Trophoblast invasion of the uterine extracellular matrix, a critical process of human implantation and essential for fetal development, is a striking example of controlled invasiveness. To identify molecules that regulate trophoblast invasion, mRNA signatures of trophoblast cells isolated from first trimester (high invasiveness) and term placentae (no/low invasiveness) were compared using U95A GeneChip microarrays yielding 220 invasion/migration-related genes. In this `invasion cluster', KiSS-1 and its G-protein-coupled receptor KiSS-1R were expressed at higher levels in first trimester trophoblasts than at term of gestation. Receptor and ligand mRNA and protein were localized to the trophoblast compartment. In contrast to KiSS-1, which is only expressed in the villous trophoblast, KiSS-1R was also found in the extravillous trophoblast, suggesting endocrine/paracrine activation mechanisms. The primary translation product of KiSS-1 is a 145 amino acid polypeptide (Kp-145), but shorter kisspeptins (Kp) with 10, 13, 14 or 54 amino acid residues may be produced. We identified Kp-10, a dekapeptide derived from the primary translation product, in conditioned medium of first trimester human trophoblast. Kp-10, but not other kisspeptins, increased intracellular Ca2+ levels in isolated first trimester trophoblasts. Kp-10 inhibited trophoblast migration in an explant as well as transwell assay without affecting proliferation. Suppressed motility was paralleled with suppressed gelatinolytic activity of isolated trophoblasts. These results identifed Kp-10 as a novel paracrine/endocrine regulator in fine-tuning trophoblast invasion generated by the trophoblast itself.

Introduction

The invasion of trophoblast cells (cytotrophoblasts), epithelial cells of the placenta, into the maternal decidua in the first trimester of pregnancy is a key process for successful reproduction and embryonic development. As a result, the embryo will be anchored in the maternal uterus and utero-placental arteries will be invaded, leading to the dilation of the vessel lumina, which is necessary to enhance uterine and intervillous blood flow in pregnancy. There are striking similarities between invasive cytotrophoblasts and invasive cancer cells (Kliman and Feinberg, 1990; Murray and Lessey, 1999; Bischof and Campana, 2000; Bilban et al., 2000; Murray and Lessey, 1999; McMaster et al., 1998). However, in contrast to tumor invasion, interactions between trophoblasts and uterine cells are closely regulated both temporally and spatially by mechanisms that are largely unknown. If mechanisms controlling migration and invasion of both trophoblast and neoplastic cells are related, it is tempting to postulate that genes expressed in early pregnancy, a period necessitating a tight control of these processes, also play a key role in regulating migration and invasion of cancer cells.

KISS-1 is one of the genes involved in controlling cancer cell dissemination. Differential display and subtractive hybridization were used to isolate KiSS-1 from melanoma cells (Lee et al., 1996). Its expression is lost during cancer progression, and overexpression of KiSS-1 cDNA in metastatic human cancer cell lines suppressed metastasis in athymic nude mice (Lee and Welch, 1997; Shirasaki et al., 2001; Sanchez-Carbayo et al., 2003). The primary translation product of the KiSS-1 gene is a 145 amino acid polypeptide (Kp-145) (Ohtaki et al., 2001), but shorter `kisspeptins' (Kp) with 10, 13, 14 or 54 amino acid residues have been discovered (Fig. 1) (Kotani et al., 2001; Stafford et al., 2002; Harms et al., 2003). Kps are endogenous ligands for an orphan G-protein-coupled receptor (GPR54, hOT7T175, AXOR12; KiSS-1R as designated from here on) that couples primarily to Gq/11 (Ohtaki et al., 2001; Kotani et al., 2001; Muir et al., 2001). KiSS-1R and its cognate ligand KiSS-1 are expressed in a variety of tissues including pancreas, testes, central nervous system and placenta (Janneau et al., 2002; Harms et al., 2003). Kp-54, also termed `metastin', is the putatively secreted and biological active form of Kp-145 (Harms et al., 2003). It inhibits chemotaxis in vitro, enhances the expression and activity of focal adhesion kinase and inhibits melanoma cell metastasis (Ohtaki et al., 2001). Kp-10 stimulates phosphatidylinositol-4,5-bisphosphate hydrolysis, Ca2+ mobilization, arachidonic acid release, extracellular signal-regulated kinase (ERK)1/2 and p38 mitogen-activated protein (MAP) kinase phosphorylation, and stress fiber formation (Kotani et al., 2001). These effects have been found in cells overexpressing KiSS-1R, but have not been investigated in a physiological system so far. Human first trimester (FT) placenta enables the mechanisms of invasion and its regulation to be investigated in a physiological setting.

Fig. 1.

KiSS-1 sequence and cleavage products resulting in various kisspeptins.

Fig. 1.

KiSS-1 sequence and cleavage products resulting in various kisspeptins.

FT trophoblasts secrete collagenases MMP-2 and MMP-9 to degrade extracellular matrices, thus making migration and invasion possible (Bischof and Campana, 2000; Xu et al., 2001). Interestingly, the KiSS-1 transcript product represses MMP-9 activity (Yan et al., 2001).

Despite their putative importance in invasion regulation in a biological system, neither Kp-10 has been detected nor have the effects of Kps been investigated. Here we report for the first time the identification of Kp-10 as a naturally occurring peptide in conditioned medium of primary human trophoblasts, its ability to reduce trophoblast migration without altering proliferation, and to downregulate the activity of MMP-2, one of the key enzymes in trophoblast invasion.

Materials and Methods

Reagents

Collagen type I (rat tail tendon), fibronectin and Matrigel were from Beckton Dickenson (Oxford, UK), Sigma (St Louis, MO) and Stratech Scientific (Luton, UK), respectively. Kp-10, Kp-13 and Kp-14, corresponding to KiSS-1 aa 112-121, 109-121 and 108-121, respectively (Ohtaki et al., 2001; Kotani et al., 2001), were chemically synthesized. Kp-54 (corresponding to aa 68-121 of KiSS-1) was purchased from California Peptide Research (Nappa, CA). A polyclonal antibody to Kp-54 was raised in rabbits. Polyclonal rabbit anti-KISS-1R (human) antibody (cl375-398) was from Phoenix Pharmaceuticals (Belmont, CA).

Immunization protocol

Two milligrams of Kp-54 (California Peptides) were dissolved in 0.1 M 2-(4-Morpholino)-ethanesulfonic acid buffer (pH 4.9) and coupled to 3 mg KLH (keyhole limpet hemocyanine) by use of a water-soluble derivative of EDCI (1-ethyl-3-(3-dimethylaminopropyl)-carbodiimidhydrochloride) as a condensation agent (Hermanson, 1996). After 2 hours EDCI and other low molecular weight molecules were removed by size exclusion chromatography (PD-10 columns, Sephadex G25 M, Amersham) using PBS as purification buffer. Two New Zealand White rabbits were immunized subcutaneously by the use of complete Freud Adjuvant and two boosts after 4 weeks and 2 weeks, respectively, with incomplete Freud Adjuvant according to standard protocols used by Charles River (Kisslegg, Germany). Globulins were precipitated from the isolated sera by ammonium sulfate and IgG were purified by protein-A affinity chromatography (Pierce, Rockford, IL).

Tissue and cells

All patients gave informed consent for collection and investigational use of tissues. This study was approved by the ethics committee of the Karl-Franzens University (Graz, Austria). FT placental tissue was obtained after termination of normal pregnancies by vacuum suction; term placentae were collected after uncomplicated pregnancy and vaginal delivery. Tissues were immediately used for experiments or fixed for 48 hours in 20% formalin buffered with 0.1 M phosphate buffer, pH 7.4, embedded in paraffin, and cut into 4 μm (immunohistochemistry) or 7 μm (in situ hybridization) sections. Five different placentae with at least ten sections of each were examined.

Mononucleated trophoblast cells were isolated by tissue digestion with trypsin and subsequent separation of released cells on a density gradient. Cells from the bands containing trophoblasts were further purified using immunomagnetic beads conjugated with either a combination of anti-CD45RB and fibroblast-specific antibodies (FT) or anti-HLA class-I antibodies (term) to remove nontrophoblast components. Isolated cells were cultured in Dulbecco's Eagle's Medium (DMEM; Gibco, Life Technologies, Paisley, UK) and rigorously characterized as described in detail elsewhere (Blaschitz et al., 2000; Cervar et al., 1999).

cRNA synthesis and gene expression profiling

Preparation of cRNA, hybridization to human U95A GeneChips (Affymetrix, Santa Clara, CA) and scanning of the arrays were carried out at The Scripps Research Institute's Affymetrix Array Core facility (http://www.scripps.edu/services/dna_array/) according to the manufacturer's protocols (available online at https://www.affymetrix.com; (Su et al., 2002)). Images were analyzed with GeneChip software (Affymetrix, version 3.3). Genes were scored on the basis of the putative biological functions of the encoded proteins, as determined by database searches on PubMed, gene cards from the Weizmann Institute of Science (http://bioinfo.weizmann.ac.il/bioinfo.html), and a previously published classification scheme (`OntoExpress') for cellular functions (Khatri et al., 2002).

Semi-quantitative RT-PCR

Using the software Primer3 (Whitehead Institute/MIT Center for Genome Research; http://www.genome.wi.mit.edu), sequence-specific primers were selected from the full-length cDNA sequences on the basis of published sequences of 13 invasion-associated and one housekeeping gene (Table 1). One microgram of total RNA was amplified using the One-Step RT-PCR kit (Qiagen,Valencia, CA). Reverse transcription was carried out at 55°C for 30 minutes and HotStarTaq DNA polymerase was activated at 95°C for 15 minutes followed by 25 (for all 13 invasion-associated genes) or 30 cycles (GAPDH) of amplification (94°C for 30 seconds, 55°C for 30 seconds and 72°C for 60 seconds), and final extension at 72°C for 10 minutes.

Table 1.

Differential gene expression of invasion-associated genes

GenBank Acc. No. Gene ID Gene name *F/T GeneChip *F/T RT PCR Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
U43527   KISS-1   KiSS-1   29.3   17.4   GCCATTAGAAAAGGTGGCCTC   TTGTAGTTCGGCAGGTCCTTC  
AB051065   KiSS-1R   KiSS-1 receptor   n.i.   23.9   GGAGTTGCTGTAGGACATGCA   TTCGCACTGTACAACCTGCTG  
L23808   MMP12   Matrix metalloproteinase 12   83.5   10.0   ACACCTGACATGAACCGTGA   AGCAGAGAGGCGAAATGTGT  
Z24680   GARP   Glycoprotein A repetitions predominant   36.7   10.4   CTGCGAAACAACAGCTTCAG   GTGAGGAGGATGGCAGAGAC  
M85289   HSPG2   Heparan sulfate proteoglycan 2   9.5   8.5   CTGAGTGATGCAGGCACCTA   CTCTCTGGGCTCACTTGGAC  
AL050396   FLNA   Filamin A   5.0   2.0   GTCCCTGTGCATGATGTGAC   TGTATACGTGCCGTCATGGT  
X66945   FGFR1   FGF receptor 1   4.3   3.2   GGGCAGTGACACCACCTACT   TGATGCTGCCGTACTCATTC  
M13981   INHA   Inhibin A   3.6   2.3   GTCTCCCAAGCCATCCTTTT   CAGAGCAGAGGGAGACCAAG  
M35878   IGFBP3   Insulin-like growth factor binding protein 3   2.7   1.6   ACAGCCAGCGCTACAAAGTT   AGGCTGCCCATACTTATCCA  
M92287   CCND3   Cyclin D3   -2.0   -4.0   TGGATGCTGGAGGTATGTGA   GAATGAAGGCCAGGAAATCA  
U15932   DUSP5   Dual specificity phosphatase 5   -2.0   -2.5   ATCAGCCAGTGTGGAAAACC   GAGACCATGCTCCTCCTCTG  
U83115   AIM1   Absent in melanoma 1   -2.6   -2.0   CTGGGCCTTCTCTTTCACTG   CAACGGAAACCACTTCAGGT  
AB007867   PLXNB1   Plexin B1   -14.7   -3.8   ACAGGCAAGGCCAAATACAC   CTCATCACTTGGCTTCACCA  
X01677   GAPDH   Glyceraldehyde-3phosphatedehydrogenase   1.2   1.0   TGAAGGTCGGAGTCAACGGAT   GTCATGAGTCCTTCCACGATA  
GenBank Acc. No. Gene ID Gene name *F/T GeneChip *F/T RT PCR Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
U43527   KISS-1   KiSS-1   29.3   17.4   GCCATTAGAAAAGGTGGCCTC   TTGTAGTTCGGCAGGTCCTTC  
AB051065   KiSS-1R   KiSS-1 receptor   n.i.   23.9   GGAGTTGCTGTAGGACATGCA   TTCGCACTGTACAACCTGCTG  
L23808   MMP12   Matrix metalloproteinase 12   83.5   10.0   ACACCTGACATGAACCGTGA   AGCAGAGAGGCGAAATGTGT  
Z24680   GARP   Glycoprotein A repetitions predominant   36.7   10.4   CTGCGAAACAACAGCTTCAG   GTGAGGAGGATGGCAGAGAC  
M85289   HSPG2   Heparan sulfate proteoglycan 2   9.5   8.5   CTGAGTGATGCAGGCACCTA   CTCTCTGGGCTCACTTGGAC  
AL050396   FLNA   Filamin A   5.0   2.0   GTCCCTGTGCATGATGTGAC   TGTATACGTGCCGTCATGGT  
X66945   FGFR1   FGF receptor 1   4.3   3.2   GGGCAGTGACACCACCTACT   TGATGCTGCCGTACTCATTC  
M13981   INHA   Inhibin A   3.6   2.3   GTCTCCCAAGCCATCCTTTT   CAGAGCAGAGGGAGACCAAG  
M35878   IGFBP3   Insulin-like growth factor binding protein 3   2.7   1.6   ACAGCCAGCGCTACAAAGTT   AGGCTGCCCATACTTATCCA  
M92287   CCND3   Cyclin D3   -2.0   -4.0   TGGATGCTGGAGGTATGTGA   GAATGAAGGCCAGGAAATCA  
U15932   DUSP5   Dual specificity phosphatase 5   -2.0   -2.5   ATCAGCCAGTGTGGAAAACC   GAGACCATGCTCCTCCTCTG  
U83115   AIM1   Absent in melanoma 1   -2.6   -2.0   CTGGGCCTTCTCTTTCACTG   CAACGGAAACCACTTCAGGT  
AB007867   PLXNB1   Plexin B1   -14.7   -3.8   ACAGGCAAGGCCAAATACAC   CTCATCACTTGGCTTCACCA  
X01677   GAPDH   Glyceraldehyde-3phosphatedehydrogenase   1.2   1.0   TGAAGGTCGGAGTCAACGGAT   GTCATGAGTCCTTCCACGATA  
*

F/T, Fold change difference of mRNA levels between FT vs term trophoblasts; n.i., not included on the U95A GeneChip

SDS-PAGE and western blotting

Trophoblast cell lysates were separated by SDS-PAGE and blotted as described previously (Hahn et al., 1998). Blots were incubated with Kp-54 antiserum (1:10,000). To determine the apparent molecular weight of the band identified by the antiserum, a standard curve was generated by plotting the log10 of unstained molecular weight standards against their retention factor (Rf). Thus, a single band at ∼15 kDa could be identified as Kp-145.

MALDI-TOF analysis

Conditioned media from FT trophoblasts cultured for 48 hours in serum-free DMEM were precleared from excess protein over a Nucleosil RP-18 column (Macherey Nagel, Easton, PA). The peptides were eluted with a linear gradient of acetonitrile (10-90%) in 0.1% (v/v) trifluoroacetic acid (TFA) over 30 minutes with a flow rate of 0.4 ml/minute; fractions were collected from 10.7 to 13 minutes. The synthetic peptides (Kp-10, -13, -14 and -54) were analyzed in a separate run to determine their retention times. In a second purification step, purified fractions were reconstituted in 10% (v/v) acetonitril containing 0.1% (v/v) TFA and passed over a Vydac RP-18 column (Vydac, USA). Peptides were eluted over 15 minutes with the same linear gradient as above. Fractions containing Kisspeptins were collected according to the retention times of the synthetic Kisspeptins and subjected to MS-Analysis. MALDI-TOF spectra were obtained in positive linear mode on a KRATOS Axima CFR mass spectrometer (Manchester, UK) by integrating 20 to 50 laser shots per spectrum. Alpha-Cyano-4-hydroxycinnamate saturated in 30% (v/v) acetonitrile and 0.1% (v/v) TFA in water was used as a matrix. External calibration was performed with adrenocorticotropic hormone (ACTH) fragment 18-39; 2466.71 m/z [MH+ av.], and insulin 5734.6 m/z [MH+ av.] (used as the mass calibration standards).

Immunohistochemistry

Deparaffinized tissue sections were treated for 10 minutes with blocking solution, then incubated for 30 minutes with primary antibodies (rabbit polyclonal antiserum against Kp-54, 1:500; anti-KiSS-1R, 1:100) followed by an incubation with an appropriate secondary antibody for 15 minutes, and then 15 minutes with avidinbiotin-peroxidase (Labvision). Immunolabeling was visualized by a 5 minute exposure to 3-amino-9-ethylcarbazole. Sections were then counterstained for 3 minutes with hematoxilin and mounted in Faramount (DAKO).

In situ hybridization

FT or term placenta sections were deparaffinized and hybridized with digoxygenin (dig)-labeled riboprobes to KiSS-1 and KiSS-1R, according to a published protocol (Simeone, 1998). RNA probes for human KiSS-1 and KiSS-1R were prepared as follows: on the basis of the published sequence, a 457 bp fragment of the the human KiSS-1 cDNA sequence was amplified by PCR using a primer pair KiSS-1_EcoRI (5′-GGG AAT TCT AGA CCC ACA GGC CAG CAG CTA GAA-3′; bp 296-328) and KiSS-1_HindIII (5′-TTT ATT GCC TAA GCT TGG AAG CTC CAG CGC CCC-3′; bp 724-752). Similarly, a 781 bp fragment of the human KiSS-1R cDNA sequence was amplified by PCR using primer sets KiSS-1R_EcoRI (5′-TGG GGA ATT CGC TGG TCA TCT ACG TCA TCT G-3′;) and hOT75T175_HindIII (5′-CAG GTC TTA AGC TTG TAG GCG GCG TAG CTG-3′). The amplified sequences were confirmed at The Scripps Research Institute's DNA Sequencing core facility (http://www.scripps.edu/). Amplified fragments were subcloned into the EcoRI and HindIII sites of pGEM-3Z (Promega, Madison, WI), and the resultant vectors were used as templates for construction of the dig-labeled RNA probes according to manufacturer's instructions (Roche Diagnostic, Indianapolis, IN). After hybridization, the slides were washed, and incubated for 4 hours at RT with peroxidase-labeled goat-anti dig monoclonal antibody. Signals were detected overnight at RT in buffer 2 containing 3 μl/ml NBT (Nitroblue tetrazoliuim chloride), 50 mg/ml BZIP (5-bromo-4-chloro-3-indolyl-phosphate, 4-toluidine salt) and 1 mM Levamisol. Color development was terminated in TE (10 mM Tris/HCl; pH 8.0, 1 mM EDTA) for 5 minutes. Sections were mounted in gelatin-glycerol (Sigma).

Explant culture

The explant culture method followed a standard protocol (Aplin et al., 2000). Dissected mesenchymal villous tissue was arranged radially on 80 μl drops of collagen type I gel, covered with 20 μl of serum-free medium (SFM; DMEM:Ham's F12 (Gibco) 1:1, supplemented with 100 μg/ml streptomycin/penicillin (Gibco) and incubated overnight at 37°C, 5% CO2 to allow attachment. Wells were then carefully flooded with 1 ml SFM and incubated in the absence or presence of 0.3 or 1.0 μM Kp-10 at 37°C, 5% CO2 and subsequent growth characteristics monitored by light microscopy. Newly synthesized DNA was detected with bromodeoxyuridine (BrdU; Roche) added to selected cultures at 1 μM for the periods specified. The extent of migration, i.e. the distance from the cell column base to the tip of the outgrowth, was measured at three defined positions (three explants per condition) and the mean of these values was used for comparing the Kp-10 effects.

Intracellular Ca2+ release assay

Cytosolic free Ca2+ concentration ([Ca2+]c) in single cells was measured using the conventional single-cell fura-2 technique with a customized fluorescence microscope as described previously (Graier et al., 1998), and expressed as ratio (F340/F380) units. Briefly, 1×105 FT trophoblasts were plated on glass coverslips. The following day, adherent cells were loaded for 45 minutes at RT in the dark with 2 μM fura-2/AM (Molecular Probes, Leiden, The Netherlands), washed twice and equilibrated for a further 20 minutes. The coverslip was mounted into an experimental chamber and perfused (1 ml/min-1) with buffer solution containing, in mM: 145 NaCl, 5 KCl, 2 Ca2Cl, 1 MgCl2 and 10 Hepes free acid (pH adjusted at 7.4).

Migration assays

Transwell migration assays were performed as described (Hintermann et al., 2001; Song et al., 2001) with filters coated with 30 μg/ml collagen I or 10 μg/ml fibronectin. After initial experiments to determine the temporal kinetics of migration, subsequent migration assays were performed for 48 hours. Cells that had migrated through the filters were viewed under bright-field optics and were counted in eight fields (using a 20× objective) from each of two filters for each condition, determining the mean number of cells counted per field.

Gelatin zymography

Protein content of trophoblastic conditioned media was measured according to the method of Bradford (Bradford, 1976), and equal amounts of protein were subjected to gelatin zymography on nonreducing 10% polyacrylamide gels supplemented with 1% gelatin to determine the proteolytic activity of conditioned media as described previously (Xu et al., 2001). Prestained molecular mass standards (Invitrogen) were used to determine the molecular mass of proteolytic activity.

Statistical analysis

Migration indices and MMP-2 levels were analyzed using one-way ANOVA, followed by the Tukey test. As data were not normally distributed, the Mann-Whitney rank-sum test was employed to determine the level of significance of differences in pairs of various treatment groups. P<0.05 was considered significant.

Results

Screening for invasion-related genes in human trophoblasts, using DNA microarray technology

DNA microarray-based large-scale gene expression profiling was applied to highly (FT) and poorly (term of gestation) invasive trophoblast cells. In all, 643 differentially expressed genes (more than twofold difference between FT and term trophoblast cells) were further compared with the gene expression profile of the poorly invasive but proliferative trophoblast-like cell line BeWo (Grummer et al., 1994; Morgan et al., 1998; Xu et al., 2001). Genes that showed a similar expression pattern in both FT and BeWo cells were assumed to control processes common to both cell types, including proliferation and endocrine function, but not invasion. Thus, BeWo cells served as a `filter' to identify genes regulating trophoblast invasion. Using this selection method, 220 invasion-associated genes were differentially expressed, some of which are shown in Table 1. A similar approach was used to identify prognostic biomarkers in prostate cancer (Dhanasekaran et al., 2001). In that study, distinct noninvasive prostate samples clustered together, differently from the metastatic samples. In order to identify novel key players regulating trophoblast invasion we focused on KiSS-1, a recently described tumor suppressor gene (Ohtaki et al., 2001), as it was one of the strongest differentially expressed genes (29.0-fold higher mRNA levels in FT compared with term trophoblasts).

Semi-quantitative RT-PCR and western blot analysis

To confirm differential expression of KiSS-1 mRNA and to include KiSS-1R in our studies, we performed semi-quantitative RT-PCR and found 17.4±3.4-fold (KiSS-1) and 23.9±5.4-fold (KiSS-1R) higher mRNA levels in FT than term trophoblasts (Fig. 2A). In western blot analyses, the antiserum generated against Kp-54, which is within the Kp-145 sequence, detected Kp-145, but not Kp-54, in lysates from FT trophoblasts (Fig. 2B) but not in FT trophoblast conditioned medium, even after 30-fold enrichment (data not shown). This suggests the following scenarios: (1) intracellular Kp-54 pools are rapidly depleted by secretion; (2) intracellularly generated Kp-54 is rapidly degraded because of the presence of PEST sequences (rich in proline, glutamic acid, serine, threonine and aspartic acid residues predisposing proteins to ubiquitination and proteosome degradation (Harms et al., 2003). The presence of this motif (aa 68-87) may allow rapid degradation of cytosolic Kp-145 resulting in a short half-life (<30 seconds) (Harms et al., 2003); (3) levels of intra- or extracellular Kp-54 are below the detection limit of western blotting. To exclude the latter, conditioned medium of cultured FT trophoblasts was analyzed by MALDI-TOF, which revealed the presence of Kp-10, -13 and -14, as well as Kp-54 in conditioned medium, with masses consistent with the theoretical masses of the amidated forms for Kp-10, -13, -14 and Kp-54 (Fig. 2C). Secreted Kp-54 may be the source for the shorter Kps Kp-10, -13 and -14.

Fig. 2.

KiSS-1 and KiSS-1R are differentially expressed in FT and term human trophoblast cells. (A) RT-PCR of total RNA of freshly isolated FT or term trophoblasts (representative experiment: left panel). (B) Western blotting of FT and term trophoblasts. Lysates were probed with anti-Kp145/Kp-54 antiserum. With purified Kp-54 (5 ng) the antiserum produced a single band at 5-6 kDa, which is in good agreement with the theoretical MW for Kp-54 (5858.0 kDa; lane `M'). The antibody reacted only with lysates from FT trophoblasts producing one prominent band at ∼15-16 kDa, which is in good agreement with the calculated Mr for Kp-145 (15.391 kDa). β-actin served as loading control. (C) FT trophoblast conditioned media were subjected to MALDI-TOF analysis after reverse phase-HPLC fractionation. The theoretical masses for C-terminally amidated Kps-10, -13, -14 and -54 are 1304, 1626, 1704 and 5858, respectively. Kp-54 was identified also as Na-adduct (m/z: 5876). The masses at around 2600 are unidentified.

Fig. 2.

KiSS-1 and KiSS-1R are differentially expressed in FT and term human trophoblast cells. (A) RT-PCR of total RNA of freshly isolated FT or term trophoblasts (representative experiment: left panel). (B) Western blotting of FT and term trophoblasts. Lysates were probed with anti-Kp145/Kp-54 antiserum. With purified Kp-54 (5 ng) the antiserum produced a single band at 5-6 kDa, which is in good agreement with the theoretical MW for Kp-54 (5858.0 kDa; lane `M'). The antibody reacted only with lysates from FT trophoblasts producing one prominent band at ∼15-16 kDa, which is in good agreement with the calculated Mr for Kp-145 (15.391 kDa). β-actin served as loading control. (C) FT trophoblast conditioned media were subjected to MALDI-TOF analysis after reverse phase-HPLC fractionation. The theoretical masses for C-terminally amidated Kps-10, -13, -14 and -54 are 1304, 1626, 1704 and 5858, respectively. Kp-54 was identified also as Na-adduct (m/z: 5876). The masses at around 2600 are unidentified.

Next, we tested which of the various Kps can activate KiSS-1R by monitoring cytosolic Ca2+ levels after stimulation of isolated FT trophoblasts with the respective Kps (Fig. 3). This treatment increased intracellular Ca2+ in KiSS-1R-overexpressing cells (Ohtaki et al., 2001; Muir et al., 2001; Kotani et al., 2001). Addition of Kp-10 to FT trophoblasts increased cytosolic Ca2+ levels with an EC50 of 21 nM (Fig. 3A,B). By contrast, Kp-54 as well as Kp-13 and Kp-14 failed to produce this response (Fig. 3A).

Fig. 3.

Kisspeptin-10 raises intracellular Ca2+ in isolated first trimester human trophoblasts. FT trophoblasts were stimulated with different Kps and intracellular [Ca2+] was measured (A). Only Kp-10 resulted in an increase in intracellular [Ca2+] (n=9), whereas Kp-13, -14 and -54 were ineffective (n=6). (B) Concentration-response curve for Kp-10 on intracellular free Ca2+ concentration in isolated FT trophoblasts. The intracellular [Ca2+] is expressed as ratio (F340/F380) (mean±s.e.m.; n=6-9). The EC50 was found to be 21 (16-29) nM (95% confidential interval).

Fig. 3.

Kisspeptin-10 raises intracellular Ca2+ in isolated first trimester human trophoblasts. FT trophoblasts were stimulated with different Kps and intracellular [Ca2+] was measured (A). Only Kp-10 resulted in an increase in intracellular [Ca2+] (n=9), whereas Kp-13, -14 and -54 were ineffective (n=6). (B) Concentration-response curve for Kp-10 on intracellular free Ca2+ concentration in isolated FT trophoblasts. The intracellular [Ca2+] is expressed as ratio (F340/F380) (mean±s.e.m.; n=6-9). The EC50 was found to be 21 (16-29) nM (95% confidential interval).

Localization of KiSS-1 and KiSS-1R mRNA and protein in first trimester placenta

Both KiSS-1 mRNA and protein were found at the syncytiotrophoblast of anchoring (Fig. 4A,B) and floating villi, whereas it was undetectable in villous and extravillous cytotrophoblasts. Maternal decidua was devoid of KiSS-1 mRNA staining (data not shown). On the basis of these results, expression of KiSS-1 as well as KiSS-1 encoded Kps in FT placenta appears to correlate with cells that have fused and become noninvasive. KiSS-1R mRNA and protein was localized to syncytio-, villous- and extravillous cytotrophoblast at similar levels (Fig. 4C,D and insets). Thus, syncytiotrophoblast expresses both the ligand Kp-145/Kp-54 and its receptor, whereas the extravillous cytotrophoblast only expresses the receptor KiSS-1R (Fig. 7). This is in line with the hypothesized inhibitory role of Kp-54 in trophoblast invasion.

Fig. 4.

KiSS-1/Kp-54 and KiSS-1R localization in first trimester placenta. Sections of human FT placental tissue at week 6-10 of gestation showing the localization of KiSS-1/Kp-54 (A,B) and KiSS-1R (E,F). KiSS-1 and KiSS-1R mRNA were detected by in situ hybridization as dark blue precipitates, whereas their respective proteins were detected using affinity purified polyclonal antibodies evident as dark red precipitate. Sense probes (C,G) and nonimmune sera (D,H) produced no detectable signal. KiSS-1 mRNA (A) and Kp-145/Kp-54 protein (B) were detected mainly on the outer (syncytiotrophoblast) surface of villi. Higher magnification showed that KiSS-1/Kp-54 expression is restricted to the syncytiotrophoblast (insets; A and B; bars, 25 μm), whereas it was undetectable in villous (vCT) and extravillous (evCT) cytotrophoblasts. KiSS-1R mRNA is located in the syncytiotrophoblast (ST), villous (vCT) and extravillous (evCT) cytotrophoblasts (E). This mRNA staining pattern is paralleled by that of KiSS-1R protein (F). Bars, 50 μm.

Fig. 4.

KiSS-1/Kp-54 and KiSS-1R localization in first trimester placenta. Sections of human FT placental tissue at week 6-10 of gestation showing the localization of KiSS-1/Kp-54 (A,B) and KiSS-1R (E,F). KiSS-1 and KiSS-1R mRNA were detected by in situ hybridization as dark blue precipitates, whereas their respective proteins were detected using affinity purified polyclonal antibodies evident as dark red precipitate. Sense probes (C,G) and nonimmune sera (D,H) produced no detectable signal. KiSS-1 mRNA (A) and Kp-145/Kp-54 protein (B) were detected mainly on the outer (syncytiotrophoblast) surface of villi. Higher magnification showed that KiSS-1/Kp-54 expression is restricted to the syncytiotrophoblast (insets; A and B; bars, 25 μm), whereas it was undetectable in villous (vCT) and extravillous (evCT) cytotrophoblasts. KiSS-1R mRNA is located in the syncytiotrophoblast (ST), villous (vCT) and extravillous (evCT) cytotrophoblasts (E). This mRNA staining pattern is paralleled by that of KiSS-1R protein (F). Bars, 50 μm.

Fig. 7.

KiSS-1 and KiSS-1R mRNA and protein expression in first trimester placenta. The histology of the maternal-fetal interface and KiSS-1 (A) and KiSS-1R (B) expression patterns are shown schematically from in situ hybridization and immunohistochemistry staining (Fig. 4). AV, anchoring villus; evCT: extravillous cytotrophoblast; ST, syncytiotrophoblast; vCT, villous cytotrophoblast.

Fig. 7.

KiSS-1 and KiSS-1R mRNA and protein expression in first trimester placenta. The histology of the maternal-fetal interface and KiSS-1 (A) and KiSS-1R (B) expression patterns are shown schematically from in situ hybridization and immunohistochemistry staining (Fig. 4). AV, anchoring villus; evCT: extravillous cytotrophoblast; ST, syncytiotrophoblast; vCT, villous cytotrophoblast.

Regulation of trophoblast migration by Kp-10 in vitro

Given the anti-metastatic function of KiSS-1, we investigated whether Kp-10 can inhibit migration of FT placental tissue. Tissue cultures of anchoring villi explanted from early gestation (6 to 9 weeks) placentas onto an extracellular matrix substrate allow the study of trophoblast outgrowth, migration and invasion, thus mimicking the key processes that occur in anchoring villi during the FT of gestation (Genbacev et al., 1992; Aplin et al., 2000). This assay has the significant advantage of allowing migratory behaviour to be observed in living trophoblasts, because migration occurs largely across the surface of the gel. Control explants displayed prominent outgrowth of extravillous trophoblast from the distal end of the villous tip and an increased number of cells migrating into the surrounding matrix (Fig. 5A,B) similar to previous reports (Aplin et al., 2000). Kp-10 strongly affected the pattern of cell migration (ANOVA P<0.001): explants exposed to Kp-10 for 48 or 72 hours displayed about 70% diminished extravillous trophoblast outgrowth (Fig. 5C-F,K).

Fig. 5.

Kisspeptin-10 inhibits trophoblast outgrowth and migration, but not proliferation in first trimester human villous explant cultures. Villous explants from 6-9 weeks' gestation were maintained in culture for 72 hours in the absence (A,B) or presence of 0.3 μM (C,D) or 1.0 μM (E,F) Kp-10. Identical villi were photographed at 48 or 72 hours. The dark areas are tissue, and sheets of outgrowing cytotrophoblast can readily be observed in the untreated cultures (A,B; arrows mark the limits/boundaries of the outgrowth). Kp-10 treatment profoundly decreases trophoblast outgrowth from the distal end of the villous tips when compared with control villous explants. Magnification: ×40. (G-J) Proliferative potential of placental villi was determined by incorporation of BrdU after 24 hours in culture in the absence (G,I) or presence (H,J) of 1 μM Kp-10. Villus sections were stained with an anti-BrdU antibody, which detects cells in the S-phase (G,H), or were labeled with the nuclear stain dapi (I,J). The nonproliferating syncytiotrophoblast (ST) is devoid of anti-BrdU staining (G,H). Cell column (CC) formation by villus explants maintained in the absence or presence of Kp-10 (0.3 μM) was similar. In addition, no significant difference in the proportion of nuclei that incorporated BrdU was detected. Six villi per treatment were examined per placenta and the experiment was repeated three times. Magnification: ×400. The extent of migration was increased between 48 and 72 hours under all conditions. Migration distance was reduced already at 0.3 μM Kp-10 at both 48 and 72 hours (K). The higher concentration of 1 μM did not augment the effect. *P<0.05 vs control. VS, villous stroma.

Fig. 5.

Kisspeptin-10 inhibits trophoblast outgrowth and migration, but not proliferation in first trimester human villous explant cultures. Villous explants from 6-9 weeks' gestation were maintained in culture for 72 hours in the absence (A,B) or presence of 0.3 μM (C,D) or 1.0 μM (E,F) Kp-10. Identical villi were photographed at 48 or 72 hours. The dark areas are tissue, and sheets of outgrowing cytotrophoblast can readily be observed in the untreated cultures (A,B; arrows mark the limits/boundaries of the outgrowth). Kp-10 treatment profoundly decreases trophoblast outgrowth from the distal end of the villous tips when compared with control villous explants. Magnification: ×40. (G-J) Proliferative potential of placental villi was determined by incorporation of BrdU after 24 hours in culture in the absence (G,I) or presence (H,J) of 1 μM Kp-10. Villus sections were stained with an anti-BrdU antibody, which detects cells in the S-phase (G,H), or were labeled with the nuclear stain dapi (I,J). The nonproliferating syncytiotrophoblast (ST) is devoid of anti-BrdU staining (G,H). Cell column (CC) formation by villus explants maintained in the absence or presence of Kp-10 (0.3 μM) was similar. In addition, no significant difference in the proportion of nuclei that incorporated BrdU was detected. Six villi per treatment were examined per placenta and the experiment was repeated three times. Magnification: ×400. The extent of migration was increased between 48 and 72 hours under all conditions. Migration distance was reduced already at 0.3 μM Kp-10 at both 48 and 72 hours (K). The higher concentration of 1 μM did not augment the effect. *P<0.05 vs control. VS, villous stroma.

Because de novo cell column formation is accompanied by cytotrophoblast proliferation peaking after an initial period of 24 hours and ceasing after 48 hours (Caniggia et al., 1997; Genbacev et al., 1992; Aplin et al., 2000), we investigated whether the Kp-10-induced inhibition of trophoblast outgrowth was due to a reduction in cell division. When tissue was explanted in the presence of Kp-10, viability and proliferative potential of cytotrophoblast was maintained for the first 24 hours as indicated by the incorporation of BrdU into cytotrophoblasts beneath the villous syncytium and in the proximal cell column (Fig. 5). Because cytotrophoblast proliferation was unaffected in the critical phase, these results indicate that Kp-10 does not affect trophoblast proliferation and that the reduced trophoblast outgrowth is most likely due to a blockade of trophoblast migration. This was tested in a Transwell migration assay, where inhibition of FT trophoblast migration was readily apparent by visual inspection (Fig. 6A). The number of migrating cells scored per field was reduced by 37% and 46% in the presence of 0.5 μM Kp-10 on fibronectin or collagen I, respectively (Fig. 6B). Like in the explant assay, Kp-10 did not alter FT trophoblast proliferation (Fig. 6B).

Fig. 6.

Kisspeptin-10 inhibits migration and gelatinolytic activity, but not proliferation of isolated first trimester human trophoblasts. (A) Microscopic image of the abluminal side of collagen I (Col I)- or fibronectin (FN)-coated membranes after 48 hours during which isolated FT trophoblasts (1×105 per filter, week 6-9 of gestation) migrated across the membrane in the absence or presence of 0.5 μM Kp-10. (B) Bars on left: Addition of Kp-10 (0.5 μM, black bars) reduced the number of cells that migrated through the filter pores. Results are expressed as mean±s.e.m. (n=3 different trophoblast isolations) of cell migration relative to unstimulated cells set as 1 (white bars) (*P<0.05 vs control). Bars on right: To assess cell proliferation, 7×104 freshly isolated FT trophoblasts were plated on collagen I in the absence (white bar) or presence of Kp-10 (black bars) added at the time of seeding. Cell numbers were counted after 48 hours. Results are presented as cell number (mean±s.e.m.; n=3) expressed relative to control (=100%). Kp-10 did not affect FT trophoblast proliferation significantly. ns, not significant vs control. (C) Conditioned medium from isolated FT trophoblasts plated on collagen I for 24 or 48 hours was subjected to gelatin zymography. Proteolytic activity was noted for the 72-kDa collagenase corresponding to pro-MMP-2. Protein molceular weight markers are indicated on the right. (D) Addition of Kp-10 suppressed 72-kDa collagenase (MMP-2) activity (*P<0.01 vs control).

Fig. 6.

Kisspeptin-10 inhibits migration and gelatinolytic activity, but not proliferation of isolated first trimester human trophoblasts. (A) Microscopic image of the abluminal side of collagen I (Col I)- or fibronectin (FN)-coated membranes after 48 hours during which isolated FT trophoblasts (1×105 per filter, week 6-9 of gestation) migrated across the membrane in the absence or presence of 0.5 μM Kp-10. (B) Bars on left: Addition of Kp-10 (0.5 μM, black bars) reduced the number of cells that migrated through the filter pores. Results are expressed as mean±s.e.m. (n=3 different trophoblast isolations) of cell migration relative to unstimulated cells set as 1 (white bars) (*P<0.05 vs control). Bars on right: To assess cell proliferation, 7×104 freshly isolated FT trophoblasts were plated on collagen I in the absence (white bar) or presence of Kp-10 (black bars) added at the time of seeding. Cell numbers were counted after 48 hours. Results are presented as cell number (mean±s.e.m.; n=3) expressed relative to control (=100%). Kp-10 did not affect FT trophoblast proliferation significantly. ns, not significant vs control. (C) Conditioned medium from isolated FT trophoblasts plated on collagen I for 24 or 48 hours was subjected to gelatin zymography. Proteolytic activity was noted for the 72-kDa collagenase corresponding to pro-MMP-2. Protein molceular weight markers are indicated on the right. (D) Addition of Kp-10 suppressed 72-kDa collagenase (MMP-2) activity (*P<0.01 vs control).

Regulation of cell motility is controlled by a multitude of factors (Lauffenburger and Horwitz, 1996), among which proteases play an evident role (Bischof and Campana, 2000; Chang and Werb, 2001). To determine whether Kp-10 triggers a decrease in collagenase activity, resulting in reduced trophoblast migration, FT trophoblast-conditioned medium was analyzed for collagenase activity by zymography. Addition of 0.3 μM or 1.0 μM Kp-10 to FT trophoblast cultures suppressed MMP-2 activity by 32% and 62% after 24 hours, and by 28% and 42% after 48 hours, respectively (Fig. 6C,D). Secreted MMP-9 levels were too low to allow accurate quantification (data not shown).

Discussion

In the present paper we show that kisspeptin Kp-10, a shorter version of the recently described metastasis suppressor gene product KiSS-1, inhibits trophoblast migration and invasion, presumably by downregulating protease activity. Our hypothesis is based on the finding that KiSS-1 was among the strongest differentially expressed genes in invasive FT versus noninvasive term trophoblast preparations. Furthermore, Kp-10 blocked explant invasion and Transwell migration and decreased MMP-2 activity. These results make KiSS-1 a strong candidate as a gene that regulates trophoblast invasion in vivo.

Differential expression of KiSS-1 was similar in microarray and RT-PCR experiments. These results confirm published data on the relative expression levels of the well-known invasion-specific trophoblast markers integrins α1 and α5, as well as HLA-G, which are almost exclusively expressed by the invasive cytotrophoblast phenotype (Damsky et al., 1994; McMaster et al., 1998; Cervar et al., 1996; Blaschitz et al., 2000), thus confirming our microarray strategy. Differential expression of KiSS-1 was paralleled by the expression and location of its receptor KiSS-1R, suggesting autocrine interactions. Additional receptor expression on villous and extravillous cytotrophoblast also suggests paracrine or endocrine mechanisms for receptor activation (Fig. 7, Fig. 3). This is supported by the findings that Kp-10 stimulates oxytocin secretion in rats and that pregnant women have high Kp-54 plasma levels (Horikoshi et al., 2003; Kotani et al., 2001). However, the cellular origin of secreted Kp-54 has not been shown so far. Here, Kp-54 and its fragments Kp-10, -13 and -14 were identified by MALDI-TOF analysis in serum-free conditioned medium of isolated FT trophoblasts. Kp-54 is predicted to result from the proteolytic processing of Kp-145 by furin or prohormone convertases, as its sequence is surrounded by pairs of basic residues in the full-size protein (Harms et al., 2003). At present, the mechanism resulting in the generation of Kp-10, -13 and -14 is unclear as no obvious cleavage sites have been found (Harms et al., 2003), but scenarios such as spontaneous decomposition as well as constitutive or regulated processing can be envisioned.

In cells overexpressing KiSS-1R, Kp-54 was capable of activating the receptor and increasing intracellular Ca2+ levels (Kotani et al., 2001; Muir et al., 2001; Ohtaki et al., 2001). In contrast to the present system with a physiological receptor level, only Kp-10 gave rise to increasing intracellular Ca2+ with an EC50 similar to other systems (Kotani et al., 2001; Muir et al., 2001). Because the Kp-54 used here caused a rapid Ca2+ response in KiSS-1R-overexpressing cells (Muir et al., 2001) we conclude that the chemically synthesized Kp-54 can induce effects in cells overexpressing KiSS-1R, whereas Kp-10 is the activator in physiological systems. The special position of Kp-10 is highlighted not only because of its threefold-to-tenfold higher receptor affinity than other Kps (Hori et al., 2001; Ohtaki et al., 2001), but also by the high conservation of the Kp-10 sequence between mouse and human with one conserved amino acid replacement, whereas other regions of the Kp-145 protein display only low homology (Stafford et al., 2002).

The extent of trophoblast invasion also depends on the provision of trophoblasts from the cell column that will differentiate and acquire an invasive phenotype. Explant and Transwell migration assays showed that Kp-10 signals reduced trophoblast motility without affecting trophoblast proliferation or viability. The absence of Kp-10 effect on trophoblast proliferation shows that the mechanism underlying invasion inhibition must be different. In fact, suppressed motility was associated with suppressed MMP-2 proteolytic activity. The high in vitro invasive capacity of FT trophoblasts has been shown to depend on their secretion of collagenases and gelatinases (Bischof et al., 1995; Bischof and Campana, 2000). Indeed, extravillous cytotrophoblasts secreting high amounts of gelatinases are highly motile and invasive, whereas extravillous cytotrophoblasts secreting low amounts of gelatinases have become immobile. Thus, syncytium-derived Kp-10, by suppressing gelatinolytic activity of extravillous cytotrophoblast located in proximity to maternal circulation, might be an endocrine mechanism of fine-tuning trophoblast motility (Fig. 7). In addition, syncytial Kp-10 may also act in a paracrine manner on the underlying villous cytotrophoblast by suppressing gelatinolytic activity in a coordinated fashion with other signals, thus rendering villous cytotrophoblasts immobile and anchored to the villous basement.

Although the ability of Kp-10 to inhibit migration has been documented in a few other cell types with overexpression of KiSS-1R (Ohtaki et al., 2001), this is the first study to report Kp-10 motility regulation in a human physiological setting. Our conclusion of an invasion inhibiting function of the KiSS-1/KiSS-1R system in human trophoblasts is corroborated by reduced expression of both in trophoblast-derived choriocarcinoma (Janneau et al., 2003). Invasion inhibition will lead to excessive invasion that is a characteristic of this tumor.

Downregulation of MMP-2 activity may be one potential mechanism underlying the Kp-10-induced invasion inhibition and this may be tissue specific (Yan et al., 2001). The possibility that Kp-10 affects MMP-9 expression or activity later in gestation cannot be excluded because trophoblast-derived MMPs are developmentally regulated throughout pregnancy and MMP-9 secretion increases between week 6 and 11 of gestation (Xu et al., 2001; Huppertz et al., 1998). In addition to MMP regulation, probably by direct interaction with MMPs (Takino et al., 2003), other mechanisms may be operative, such as activation of focal adhesion kinase (Kotani et al., 2001; Ohtaki et al., 2001; Ilic et al., 2001), alteration of tissue inhibitors of MMPs (TIMPs) or effects on the plaminogen activator/inhibitor system. The absence or low levels of invasion in situ at term despite low KiSS-1 levels suggests that other anti-invasive factors prevail at the end of gestation. Hence, the anti-invasive effect of KiSS-1/KiSS-1R system may only be important in the first trimester.

Acknowledgements

We thank Abdulaziz Moqrich for expert technical advice for in situ hybridization, Steven Head for assistance with DNA microarrays and Gabi Hagendorfer, Renate Michlmaier and Nicole Prutsch for assistance with trophoblast preparations. This work was supported by grants GM46902 and CA47858, National Institutes of Health to V.Q. and grants 7535 and 7793, Jubilee Fund, Austrian National Bank, Vienna to G.D.

References

Aplin, J. D., Lacey, H., Haigh, T., Jones, C. J., Chen, C. P. and Westwood, M. (
2000
). Growth factor-extracellular matrix synergy in the control of trophoblast invasion.
Biochem. Soc. Trans.
28
,
199
-202.
Bilban, M., Head, S., Desoye, G. and Quaranta, V. (
2000
). DNA microarrays: a novel approach to investigate genomics in trophoblast invasion – a review.
Placenta
21
(Suppl. A),
S99
-S105.
Bischof, P. and Campana, A. (
2000
). Molecular mediators of implantation.
Baillieres Best. Pract. Res. Clin. Obstet. Gynaecol.
14
,
801
-814.
Bischof, P., Haenggeli, L. and Campana, A. (
1995
). Gelatinase and oncofetal fibronectin secretion is dependent on integrin expression on human cytotrophoblasts.
Hum. Reprod.
10
,
734
-742.
Blaschitz, A., Weiss, U., Dohr, G. and Desoye, G. (
2000
). Antibody reaction patterns in first trimester placenta: implications for trophoblast isolation and purity screening.
Placenta
21
,
733
-741.
Bradford, M. M. (
1976
). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72
,
248
-254.
Caniggia, I., Taylor, C. V., Ritchie, J. W., Lye, S. J. and Letarte, M. (
1997
). Endoglin regulates trophoblast differentiation along the invasive pathway in human placental villous explants.
Endocrinology
138
,
4977
-4988.
Cervar, M., Blaschitz, A., Dohr, G. and Desoye, G. (
1999
). Paracrine regulation of distinct trophoblast functions in vitro by placental macrophages.
Cell Tissue Res.
295
,
297
-305.
Cervar, M., Puerstner, P., Kainer, F. and Desoye, G. (
1996
). Endothelin-1 stimulates the proliferation and invasion of first trimester trophoblastic cells in vitro – a possible role in the etiology of pre-eclampsia?
J. Investig. Med.
44
,
447
-453.
Chang, C. and Werb, Z. (
2001
). The many faces of metalloproteases: cell growth, invasion, angiogenesis and metastasis.
Trends Cell Biol.
11
,
S37
-S43.
Damsky, C. H., Librach, C., Lim, K. H., Fitzgerald, M. L., McMaster, M. T., Janatpour, M., Zhou, Y., Logan, S. K. and Fisher, S. J. (
1994
). Integrin switching regulates normal trophoblast invasion.
Development
120
,
3657
-3666.
Dhanasekaran, S. M., Barrette, T. R., Ghosh, D., Shah, R., Varambally, S., Kurachi, K., Pienta, K. J., Rubin, M. A. and Chinnaiyan, A. M. (
2001
). Delineation of prognostic biomarkers in prostate cancer.
Nature
412
,
822
-826.
Genbacev, O., Schubach, S. A. and Miller, R. K. (
1992
). Villous culture of first trimester human placenta – model to study extravillous trophoblast (EVT) differentiation.
Placenta
13
,
439
-461.
Graier, W. F., Paltauf-Doburzynska, J., Hill, B. J., Fleischhacker, E., Hoebel, B. J., Kostner, G. M. and Sturek, M. (
1998
). Submaximal stimulation of porcine endothelial cells causes focal Ca2+ elevation beneath the cell membrane.
J. Physiol.
506
,
109
-125.
Grummer, R., Hohn, H. P., Mareel, M. M. and Denker, H. W. (
1994
). Adhesion and invasion of three human choriocarcinoma cell lines into human endometrium in a three-dimensional organ culture system.
Placenta
15
,
411
-429.
Hahn, T., Barth, S., Weiss, U., Mosgoeller, W. and Desoye, G. (
1998
). Sustained hyperglycemia in vitro down-regulates the GLUT1 glucose transport system of cultured human term placental trophoblast: a mechanism to protect fetal development?
FASEB J.
12
,
1221
-1231.
Harms, J. F., Welch, D. R. and Miele, M. E. (
2003
). KISS1 metastasis suppression and emergent pathways.
Clin. Exp. Metastasis
20
,
11
-18.
Hintermann, E., Bilban, M., Sharabi, A. and Quaranta, V. (
2001
). Inhibitory role of alpha 6 beta 4-associated erbB-2 and phosphoinositide 3-kinase in keratinocyte haptotactic migration dependent on alpha 3 beta 1 integrin.
J. Cell Biol.
153
,
465
-478.
Hori, A., Honda, S., Asada, M., Ohtaki, T., Oda, K., Watanabe, T., Shintani, Y., Yamada, T., Suenaga, M., Kitada, C. et al. (
2001
). Metastin suppresses the motility and growth of CHO cells transfected with its receptor.
Biochem. Biophys. Res. Commun.
286
,
958
-963.
Horikoshi, Y., Matsumoto, H., Takatsu, Y., Ohtaki, T., Kitada, C., Usuki, S. and Fujino, M. (
2003
). Dramatic elevation of plasma metastin concentrations in human pregnancy: metastin as a novel placenta-derived hormone in humans.
J. Clin. Endocrinol. Metab.
88
,
914
-919.
Huppertz, B., Kertschanska, S., Demir, A. Y., Frank, H. G. and Kaufmann, P. (
1998
). Immunohistochemistry of matrix metalloproteinases (MMP), their substrates, and their inhibitors (TIMP) during trophoblast invasion in the human placenta.
Cell Tissue Res.
291
,
133
-148.
Ilic, D., Genbacev, O., Jin, F., Caceres, R., Almeida, E. A., Bellingard-Dubouchaud, V., Schaefer, E. M., Damsky, C. H. and Fisher, S. J. (
2001
). Plasma membrane-associated pY397FAK is a marker of cytotrophoblast invasion in vivo and in vitro.
Am. J. Pathol.
159
,
93
-108.
Janneau, J. L., Maldonado-Estrada, J., Tachdjian, G., Miran, I., Motte, N., Saulnier, P., Sabourin, J. C., Cote, J. F., Simon, B., Frydman, R. et al. (
2002
). Transcriptional expression of genes involved in cell invasion and migration by normal and tumoral trophoblast cells.
J. Clin. Endocrinol. Metab.
87
,
5336
-5339.
Khatri, P., Draghici, S., Ostermeier, G. C. and Krawetz, S. A. (
2002
). Profiling gene expression using onto-express.
Genomics
79
,
266
-270.
Kliman, H. J. and Feinberg, R. F. (
1990
). Human trophoblast-extracellular matrix (ECM) interactions in vitro: ECM thickness modulates morphology and proteolytic activity.
Proc. Natl. Acad. Sci. USA
87
,
3057
-3061.
Kotani, M., Detheux, M., Vandenbogaerde, A., Communi, D., Vanderwinden, J. M., Le Poul, E., Brezillon, S., Tyldesley, R., Suarez-Huerta, N., Vandeput, F. et al. (
2001
). The metastasis suppressor gene KiSS-1 encodes kisspeptins, the natural ligands of the orphan G protein-coupled receptor GPR54.
J. Biol. Chem.
276
,
34631
-34636.
Lauffenburger, D. A. and Horwitz, A. F. (
1996
). Cell migration: a physically integrated molecular process.
Cell
84
,
359
-369.
Lee, J. H., Miele, M. E., Hicks, D. J., Phillips, K. K., Trent, J. M., Weissman, B. E. and Welch, D. R. (
1996
). KiSS-1, a novel human malignant melanoma metastasis-suppressor gene.
J. Natl. Cancer Inst.
88
,
1731
-1737.
Lee, J. H. and Welch, D. R. (
1997
). Suppression of metastasis in human breast carcinoma MDA-MB-435 cells after transfection with the metastasis suppressor gene, KiSS-1.
Cancer Res.
57
,
2384
-2387.
McMaster, M., Zhou, Y., Shorter, S., Kapasi, K., Geraghty, D., Lim, K. H. and Fisher, S. J. (
1998
). HLA-G isoforms produced by placental cytotrophoblasts and found in amniotic fluid are due to unusual glycosylation.
J. Immunol.
160
,
5922
-5928.
Morgan, M., Kniss, D. and McDonnell, S. (
1998
). Expression of metalloproteinases and their inhibitors in human trophoblast continuous cell lines.
Exp. Cell Res.
242
,
18
-26.
Muir, A. I., Chamberlain, L., Elshourbagy, N. A., Michalovich, D., Moore, D. J., Calamari, A., Szekeres, P. G., Sarau, H. M., Chambers, J. K., Murdock, P. et al. (
2001
). AXOR12, a novel human G protein-coupled receptor, activated by the peptide KiSS-1.
J. Biol. Chem.
276
,
28969
-28975.
Murray, M. J. and Lessey, B. A. (
1999
). Embryo implantation and tumor metastasis: common pathways of invasion and angiogenesis.
Semin. Reprod. Endocrinol.
17
,
275
-290.
Ohtaki, T., Shintani, Y., Honda, S., Matsumoto, H., Hori, A., Kanehashi, K., Terao, Y., Kumano, S., Takatsu, Y., Masuda, Y. et al. (
2001
). Metastasis suppressor gene KiSS-1 encodes peptide ligand of a G-protein-coupled receptor.
Nature
411
,
613
-617.
Sanchez-Carbayo, M., Capodieci, P. and Cordon-Cardo, C. (
2003
). Tumor suppressor role of KiSS-1 in bladder cancer: loss of KiSS-1 expression is associated with bladder cancer progression and clinical outcome.
Am. J. Pathol.
162
,
609
-617.
Shirasaki, F., Takata, M., Hatta, N. and Takehara, K. (
2001
). Loss of expression of the metastasis suppressor gene KiSS1 during melanoma progression and its association with LOH of chromosome 6q16.3-q23.
Cancer Res.
61
,
7422
-7425.
Simeone, A. (
1998
). In
In Situ Hybridization: A Practical Approach
(ed. D. G. Wilkinson), pp.
69
-86. New York: Oxford University Press.
Song, M., Ramaswamy, S., Ramachandran, S., Flowers, L. C., Horowitz, I. R., Rock, J. A. and Parthasarathy, S. (
2001
). Angiogenic role for glycodelin in tumorigenesis.
Proc. Natl. Acad. Sci. USA
98
,
9265
-9270.
Stafford, L. J., Xia, C., Ma, W., Cai, Y. and Liu, M. (
2002
). Identification and characterization of mouse metastasis-suppressor KiSS1 and its G-protein-coupled receptor.
Cancer Res.
62
,
5399
-5404.
Su, A. I., Cooke, M. P., Ching, K. A., Hakak, Y., Walker, J. R., Wiltshire, T., Orth, A. P., Vega, R. G., Sapinoso, L. M., Moqrich, A. et al. (
2002
). Large-scale analysis of the human and mouse transcriptomes.
Proc. Natl. Acad. Sci. USA
99
,
4465
-4470.
Takino, T., Koshikawa, N., Miyamori, H., Tanaka, M., Sasaki, T., Okada, Y., Seiki, M. and Sato, H. (
2003
). Cleavage of metastasis suppressor gene product KiSS-1 protein/metastin by matrix metalloproteinases.
Oncogene
22
,
4617
-4626.
Xu, P., Wang, Y., Piao, Y., Bai, S., Xiao, Z., Jia, Y., Luo, S. and Zhuang, L. (
2001
). Effects of matrix proteins on the expression of matrix metalloproteinase-2, -9, and -14 and tissue inhibitors of metalloproteinases in human cytotrophoblast cells during the first trimester.
Biol. Reprod.
65
,
240
-246.
Yan, C., Wang, H. and Boyd, D. D. (
2001
). KiSS-1 represses 92-kDa type IV collagenase expression by down-regulating NF-kappa B binding to the promoter as a consequence of Ikappa Balpha-induced block of p65/p50 nuclear translocation.
J. Biol. Chem.
276
,
1164
-1172.