosolic aconitase fraction.

Discussion

At present, fumarase and aconitase serve as models for retrograde-driven dual localization (Knox et al., 1998; Regev-Rudzki et al., 2005; Regev-Rudzki and Pines, 2007). These two proteins share two common features in their distribution mechanism: (1) a single nuclear gene encodes both the mitochondrial and cytosolic forms and, (2) all the molecules are processed in mitochondria before distribution (Knox et al., 1998; Regev-Rudzki et al., 2005; Sass et al., 2001). In this study we show, for the first time (through the effect of MTS mutations) that the MTS has a role in the dual-localization of fumarase and aconitase. For aconitase it appears to be a major cis element that determines the balance between cytosolic and mitochondrial locations whereas for fumarase it is minor. The reason for this might be the relative contribution of the MTS and the mature protein sequences to distribution. As pointed out in the results section, we have shown that both folding and translocation might be important factors in determining the relative distribution of fumarase between the cytosol and mitochondria (Karniely et al., 2006; Sass et al., 2003; Yogev et al., 2007). Consistent with fumarase folding as the major cis determinant for distribution is the finding that mutations throughout the coding sequence of fumarase, that do not impair targeting to mitochondria, cause a loss in retrograde movement and distribution (Sass et al., 2003). For aconitase, however, the situation is very different because mutations and deletions within the mature sequence do not necessarily abrogate the distribution of the protein (N.R.-R., Reut Hazan and O.P., unpublished data). Thus, the folding constituent in aconitase dual targeting is probably much lower than that for fumarase.

Fig. 7.

Translocation of aconitase-MTS mutants is slower. Yeast cells expressing the indicated plasmids were incubated for 1 minute with CCCP followed by labeling for 15 minutes with [35S]methionine (in the presence of CCCP). DTT, an excess unlabeled methionine-cysteine and cycloheximide were added (start of the chase). Aliquots were taken at the indicated times, immunoprecipitated with aconitase antiserum and analyzed by SDS-PAGE. Arrows show positions of precursor (p) and mature proteins (m).

Fig. 7.

Translocation of aconitase-MTS mutants is slower. Yeast cells expressing the indicated plasmids were incubated for 1 minute with CCCP followed by labeling for 15 minutes with [35S]methionine (in the presence of CCCP). DTT, an excess unlabeled methionine-cysteine and cycloheximide were added (start of the chase). Aliquots were taken at the indicated times, immunoprecipitated with aconitase antiserum and analyzed by SDS-PAGE. Arrows show positions of precursor (p) and mature proteins (m).

Traditionally, the MTS is associated with import that includes functions of targeting to the membrane and translocation through mitochondrial translocases. The results presented in this study, are consistent with a post-targeting function (i.e. translocation) of the MTS in determining the protein subcellular distribution: (1) MTS mutants of aconitase and fumarase displaying an altered distribution are active and fully processed (suggesting no problem in targeting). (2) Regardless of whether mutations were designed to strengthen or weaken the targeting ability of the MTS (according to μH, Hmax and the MitoprotII score), they turned out to have similar effects on distribution. (3) Mutations in components of the mitochondrial translocation machinery (Tim23, Mim1, Tom40) or growth at low temperatures that slows down translocation, cause an increase in the cytosolic fraction of aconitase (this study) and fumarase (Karniely et al., 2006; Yogev et al., 2007). (4) Aconitase-MTS mutants exhibited a slower translocation rate into the mitochondria according to in vivo post-translational pulse-chase experiments. These results are consistent with the notion that MTS affects distribution through its effect on the translocation rate.

Our working hypothesis is that the folding and rate of translocation of the proteins determine the dual distribution pattern. Yet, folding and translocation rate are dependent on one another; modifying the translocation rate allows the proteins to fold and/or interact with cytosolic factors prior to translocation, thereby causing a change in their distribution.

Finally, one can not exclude the possibility that there are alternative explanations for our observations besides affects on translocation rate and folding. First, the efficiency of targeting might be subtly impaired, which in turn might affect the balance of dual targeting (even though all the relevant mutants in this study are fully processed). Second, the MTS mutations might affect an interaction with a trans-acting element, such as mitochondrial Hsp70, which has been shown to affect fumarase distribution (Karniely et al., 2006). Third, the cleaved MTS peptide might affect retrograde translocation. In this regard, an example of a post-cleavage function of a signal are cleaved ER signal peptides, which have been proposed to have a role in antigen presentation for the MHC-class I proteins (Borrego et al., 1998; Braud et al., 1998).

We suggest that during evolution the combination of signal and mature portions of fumarase have been optimized for substantial retrograde-driven cytosolic presence. Any change in either the fumarase MTS or the mature protein sequence causes less cytosolic retention. Aconitase, however, has – during evolution – been optimized for eclipsed distribution and any change in its MTS causes more cytosolic retention. How this evolutionary goal is specifically achieved and how cis- and trans-acting elements might be involved, remains to be determined in future studies.

Materials and Methods

Strains, plasmid constructs and growth conditions Strains

S. cerevisiae strains used were BY4741 (Mat a; his3Δ1; leu2Δ0; met15Δ0; ura3Δ0) and YPH499 (Mat a ura3;lys2;ade;trp1;his3;leu2), BY4742 (Mat α; his3Δ1; leu2Δ0; lys2Δ0; ura3Δ0; YLR304c::kanMX4), and BY4743 (Mat a/α; his3Δ1/his3Δ1; leu2Δ0/leu2Δ0; lys2Δ0/LYS2; MET15/met15Δ0; ura3Δ0/ura3Δ0; YLR304c::kanMX4/YLR304c). Δaco1 was obtained as previously described (Regev-Rudzki et al., 2005). Δfum1 was obtained as previously described (Sass et al., 2003). tim23ts strain was kindly provided by Abdussalam Azem (Department of Biochemistry, Tel-Aviv University, Israel), Δmim1 and tom40ts strains were kindly provided by Doron Rapaport (Department of Biochemistry, University of Tübingen, Germany).

Plasmid constructs

Mutation were created using the QuickChange®II kit (Stratagene) or PCR reactions using the indicated oligonucleotides (Table 5).

Table 5.

Oligonucleotides (5′ to 3′) used in this study

Mutant name Forward Reverse
AcoMTS-Fum1   GGGTCGACCTGCAGC   GGGTCTCTTGATGGCAGAACGTGCAGACAGCATGATTGATACTCTTATCCG  
  GCCATCAAGAGACCCATTGTTCGTGGTCTTGCGTCCTCGTTCAGAACTGAAACC   GCCTTGGAGATCTTGGG  
Hsp60MTS-Fum1   GGGTCGACCTGCAGC   GGCCTTAAAGTAGCGCGACTACGAACAACGGATGATCTCAACATGATTGTATCTCTTATCCG  
  CGTAGTCGCGCTACTTTAAGGCCTTATTGCGTCGTGCTTACTCCTCCTCGTTCAGAACTG   GCCTTGGAGATCTTGGG  
MTS4Aco1   GGATCCATGCTGTCTAGACGTTCTGCCATCAAGAGACCC   GGGTCTCTTGATGGCAGAACGTCTAGACAGCATGGATCC  
MTS5Aco1   GGATCCATGCTGTCTGCATCTTCTGCCATCAAGAGACCC   GGGTCTCTTGATGGCAGAAGATGCAGACAGCATGGATCC  
MTS8Aco1   GCTGTCTGCACGTTCTGCCCGTAAGAGACCCATTGTTCG   CGAACAATGGGTCTCTTACGGGCAGAACGTGCAGACAGC  
MTS9Aco1   GCACGTTCTGCCATCTGTAGACCCATTGTTCGTGG   CCACGAACAATGGGTCTACAGATGGCAGAACGTGC  
MTS456Aco1   CTAGTGGATCCATGCTGTCTAGATTTACCGCCATCAAGAGACCCATTG   CAATGGGTCTCTTGATGGCGGTAAATCTAGACAGCATGGATCCACTAG  
MTS910Aco1   GTCTGCACGTTCTGCCATCAAGAGACCCATTGTTCGTGGTCTTGC   GCAAGACCACGAACAATGGGTCTCTTGATGGCAGAACGTGCAGAC  
MTS48Aco1   ATGCTGAAGAGACGTTCTGCCAGAAAGAGACCCATTGTTCGTG   GGTCTGCAGGTGGAGC  
MTS91014Aco1   ATGCTGTCTGCACGTTCTGCCATCCCCATCCCCATTGTTTGTGGTCTTGCGACAGTCTC   GGTCTGCAGGTGGAGC  
MTS9aaFum-Aco1   GGATCCATGCTGTCTGCACGTTCTGCCATCAAGAGACCCATTGTTCGTGGTCTTGCGAAGAGACCCATTGTTCG   GGTCTGCAGGTGGAGC  
MTS9aaAco-Aco1   GGATCCATGCTGTCTGCACGTTCTGCCATCAAGAGACCCATTGTTCGTGGTGCCATCAAGAGACCCA   GGTCTGCAGGTGGAGC  
MTS3Fum1   GAGATACAATCATGTTGAGTTTTACCAATTGTAGTTGCAAGAC   GTCTTGCAACTACAATTGGTAAAACTCAACATGATTGTATCTC  
MTS5Fum1   GAGATACAATCATGTTGAGATTTAGAAATTGTAGTTGCAAGACTTTCG   CGAAAGTCTTGCAACTACAATTTCTAAATCTCAACATGATTGTATCTC  
MTS9Fum1   CATGTTGAGATTTACCAATTGTAGTAAGAAGACTTTCGTAAAATCGTCATATAAGC   GCTTATATGACGATTTTACGAAAGTCTTCTTACTACAATTGGTAAATCTCAACATG  
Nif3MTSFum1   GGACAAACTTGTGCGTAGCATTACCAAGTTCTACCCTCAAAAGTACTCCTCGTTCAGAACTGAAAC   TCACCCGGGGGTACCACCTTGTGCCA  
Mutant name Forward Reverse
AcoMTS-Fum1   GGGTCGACCTGCAGC   GGGTCTCTTGATGGCAGAACGTGCAGACAGCATGATTGATACTCTTATCCG  
  GCCATCAAGAGACCCATTGTTCGTGGTCTTGCGTCCTCGTTCAGAACTGAAACC   GCCTTGGAGATCTTGGG  
Hsp60MTS-Fum1   GGGTCGACCTGCAGC   GGCCTTAAAGTAGCGCGACTACGAACAACGGATGATCTCAACATGATTGTATCTCTTATCCG  
  CGTAGTCGCGCTACTTTAAGGCCTTATTGCGTCGTGCTTACTCCTCCTCGTTCAGAACTG   GCCTTGGAGATCTTGGG  
MTS4Aco1   GGATCCATGCTGTCTAGACGTTCTGCCATCAAGAGACCC   GGGTCTCTTGATGGCAGAACGTCTAGACAGCATGGATCC  
MTS5Aco1   GGATCCATGCTGTCTGCATCTTCTGCCATCAAGAGACCC   GGGTCTCTTGATGGCAGAAGATGCAGACAGCATGGATCC  
MTS8Aco1   GCTGTCTGCACGTTCTGCCCGTAAGAGACCCATTGTTCG   CGAACAATGGGTCTCTTACGGGCAGAACGTGCAGACAGC  
MTS9Aco1   GCACGTTCTGCCATCTGTAGACCCATTGTTCGTGG   CCACGAACAATGGGTCTACAGATGGCAGAACGTGC  
MTS456Aco1   CTAGTGGATCCATGCTGTCTAGATTTACCGCCATCAAGAGACCCATTG   CAATGGGTCTCTTGATGGCGGTAAATCTAGACAGCATGGATCCACTAG  
MTS910Aco1   GTCTGCACGTTCTGCCATCAAGAGACCCATTGTTCGTGGTCTTGC   GCAAGACCACGAACAATGGGTCTCTTGATGGCAGAACGTGCAGAC  
MTS48Aco1   ATGCTGAAGAGACGTTCTGCCAGAAAGAGACCCATTGTTCGTG   GGTCTGCAGGTGGAGC  
MTS91014Aco1   ATGCTGTCTGCACGTTCTGCCATCCCCATCCCCATTGTTTGTGGTCTTGCGACAGTCTC   GGTCTGCAGGTGGAGC  
MTS9aaFum-Aco1   GGATCCATGCTGTCTGCACGTTCTGCCATCAAGAGACCCATTGTTCGTGGTCTTGCGAAGAGACCCATTGTTCG   GGTCTGCAGGTGGAGC  
MTS9aaAco-Aco1   GGATCCATGCTGTCTGCACGTTCTGCCATCAAGAGACCCATTGTTCGTGGTGCCATCAAGAGACCCA   GGTCTGCAGGTGGAGC  
MTS3Fum1   GAGATACAATCATGTTGAGTTTTACCAATTGTAGTTGCAAGAC   GTCTTGCAACTACAATTGGTAAAACTCAACATGATTGTATCTC  
MTS5Fum1   GAGATACAATCATGTTGAGATTTAGAAATTGTAGTTGCAAGACTTTCG   CGAAAGTCTTGCAACTACAATTTCTAAATCTCAACATGATTGTATCTC  
MTS9Fum1   CATGTTGAGATTTACCAATTGTAGTAAGAAGACTTTCGTAAAATCGTCATATAAGC   GCTTATATGACGATTTTACGAAAGTCTTCTTACTACAATTGGTAAATCTCAACATG  
Nif3MTSFum1   GGACAAACTTGTGCGTAGCATTACCAAGTTCTACCCTCAAAAGTACTCCTCGTTCAGAACTGAAAC   TCACCCGGGGGTACCACCTTGTGCCA  

Growth conditions

Strains harboring the appropriate plasmids were grown overnight at 30°C or 20°C (when indicated) in synthetic depleted (SD) medium containing 0.67% (w/v) yeast nitrogen base plus 2% ethanol or 3% galactose, 2% glucose, 2% acetate and (w/v), supplemented with the appropriate amino acids (50 μg/ml). For agar plates, 2% agar was added.

Metabolic labeling

Cultures or induced cultures (in galactose) were harvested and labeled with 10 μCi/ml [35S]methionine and further incubated for 30 minutes at 30°C. When required, 20 μM carbonyl cyanide m-chlorophenylhydrazone (CCCP) was added before labeling. Labeling was stopped by addition of 10 mM sodium azide. Labeled cells were collected by centrifugation, resuspended in Tris/EDTA buffer pH 8.0, containing 1 mM phenylmethylsulfonyl fluoride, broken with glass beads for 5 minutes, and centrifuged to obtain the supernatant fraction. Supernatants were denatured by boiling in 1% SDS, immunoprecipitated with anti-aconitase or anti-fumarase rabbit antiserum and protein A-Sepharose (Amersham Biosciences, Piscataway, NJ), and then analyzed by SDS-PAGE.

For pulse-chase experiments, yeast cultures were incubated for 1 minute with 20 μM CCCP and labeled for 15 minutes with 10 μCi/ml [35S]methionine, and then, in the presence of 40 mM DTT, chased using unlabeled 0.03% methionine, 0.04% cysteine and 0.01% cycloheximide.

Subcellular fractionation

Induced yeast cultures were grown to an OD600 of 1.5. Mitochondria were isolated as described previously (Knox et al., 1998). Spheroplasts were prepared in the presence of Zymolyase-20T (MP Biomedicals, Irvine, CA). Each of our subcellular fractionation experiments was assayed for cross-contaminations by using anti-Hsp60 or anti-mtHsp70 antibodies as mitochondrial markers and anti-hexokinase 1 (anti-HK) antibody as a cytosolic marker. Cytosolic and mitochondrial band intensities were quantified densitometrically using TINA Software.

Acknowledgements

We thank Abdussalam Azem, Eitan Bibi, Sharon Karniely and Lee Shlevin for critical reading of this manuscript. Special thanks to Merav Tal and Yudit Karp for their dedicated assistance. This research was supported by the German Israeli Foundation (GIF), the Israel Science Foundation (ISF) and the German Israeli Project Cooperation (DIP).

References

Beinert, H., Kennedy, M. C. and Stout, C. D. (
1996
). Aconitase as ironminus signSulfur protein, enzyme, and iron-regulatory protein.
Chem. Rev.
96
,
2335
-2374.
Borrego, F., Ulbrecht, M., Weiss, E. H., Coligan, J. E. and Brooks, A. G. (
1998
). Recognition of human histocompatibility leukocyte antigen (HLA)-E complexed with HLA class I signal sequence-derived peptides by CD94/NKG2 confers protection from natural killer cell-mediated lysis.
J. Exp. Med.
187
,
813
-818.
Braud, V. M., Allan, D. S., O'Callaghan, C. A., Soderstrom, K., D'Andrea, A., Ogg, G. S., Lazetic, S., Young, N. T., Bell, J. I., Phillips, J. H. et al. (
1998
). HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C.
Nature
391
,
795
-799.
Claros, M. G. and Vincens, P. (
1996
). Computational method to predict mitochondrially imported proteins and their targeting sequences.
Eur. J. Biochem.
241
,
779
-786.
Claros, M. G., Brunak, S. and von Heijne, G. (
1997
). Prediction of N-terminal protein sorting signals.
Curr. Opin. Struct. Biol.
7
,
394
-398.
Eilers, M. and Schatz, G. (
1986
). Binding of a specific ligand inhibits import of a purified precursor protein into mitochondria.
Nature
322
,
228
-232.
Hegde, R. S. and Bernstein, H. D. (
2006
). The surprising complexity of signal sequences.
Trends Biochem. Sci.
31
,
563
-571.
Karniely, S. and Pines, O. (
2005
). Single translation-dual destination: mechanisms of dual protein targeting in eukaryotes.
EMBO Rep.
6
,
420
-425.
Karniely, S., Regev-Rudzki, N. and Pines, O. (
2006
). The presequence of fumarase is exposed to the cytosol during import into mitochondria.
J. Mol. Biol.
358
,
396
-405.
Kim, S. J., Mitra, D., Salerno, J. R. and Hegde, R. S. (
2002
). Signal sequences control gating of the protein translocation channel in a substrate-specific manner.
Dev. Cell
2
,
207
-217.
Knox, C., Sass, E., Neupert, W. and Pines, O. (
1998
). Import into mitochondria, folding and retrograde movement of fumarase in yeast.
J. Biol. Chem.
273
,
25587
-25593.
Kurys, G., Tagaya, Y., Bamford, R., Hanover, J. A. and Waldmann, T. A. (
2000
). The long signal peptide isoform and its alternative processing direct the intracellular trafficking of interleukin-15.
J. Biol. Chem.
275
,
30653
-30659.
Neupert, W. (
1997
). Protein import into mitochondria.
Annu. Rev. Biochem.
66
,
863
-917.
Plath, K., Mothes, W., Wilkinson, B. M., Stirling, C. J. and Rapoport, T. A. (
1998
). Signal sequence recognition in posttranslational protein transport across the yeast ER membrane.
Cell
94
,
795
-807.
Rapaport, D. (
2003
). Finding the right organelle. Targeting signals in mitochondrial outer-membrane proteins.
EMBO Rep.
4
,
948
-952.
Ratner, S., Anslow, W. P., Jr and Petrack, B. (
1953
). Biosynthesis of urea. VI. Enzymatic cleavage of argininosuccinic acid to arginine and fumaric acid.
J. Biol. Chem.
204
,
115
-125.
Regev-Rudzki, N. and Pines, O. (
2007
). Eclipsed distribution: a phenomenon of dual targeting of protein and its significance.
BioEssays
29
,
772
-782.
Regev-Rudzki, N., Karniely, S., Ben-Haim, N. N. and Pines, O. (
2005
). Yeast aconitase in two locations and two metabolic pathways: seeing small amounts is believing.
Mol. Biol. Cell
16
,
4163
-4171.
Sass, E., Blachinsky, E., Karniely, S. and Pines, O. (
2001
). Mitochondrial and cytosolic isoforms of yeast fumarase are derivatives of a single translation product and have identical amino termini.
J. Biol. Chem.
276
,
46111
-46117.
Sass, E., Karniely, S. and Pines, O. (
2003
). Folding of fumarase during mitochondrial import determines its dual targeting in yeast.
J. Biol. Chem.
278
,
45109
-45116.
Shlevin, L., Regev-Rudzki, N., Karniely, S. and Pines, O. (
2007
). Location-specific depletion of a dual-localized protein.
Traffic
8
,
169
-176.
Stein, I., Peleg, Y., Even-Ram, S. and Pines, O. (
1994
). The single translation product of the FUM1 gene (fumarase) is processed in mitochondria before being distributed between the cytosol and mitochondria in Saccharomyces cerevisiae.
Mol. Cell. Biol.
14
,
4770
-4778.
von Heijne, G. (
1986
). Mitochondrial targeting sequences may form amphiphilic helices.
EMBO J.
5
,
1335
-1342.
Waizenegger, T., Schmitt, S., Zivkovic, J., Neupert, W. and Rapaport, D. (
2005
). Mim1, a protein required for the assembly of the TOM complex of mitochondria.
EMBO Rep.
6
,
57
-62.
Yogev, O., Karniely, S. and Pines, O. (
2007
). Translation coupled translocation of yeast fumarase into mitochondria in vivo.
J. Biol. Chem.
282
,
29222
-29229.