Mouse 3T3-L1 cells are widely used to study adipocyte differentiation in vitro. When treated with insulin, dexamethasone and isobutylmethylxanthine these fibroblastic cells differentiate into round triglyceride-rich adipocytes. Because several proteins implicated in adipocyte differentiation(e.g. type 1 IGF receptors) are proteolytically activated by endoproteinases of the proprotein convertase family, we sought to determine whether these endoproteinases are crucial for adipose conversion. In this study, we show that expression of the proprotein convertases PACE4, PC7 and furin increases when 3T3-L1 cells are induced to differentiate into adipocytes. The differentiation was blocked in transfected cells expressingα1-antitrypsin Portland or in normal cells pre-treated with the synthetic inhibitor decanoyl-RVKR-chloromethylketone. Both inhibitors are known to specifically inactivate proprotein convertases. The block was associated with impaired proteolytic activation of proIGF-1 receptor, absence of induction of the adipogenic transcriptional factor PPARγ and marked reduction of the nuclear translocation of the C/EBPβ factor. Taken together, these data constitute evidence that proprotein convertases are crucial mediators of adipogenesis.

Introduction

3T3-L1 cells were selected from Swiss 3T3 mouse fibroblasts for their ability to differentiate into adipocytes. Upon growth arrest in the presence of fetal bovine serum (FBS), they become rounded and accumulate cytoplasmic lipid vesicles made of newly biosynthesized triglycerides(Green and Kehinde, 1975). This differentiation is accelerated when the cells are transiently exposed to a cocktail of inducing agents including dexamethasone (Dex),isobutylmethylxanthine (IBMX) and insulin (Ins)(Rubin et al., 1978).

The determining role of transcriptional regulation in this conversion has been extensively studied. Two families of transcription factors, the CCAAT/enhancer-binding proteins (C/EBPs) and the peroxisome proliferator-activated receptors (PPARs), play particularly important roles as mediators of adipogenic signals (Gregoire et al., 1998; Hwang et al.,1997). Among members of the C/EBP family, C/EBPβ and C/EBPδ regulate the early response to these signals. Their rapid and transient induction relays the effects of IBMX and Dex, and catalyzes the transactivation of C/EBPα and PPARγ genes(Cao et al., 1991;Yeh et al., 1995;Zhu et al., 1995). The latter factors, in turn, activate a variety of adipocyte-specific genes. Transduction of either factor in multipotent NIH-3T3 fibroblasts has been shown to promote their conversion into adipocytes (Freytag et al., 1994; Tontonoz et al.,1994).

Adipocyte differentiation may also be determined by post-translational modifications of adipogenic proteins. Proteolytic activation of latent precursors is one such modification. Sterol regulatory element binding protein 1 (SREBP-1), otherwise known as adipocyte determination and differentiation factor 1 (ADD1), represents an example of an adipogenic protein that needs activation by proteases. This transcriptional factor is released into the nucleus from a membrane-bound precursor located in the endoplasmic reticulum following two successive cleavages at distinct sites, the first by a pyrolysin-like convertase called site-1 protease(Sakai et al., 1998) or SKI-1(Seidah et al., 1999), the second by a metalloproteinase known as site-2 protease(Brown and Goldstein, 1999). SREBP-1 regulates genes involved in the biosynthesis of cholesterol and fatty acids (Brown and Goldstein,1999). Its downregulation has been shown to inhibit the differentiation of 3T3-L1 cells into adipocytes(Brun et al., 1996).

Receptors for insulin (InsR) and insulin-like growth factor 1 (IGF-1R) are other important mediators of adipocyte differentiation(Accili and Taylor, 1991;Smith et al., 1988) that are activated by limited proteolysis. These receptors are biosynthesized as inactive precursors and are rendered functional by a single cleavage into two chains (α and β) linked by disulfide bonds. Furin, the enzyme mediating this processing (Bravo et al.,1994; Lehmann et al.,1998) belongs to a family of serine proteinases known as proprotein convertases (PCs) (Seidah and Chretien, 1999; Zhou et al.,1999).

The PC family also includes PACE4, PC1/3, PC2, PC4, PC5/6 and PC7/8. Furin,PACE4, PC5 and PC7 are widely expressed. PC1 and PC2 are primarily found in endocrine and neuroendocrine cells. PC4 expression is mostly confined to the testis. PCs act in the secretory pathways where they cleave precursor proteins after selected pairs of basic residues. Their substrates include precursors to hormones and neuropeptides, cell surface receptors, extracellular matrix components, viral glycoproteins and bacterial toxins(Seidah and Chretien, 1999;Zhou et al., 1999).

Of all the PCs, furin has the widest variety of proteins among its substrates. This type 1-membrane-bound enzyme cycles between the TGN and the surface of all cells (Molloy et al.,1994). It cleaves its substrates after an R-X-K/R-R (X represents any amino acid) motif. This motif is found at the processing site of proInsR and proIGF-1R as well as that of precursors to extracellular matrix components such as stromelysin-3, fibrillin and membrane type 1 matrix metalloproteinase(Lönnqvist et al., 1998;Santavicca et al., 1996;Yana and Weiss, 2000). Furin cleavage of these precursors could thus be integral to mitogenic cell signaling and to plasma membrane remodeling. In this context, furin has been implicated in the growth and differentiation of gastric surface mucous cells and of cardiocytes (Konda et al.,1997; Sawada et al.,1997).

The importance of PCs in adipogenesis has not been examined before. In this report, we describe the regulation of several PC genes during adipocyte differentiation of 3T3-L1 cells. We also show that PC-specific inhibitors block this differentiation at an early stage, confirming the involvement of these proteinases for the process.

Materials and Methods

Cell culture and differentiation

3T3-L1 preadipocytes were obtained from the American Type Culture Collection and cultured in Dulbecco's modified Eagle's medium (DMEM)containing 10% FBS. Two days after they reached confluence (experimental day 0), they were induced to differentiate with 10 μg/ml of Ins, 0.5 mM IBMX and 1 μM Dex. On day 2 and every other day afterwards, fresh medium was substituted until day 7. Alternatively, post-confluent cells were incubated in medium containing varying concentrations of the synthetic inhibitor decanoyl-RVKR-chloromethylketone (dec-RVKR-CMK), for 24 hours before and for the 48 hours of adipogenic stimulation. The N-α-p-Tosyl-L-Phe-CMK,H-Glu-Gly-Arg-CMK peptides (Bachem), α1-antitrypsin (Sigma) and recombinant α1-PDX (Affinity Bioreagents) were used in control experiments. Inhibitor-free medium was then substituted and incubation resumed for 5 days. Differentiation was assessed by microscopy and Oil Red O staining. In the latter method, cells were washed twice with PBS, fixed in 3.7%formaldehyde for 1 hour and stained for 10 minutes with a 0.36% Oil Red O solution in 60% isopropanol. They were then rinsed with 60% isopropanol and washed several times with water (Green and Kehinde, 1975). For some experiments, cell number was determined by trypsinizing cell monolayers from 6-well culture dishes followed by counting.

Establishment of clonal lines of transfectant 3T3-L1 cells

The pcDNA3 expression vector (Invitrogen) and a derivative carrying a full-length cDNA for the PC inhibitor α1-antitrypsin Portland(α1-PDX) (Anderson et al.,1993; Benjannet et al.,1997; Dufour et al.,1998; Jean et al.,1998; Munzer et al.,1997; Tsuji et al.,1999a) were transfected into 3T3-L1 preadipocyte cells using the DOSPER Liposomal Transfection Reagent (Boehringer Mannheim). Independent G418-resistant clonal cell lines were established from clones picked from different transfection culture dishes.

Semi-quantitative RT-PCR

Total RNA was extracted using a guanidine isothiocyanate method previously described (Day et al., 1992). The RNA was treated with RNase-free DNaseI (Life Technologies) and 2 μg were reverse-transcribed into cDNA using the SuperScript II Reverse Transcriptase (Life Technologies). Three microliters of the reverse transcription reaction were used for PCR amplification of cDNA fragments for PC1, PC2, PC5, PC7, PACE4, furin, adipsin, PPARγ1 and γ2(collectively called PPARγ), α1-PDX or the ribosomal protein L30 as internal standard. The sequence of the PCR primers is shown inTable 1. The PCR reaction mixes contained 0.5 units of rTaq DNA polymerase (Life Technologies), 1× PCR buffer, 0.2 mM dNTP, 0.5 μM sense and antisense primers for a specific cDNA, and L30 in a 50 μl volume. PCR was performed with PC or α1-PDX primers for a total of 32-37 cycles, together with L30 primers for the last 20 cycles. For PPARγ and adipsin semi-quantification, the reaction was conducted for 25 cycles with their respective primers and L30 primers. The number of cycles was pre-determined to fall within the linear range of amplification of each PCR product. Each cycle involved a 94°C/1 minute denaturation step, a 60°C/1 minute annealing step, and a 72°C/1 minute polymerization step. The PCR products were electrophoresed on agarose gels,stained with ethidium bromide, revealed by UV irradiation and analyzed by densitometry using the National Institutes of Health Image software. The authenticity of the amplified sequences was verified by restriction enzyme mapping.

Table 1.

Primers used for RT-PCR amplification

Primer sequences
mRNAStrand*Sequence (5′→3′)PCR fragment length (bp)
PC1 GGATCTCTTCAATGATCCAATGTGG 398 
 AS CCTCAATGGCATCAGTTACAA  
PC2 GAGACCCGTCTTCACGAATC 541 
 AS GTTGAACCAGTCATCTGTGTATCG  
PC5 GGGCGGAGAGGCCTTGGA 532 
 AS TTTGTCGGTCTGTGCTTTCCAC  
PC7 CCCACCCTGATGAGGAGAATG 434 
 AS AAAGGCATCCGTCCCTCCTCA  
PACE4 GCATAGAAAGGAATCACCCAG 462 
 AS TGTAGCCATCACAGGAGCAG  
Furin TGAGCCATTCGTATGGCTACG 576 
 AS GGACACAGCTTTTCTGGTGCA  
Adipsin CCTGAACCCTACAAGCGATG 170 
 AS GGTTCCACTTCTTTGTCCTCG  
PPARγ GGAAAGACAACGGACAAATCAC 325 
 AS ATCCTTGGCCCTCTGAGATG  
α1-PDX CTCACCCACGATATCATCACC 382 
 AS TTTGGGTGGGATTCACCACTT  
L30 AAGTGGGAAGTACGTGCTGG 272 
 AS CACCAGTCTGTTCTGGCATG  
Primer sequences
mRNAStrand*Sequence (5′→3′)PCR fragment length (bp)
PC1 GGATCTCTTCAATGATCCAATGTGG 398 
 AS CCTCAATGGCATCAGTTACAA  
PC2 GAGACCCGTCTTCACGAATC 541 
 AS GTTGAACCAGTCATCTGTGTATCG  
PC5 GGGCGGAGAGGCCTTGGA 532 
 AS TTTGTCGGTCTGTGCTTTCCAC  
PC7 CCCACCCTGATGAGGAGAATG 434 
 AS AAAGGCATCCGTCCCTCCTCA  
PACE4 GCATAGAAAGGAATCACCCAG 462 
 AS TGTAGCCATCACAGGAGCAG  
Furin TGAGCCATTCGTATGGCTACG 576 
 AS GGACACAGCTTTTCTGGTGCA  
Adipsin CCTGAACCCTACAAGCGATG 170 
 AS GGTTCCACTTCTTTGTCCTCG  
PPARγ GGAAAGACAACGGACAAATCAC 325 
 AS ATCCTTGGCCCTCTGAGATG  
α1-PDX CTCACCCACGATATCATCACC 382 
 AS TTTGGGTGGGATTCACCACTT  
L30 AAGTGGGAAGTACGTGCTGG 272 
 AS CACCAGTCTGTTCTGGCATG  
*

S, sense; AS, antisense.

Western blot analysis

Cells were washed with PBS and scraped off dishes in 1 ml of PBS. They were sedimented by centrifugation, lysed by the addition of 100 μl of SDS-gel buffer, and heated to 100°C for 5 minutes(Cao et al., 1991). Extracted proteins were fractionated by 12% SDS-PAGE and transferred to Immobilon-P membranes (Millipore). The membranes were incubated with an anti-C/EBPβantibody (Santa Cruz Biotechnology) and immunoreactive proteins were revealed by chemiluminescence (Amersham). To equalize protein loading, a preliminary protein gel was stained with Coomassie brilliant blue for a visual estimation of the quantity of proteins in the cellular extracts. Nuclear extracts were prepared as described by Dent and Latchman(Dent and Latchman, 1993) from cells treated for 24 hours with the adipogenesis-inducing agents. Aliquots equivalent to 50 μg of proteins were treated or not with 50 units of calf intestine alkaline phosphatase (CIAP) (Boehringer) for 1 hour at 37°C;they were then diluted in SDS-gel buffer, boiled for 5 minutes and analyzed by Western blotting for C/EBPβ proteins.

To examine proIGF-1R proteolytic processing, we used transfected control and α1-PDX preadipocytes as well as normal preadipocytes treated at confluency with 0 or 100 μM dec-RVKR-CMK for 48 hours. Whole-cell extracts in 60 mM Tris-HCl buffer, pH 7.5/1% SDS were prepared; aliquots corresponding to 100 μg of proteins were fractionated by 8% SDS-PAGE and analyzed by immunoblotting as described above using an antibody against the β subunit of IGF-1R (Santa Cruz Biotechnology).

IRS-1 phosphorylation was examined by sequential probing of a blot carrying 50 μg of proteins from control and α1-PDX cells, stimulated or not with insulin (10 μg/ml). Probing was conducted subsequently with an anti-IRS-1 antibody and, after membrane stripping using Re-Blot Plus-Mild(Chemicon), with an anti-phosphotyrosine antibody. Both antibodies were obtained from Santa Cruz Biotechnology.

Electrophoretic mobility shift assay (EMSA)

A 5′-[32P]-labeled double-stranded C/EBP consensus oligonucleotide (5′-GAT CGA TTG CGC AAT C-3′)(Osada et al., 1996) was used as probe. The binding mixture contained 10 μg of nuclear extract, 2 μg of poly dI-dC, 20 mM Hepes, pH 7.9, 4% Ficoll, 0.5 mM DTT, 1 mM MgCl2, 50 mM KCl and 20,000 cpm of labeled probe. It was incubated for 40 minutes at 4°C. In competition assays, the mixture was supplemented with a 100-fold molar excess of unlabeled oligonucleotide prior to adding the labeled probe. In supershift assays, nuclear extracts were incubated for 90 minutes with 1 μg of an antibody directed against the C-terminus of C/EBPβ prior to adding the labeled probe. The binding mixtures were electrophoresed at 100 V at room temperature in a 6% nondenaturing polyacrylamide gel with a 45 mM Tris-borate/1 mM EDTA buffer. The gel was then dried and subjected to autoradiography.

Immunohistochemistry

Confluent preadipocytes were induced to differentiate for 24 hours; they were then fixed with 50% ethanol/1% H2O2 and incubated for 90 minutes with the anti-C/EBPβ antibody (diluted 1:250). The immunoreaction was amplified using a horseradish peroxidase-based Tyramine Signal Amplification (TSA) Plus DNP kit (NEN Life Science Products), and revealed using the chromogenic substrate 3,3′ diaminobenzidine.

Results

Regulation of furin, PC7 and PACE4 during adipocyte differentiation

We first determined by semi-quantitative RT-PCR the relative levels of PC mRNAs in 3T3-L1 cells before and after their differentiation into adipocytes. This technique was chosen for its sensitivity, considering the low levels of some PCs in these cells. In both cell types, transcripts for PC7 were the most abundant, followed by those for furin and PACE4(Fig. 1A). PC1 and PC2 transcripts were present at very low levels (not shown). PC5 mRNA transcripts were not detected. Expression of the testis-restricted PC4 was not examined. There were more transcripts for PC7, furin and PACE4 in adipocytes than in preadipocytes (Fig. 1A,B). The kinetics of this increase is shown in Fig. 1B. The starting level of PACE4 transcripts was very low, but it increased from day 3 to about tenfold the starting level on day 7(P<0.001). PC7 mRNA increased gradually to threefold the starting level by day 7 (P<0.005). Furin transcripts, in contrast, sharply increased to 2.5-fold the starting level (P<0.005) during the 2-day inducing treatment, sharply diminished on day 3 and gradually increased again to twice the starting level by day 7 (P<0.005). The changes in the mRNA levels of the three PCs during adipocyte differentiation suggested that these enzymes play a role in this process.

Fig. 1.

Levels of PACE4, PC7 and furin transcripts in 3T3-L1 cells during adipocyte conversion. (A) Total RNA extracted from 3T3-L1 preadipocytes and adipocytes was analyzed by semi-quantitative RT-PCR as described in Materials and Methods. RNA from epididymal WAT was also examined for comparison. (B) Ratios between PC and L30 densitometric values obtained by semi-quantitative RT-PCR were determined. They are presented as percent of maximal expression of each PC. The values represent means±s.e.m. of five independent experiments.

Fig. 1.

Levels of PACE4, PC7 and furin transcripts in 3T3-L1 cells during adipocyte conversion. (A) Total RNA extracted from 3T3-L1 preadipocytes and adipocytes was analyzed by semi-quantitative RT-PCR as described in Materials and Methods. RNA from epididymal WAT was also examined for comparison. (B) Ratios between PC and L30 densitometric values obtained by semi-quantitative RT-PCR were determined. They are presented as percent of maximal expression of each PC. The values represent means±s.e.m. of five independent experiments.

For comparison, we also examined the relative levels of these transcripts in epididymal white adipose tissue (WAT) from C57B1/6 mice. Compared with 3T3-L1 adipocytes, WAT contained more PACE4 transcripts, less PC7 transcripts and markedly less furin transcripts (Fig. 1A). These differences may be due to the fact that, unlike 3T3-L1 adipocytes, the WAT is made of a heterogeneous populations of cells(Smas and Sul, 1995) that may have distinct patterns of PC transcripts.

PC inhibitors block adipocyte differentiation

To assess the importance of these PCs for adipogenic conversion, we produced clonal lines of 3T3-L1 transfectants carrying either the pcDNA3 vector (control cell lines) or a pcDNA3/α1-PDX for expression of the PC-specific inhibitor α1-PDX (α1-PDX cell lines). Because 3T3-L1 cells are notorious for spontaneously giving rise to differentiation-resistant cells, 3 control and 16 α1-PDX transfectant cell lines were established. These cell lines were induced to differentiate and stained with Oil Red O. A typical staining before and after adipogenic treatment is illustrated inFig. 2A. All 3 control cell lines stained very strongly with Oil Red O, an indication that they accumulated substantial amounts of cytoplasmic triglycerides. By contrast, 14 out of the 16 cell lines derived from transfection with the α1-PDX expression vector exhibited noticeably reduced staining with Oil Red O(Fig. 2A), indicative of low triglyceride content. By light microscopy, only 2-5% of cells in these lines contained lipid vesicles typical of fully differentiated adipocytes (not shown). Transcripts for α1-PDX were detectable by RT-PCR in the 14 lines. They were absent in control lines. A representative analysis of the PCR product is shown in Fig. 2B. All subsequent experiments involving transfected cells were conducted with the 3 control cell lines and 3 randomly selected α1-PDX-positive cell lines. To ascertain that the effect of α1-PDX is specific, we also used recombinant α1-PDX, which has been shown to efficiently inhibit cellular PC activities when added to cell culture medium(Jean et al., 1998). As control, we used the α1-antitrypsin (α1-AT) protein, from whichα1-PDX was derived but which is not a PC inhibitor(Anderson et al., 1993) As expected, α1-PDX added in medium at 8 μM blocked adipocyte differentiation whereas α1-AT had no effect at this concentration(Fig. 3A).

Fig. 2.

α1-PDX expression inhibits 3T3-L1 adipocyte differentiation. (A)Three control and 16 α1-PDX 3T3-L1 independent transfectant cell lines at confluence were treated (or not) with adipogenesis-inducing agents for 2 days. They were subsequently cultured for 5 days, fixed and stained with Oil Red O on day 7. A typical staining of differentiated and undifferentiated cells is shown. Unlike control cells, α1-PDX transfectant cell lines failed to respond to the adipogenic treatment. (B) Expression of α1-PDX transgene by RT-PCR in control and α1-PDX transfectants cell lines. Transcripts were observed in α1-PDX cells and not in control cells.

Fig. 2.

α1-PDX expression inhibits 3T3-L1 adipocyte differentiation. (A)Three control and 16 α1-PDX 3T3-L1 independent transfectant cell lines at confluence were treated (or not) with adipogenesis-inducing agents for 2 days. They were subsequently cultured for 5 days, fixed and stained with Oil Red O on day 7. A typical staining of differentiated and undifferentiated cells is shown. Unlike control cells, α1-PDX transfectant cell lines failed to respond to the adipogenic treatment. (B) Expression of α1-PDX transgene by RT-PCR in control and α1-PDX transfectants cell lines. Transcripts were observed in α1-PDX cells and not in control cells.

Fig. 3.

Effect of exogenously added serine protease inhibitors on adipocyte conversion. Post-confluent 3T3-L1 cells were incubated for 24 hours before and 48 hours during the adipogenic induction in medium containing α1-AT,α1-PDX or dec-RVKR-CMK. They were then cultured for 5 days in normal medium and stained with Oil Red O on day 7 to assess conversion. (A) Staining was reduced in cells treated with 8 μM α1-PDX, but not in those treated with α1-AT. (B) Treatment with dec-RVKR-CMK reduced the staining in a concentration-dependent manner. The same results were obtained in four separate experiments. (C) By general cellular morphology, blockage of adipocyte conversion was partial at 20 μM dec-RVKR-CMK and complete at 100μM.

Fig. 3.

Effect of exogenously added serine protease inhibitors on adipocyte conversion. Post-confluent 3T3-L1 cells were incubated for 24 hours before and 48 hours during the adipogenic induction in medium containing α1-AT,α1-PDX or dec-RVKR-CMK. They were then cultured for 5 days in normal medium and stained with Oil Red O on day 7 to assess conversion. (A) Staining was reduced in cells treated with 8 μM α1-PDX, but not in those treated with α1-AT. (B) Treatment with dec-RVKR-CMK reduced the staining in a concentration-dependent manner. The same results were obtained in four separate experiments. (C) By general cellular morphology, blockage of adipocyte conversion was partial at 20 μM dec-RVKR-CMK and complete at 100μM.

To further confirm the importance of PCs for adipocyte differentiation, we incubated untransfected post-confluent 3T3-L1 cells, for 24 hours before and for the 48 hours of adipogenic stimulation, in medium containing non-cytotoxic amounts (20-100 μM) of dec-RVKR-CMK, an irreversible inhibitor of PCs(Angliker, 1995;Munzer et al., 1997;Santavicca et al., 1996;Tsuji et al., 1999a). Then we assessed their adipogenic response by Oil Red O staining. Incubation with the inhibitor reduced the staining in a concentration-dependent manner(Fig. 3B). Maximum inhibition was reached at 80 μM dec-RVKR-CMK. The general cellular morphology after adipogenic treatment is shown in Fig. 3C. Adipocyte conversion was extensive in the absence of the inhibitor. It was blocked in its presence, partially at 20 μM and completely at 100 μM. The timing of incubation with the inhibitor was critical as addition of the latter any time after the two-day induction period failed to block differentiation (data not shown). Thus, like α1-PDX,this synthetic inhibitor was able to block the adipocyte conversion of 3T3-L1 cells, reinforcing the view that PCs are crucial for adipogenesis.

Altered expression of adipsin, PPARγ and C/EBPβ inα1-PDX-expressing cells

To further characterize the phenotype of the α1-PDX-transduced cells,we examined by semi-quantitative RT-PCR the relative levels of PPARγ and adipsin. The former is an early marker of adipogenic conversion and the latter a late marker of the adipocyte phenotype. Representative results are illustrated in Fig. 4. Expectedly, the levels of PPARγ and adipsin mRNA transcripts markedly increased in control cells after adipogenic induction. By contrast, inα1-PDX-expressing cells, a similar treatment produced only a slight and belated induction in the level of adipsin transcripts and none at all for PPARγ transcripts.

Fig. 4.

Expression of PPARγ and adipsin transcripts in 3T3-L1 transfectants. Total RNA isolated on days 0, 1, 2, 3, 5 and 7 after adipogenic induction was analyzed by semi-quantitative RT-PCR as described in Materials and Methods. Results are representative of five independent experiments on three individual clones of each transfectant type. The levels of PPARγ and adipsin transcripts markedly increased in control cells during differentiation. Inα1-PDX cells, the increase was significantly lower for adipsin and not observed for PPARγ.

Fig. 4.

Expression of PPARγ and adipsin transcripts in 3T3-L1 transfectants. Total RNA isolated on days 0, 1, 2, 3, 5 and 7 after adipogenic induction was analyzed by semi-quantitative RT-PCR as described in Materials and Methods. Results are representative of five independent experiments on three individual clones of each transfectant type. The levels of PPARγ and adipsin transcripts markedly increased in control cells during differentiation. Inα1-PDX cells, the increase was significantly lower for adipsin and not observed for PPARγ.

The gene for PPARγ is one of those activated by C/EBPβ in the cascade of transcriptional events leading to the adipogenic conversion of 3T3-L1 cells (Zhu et al.,1995). We therefore examined how C/EBPβ expression was affected by α1-PDX transduction. By western blot analysis, total extracts from control and α1-PDX-expressing cells contained comparable levels of the LIP (liver-enriched inhibitory protein) and LAP (liver-enriched activating protein) C/EBPβ isoforms(Fig. 5A). These levels transiently increased during the 2-day treatment with inducing agents, as expected (Cao et al., 1991). However, when nuclear extracts from these transfectant lines were analyzed by C/EBPβ-specific EMSA, the complexes observed with nuclear extracts fromα1-PDX-expressing cells were of lesser intensity and of faster electrophoretic mobility than those observed with nuclear extracts from control cells (Fig. 5B, lane 1 versus lane 4). In both cases, the oligonucleotide electrophoretic shift was specifically due to C/EBPβ binding since the complexes could be retarded in the presence of an anti-C/EBPβ antibody(Fig. 5B, lanes 2,5) and abrogated in the presence of unlabeled competing oligonucleotide(Fig. 5B, lanes 3,6). These results suggested that, compared with control cells, α1-PDX-expressing cells contained less or less active C/EBPβ in their nucleus. We conducted a comparative western blot analysis of the nuclear extracts to verify these possibilities. Nuclear extracts from control cells contained two LAP immunoreactive bands of nearly equal intensities; those fromα1-PDX-expressing cells contained noticeably less of both isoforms, and even less of the slower-migrating one (Fig. 5C, lanes 1,2). The latter represented a phosphorylated form of the faster-migrating isoform, as shown by its disappearance in CIAP-treated nuclear extracts (Fig. 5C,lanes 3,4).

Fig. 5.

C/EBPβ expression, binding activity and localization in 3T3-L1 transfectants. (A) Control and α1-PDX cells were subjected to an adipogenic treatment as described in Materials and Methods. Cell extracts were prepared on days 0, 1, 2, 3, 5 and 7. Aliquots of 25 μl were fractionated by SDS-PAGE and analyzed by immunoblotting for C/EBPβ. The antibody recognized the LAP (liver-enriched activating protein, 32 kDa) and the LIP(liver-enriched inhibitor protein, 18 kDa) C/EBPβ isoforms. Control andα1-PDX producing cells carried equivalent amounts of both isoforms. (B)Nuclear extracts were prepared from control or α1-PDX expressing preadipocytes treated with adipogenesis-inducing agents for 24 hours. An EMSA of a radiolabeled C/EBP consensus oligonucleotide probe was conducted using 10μg of nuclear extract proteins. For supershift assays, the extract was preincubated with an antibody directed against the C-terminus of C/EBPβ. In competition assays, a 100-fold molar excess of unlabeled oligonucleotide was supplemented to the binding mixture. (C) The nuclear extracts (50 μg of proteins) analyzed for binding activity in (B) were fractionated by SDS-PAGE and further analyzed by immunoblotting for C/EBPβ. Extracts fromα1-PDX-expressing cells contained less C/EBPβ LAP than those from control cells (lanes 1,2). The upper band in lane 1 corresponded to a hyperphosphorylated form of C/EBPβ as demonstrated by its disappearance in CIAP-treated extracts (lanes 3,4). The blots shown are representative of three separate experiments with three control and three α1-PDX clonal lines. (D) Immunohistochemical analysis on 3T3-L1 transfectant cells after adipogenic treatment for 24 hours. Localization of C/EBPβ was nuclear in control cells (c) and perinuclear in α1-PDX-expressing cells (d). Panels a and c represent control samples not treated with the anti-C/EBPβprimary antibody.

Fig. 5.

C/EBPβ expression, binding activity and localization in 3T3-L1 transfectants. (A) Control and α1-PDX cells were subjected to an adipogenic treatment as described in Materials and Methods. Cell extracts were prepared on days 0, 1, 2, 3, 5 and 7. Aliquots of 25 μl were fractionated by SDS-PAGE and analyzed by immunoblotting for C/EBPβ. The antibody recognized the LAP (liver-enriched activating protein, 32 kDa) and the LIP(liver-enriched inhibitor protein, 18 kDa) C/EBPβ isoforms. Control andα1-PDX producing cells carried equivalent amounts of both isoforms. (B)Nuclear extracts were prepared from control or α1-PDX expressing preadipocytes treated with adipogenesis-inducing agents for 24 hours. An EMSA of a radiolabeled C/EBP consensus oligonucleotide probe was conducted using 10μg of nuclear extract proteins. For supershift assays, the extract was preincubated with an antibody directed against the C-terminus of C/EBPβ. In competition assays, a 100-fold molar excess of unlabeled oligonucleotide was supplemented to the binding mixture. (C) The nuclear extracts (50 μg of proteins) analyzed for binding activity in (B) were fractionated by SDS-PAGE and further analyzed by immunoblotting for C/EBPβ. Extracts fromα1-PDX-expressing cells contained less C/EBPβ LAP than those from control cells (lanes 1,2). The upper band in lane 1 corresponded to a hyperphosphorylated form of C/EBPβ as demonstrated by its disappearance in CIAP-treated extracts (lanes 3,4). The blots shown are representative of three separate experiments with three control and three α1-PDX clonal lines. (D) Immunohistochemical analysis on 3T3-L1 transfectant cells after adipogenic treatment for 24 hours. Localization of C/EBPβ was nuclear in control cells (c) and perinuclear in α1-PDX-expressing cells (d). Panels a and c represent control samples not treated with the anti-C/EBPβprimary antibody.

Reduced translocation of C/EBPβ into the nucleus of stimulatedα1-PDX-expressing cells was further confirmed by immunohistochemistry. The results are shown in Fig. 5D. After a 24-hour stimulation with the adipogenic agents,C/EBPβ immunoreactivity in control cells was concentrated in the nucleus(Fig. 5Db), it was mostly perinuclear in the α1-PDX-expressing cells(Fig. 5Dd). The specificity of the immunoreaction was ascertained by omitting the anti-C/EBPβ antibody in the protocol (Fig. 5Da,c).

PC inhibitors block the processing of prolGF-1 receptors and mitotic clonal expansion

The observed blockage by PC inhibitors of the transcriptional cascade leading to adipocyte differentiation was most probably due to a failure in the signaling pathways normally induced by adipogenic treatment. The insulin and IGF-1 signaling pathway is one that is likely to be affected by the inhibitor since the latter may reduce activation of proIGF-1R by furin(Lehmann et al., 1998). To verify that the proIGF-1R processing is abolished by PC inhibition, 3T3-L1 confluent preadipocytes were treated or not with dec-RVKR-CMK and analyzed for proIGF-1R processing by immunoblotting. The results are shown inFig. 6A. In the absence of the inhibitor, there was complete proIGF-1R processing since only the mature IGF-1R β chain was detected (Fig. 6A, lane 1). In dec-RVKR-CMK-treated cells, by contrast, proIGF-1R was much more abundant than the mature IGF-1R β chain(Fig. 6A, lane 2). We observed the same block of proIGF-1R processing in the α1-PDX-expressing cells compared with control cells (Fig. 6A, lanes 3,4). This observation confirms the role of PCs in proIGF-1R processing in 3T3-L1 cells. It also suggests that the block of adipocyte differentiation may be due to inhibition of proIGF-1R processing.

Fig. 6.

Effect of PC inhibitors on IGF-1 receptor pathway. (A) Confluent 3T3-L1 preadipocyte cells treated or not with dec-RVKR-CMK (100 μM) for 48 hours(lanes 1,2) as well as control and α1-PDX cells (lanes 3,4) were analyzed by immunoblot for proIGF-1R processing. The arrowhead points to an unknown immuno-crossreactive protein that was unaffected by the inhibitor. (B)IRS-1 phosphorylation was analyzed by sequential probing of a blot carrying proteins from control and α1-PDX cells, stimulated or not with insulin(10 μg/ml). The first probing was conducted with an anti-IRS-1 antibody and the second probing was conducted with an anti-phosphotyrosine antibody. (C)Effect on mitotic clonal expansion. Control and α1-PDX cells were induced or not to differentiate. After 3 days, cells from 6-well culture dishes were trypsinized and cell number was determined by counting. Data shown are the means±s.e. Results are representative of three independent experiments with three individual clones of each cell lines.

Fig. 6.

Effect of PC inhibitors on IGF-1 receptor pathway. (A) Confluent 3T3-L1 preadipocyte cells treated or not with dec-RVKR-CMK (100 μM) for 48 hours(lanes 1,2) as well as control and α1-PDX cells (lanes 3,4) were analyzed by immunoblot for proIGF-1R processing. The arrowhead points to an unknown immuno-crossreactive protein that was unaffected by the inhibitor. (B)IRS-1 phosphorylation was analyzed by sequential probing of a blot carrying proteins from control and α1-PDX cells, stimulated or not with insulin(10 μg/ml). The first probing was conducted with an anti-IRS-1 antibody and the second probing was conducted with an anti-phosphotyrosine antibody. (C)Effect on mitotic clonal expansion. Control and α1-PDX cells were induced or not to differentiate. After 3 days, cells from 6-well culture dishes were trypsinized and cell number was determined by counting. Data shown are the means±s.e. Results are representative of three independent experiments with three individual clones of each cell lines.

To confirm that the IGF-1R pathway was affected, we analyzed IRS-1 phosphorylation in control and α1-PDX cells(Fig. 6B). This analysis was conducted by sequential probing of a blot carrying proteins from control andα1-PDX cells, stimulated or not with insulin. The insulin concentration used was high enough to activate type 1 IGF-1R. The first probing conducted with an anti-IRS-1 antibody revealed an IRS-1 band in both control andα1-PDX cells. The second probing conducted with an anti-phosphotyrosine antibody revealed a band overlapping that of IRS-1 only in insulin-stimulated control cells.

Early following differentiation induction, 3T3-L1 preadipocytes undergo∼2 rounds of mitotic clonal expansion as they express the early adipogenic genes (Tang and Lane, 1999). It was recently demonstrated that mitotic clonal expansion was induced only by insulin and not by IBMX or Dex (Qiu et al., 2001). We therefore examined whether this event was altered in α1-PDX cells. To do so, we induced post-confluent control andα1-PDX cells and, three days later, we determined their number. For control cells, the number increased almost fourfold, whereas it did not significantly change in α1-PDX cells(Fig. 6C), indicating thatα1-PDX expression affected the mitotic clonal expansion step.

Discussion

The possibility of a physiological link between endoproteinases and adipogenesis has been of increased scientific interest in recent years following the observation that AIDS patients treated with aspartyl protease inhibitors develop a lipodystrophy syndrome(Carr, 2000;Dowell et al., 2000;Nguyen et al., 2000;Caron et al., 2001). Our laboratory studies the role of another class of endoproteinases, namely the PC family of serine proteases, in adipocyte differentiation. In this report, we show that expression of PACE4, PC7 and furin during adipocyte conversion of 3T3-L1 cells increases in distinctive fashions. The mRNA level of PC7 increases in a nearly linear fashion; that of PACE4 begins after the 2-day treatment with inducing agents, and that of furin transcripts was maximal during the treatment. Interestingly, the levels of furin transcripts change in parallel with that of C/EBPβ. Three different promoters, P1, P1A, and P1B, drive transcription of the furin gene(Ayoubi et al., 1994). The P1 promoter carries a C/EBP binding element that can be activated by transduced C/EBPβ (Ayoubi et al.,1994). Activation of this promoter may explain the observed correlation in the levels of furin transcripts and immunoreactive C/EBPβduring adipogenic stimulation. The increase in PACE4 mRNA may be due to SREBP-induced activation of its gene since its promoter contains a functional E box (Tsuji et al., 1999b). SREBP-1, which is known to be induced in 3T3-L1 cells after adipogenic stimulation (Kim and Spiegelman,1996), may activate the PACE4 gene through this element. There is a PPAR binding site in the PC7 gene promoter (F. Sirois and M. Mbikay,unpublished). Thus the increase of PC7 transcripts may result from the activation of its gene by PPAR following its induction during adipogenic conversion.

To assess the importance of PCs in the adipocyte differentiation of 3T3-L1 cells, we produced transfectant cell lines expressing the PC inhibitorα1-PDX. The majority (14/16) of these cell lines failed to convert into adipocytes when subjected to an adipogenic treatment. The two lines that were able to convert were not characterized. They may have derived either from spontaneously G418-resistant cells, from cells that had incorporated a fragment of the expression vector containing the resistance gene but not theα1-PDX transgene, or from cells that had incorporated the full vector but in a transcription-repressing genomic environment. Endogenous expression of α1-PDX did not cause any change in cell growth or in the levels of apoptosis markers (not shown). The fact that addition of recombinantα1-PDX or the synthetic PC inhibitor dec-RVKR-CMK to the culture medium of a native population of 3T3-L1 cells induced a similar differentiation block is a strong indication that the observations made with α1-PDX transfectant lines were due to the action of this inhibitor and not caused by some clonal variation among 3T3-L1 cells. Other peptidyl CMKs such as N-α-p-Tosyl-L-Phe-CMK and H-Glu-Gly-Arg-CMK had no inhibiting effect on adipocyte differentiation when added in the medium (not shown).

The differentiation block was associated with absence of PPARγinduction. These factors regulate a variety of genes for proteins involved in lipid metabolism (Tontonoz et al.,1994). PPAR gene activation is mediated by members of the C/EBP(Wu et al., 1996) and SREBP(Fajas et al., 1999) families. The PPARγ gene promoter carries two functional C/EBP binding sites(Zhu et al., 1995) and two E-boxes (Fajas et al., 1999). Adipogenic stimuli induce as much C/EBPβ in α1-PDX-expressing cells as in control cells. However, the amount of C/EBPβ LAP isoform,particularly its phosphorylated isoform, is dramatically reduced in the nucleus. Moreover, nuclear C/EBPβ from α1-PDX-transduced cells,together with a consensus C/EBP oligonucleotide, forms a complex of faster electrophoretic mobility on EMSA. The abnormal EMSA and western blot banding patterns of nuclear C/EBPβ from α1-PDX-expressing cells may be due to inefficient post-translational modification of the factor. Thus, nearly complete failure of C/EBPβ translocation into the nucleus and abnormal interactions with its binding sites in the PPARγ promoter may explain why this gene is not activated by adipogenic signals inα1-PDX-expressing cells. C/EBPβ is an early response factor in the adipogenic signaling pathways as indicated by its rapid increase following adipogenic stimulation. This regulation is reportedly mediated by cAMP in response to IBMX (Yeh et al.,1995). It has been reported that C/EBPβ can be phosphorylated at multiple sites and that, depending on the phosphorylated site, its DNA-binding activity either increases or decreases(Trautwein et al., 1993;Trautwein et al., 1994;Piwien-Pilipuk et al., 2001). Moreover, it appears that acquisition of binding activity during mitotic clonal expansion involves phosphorylation of C/EBPβ(Tang and Lane, 1999). Our results do not imply that lack of C/EBPβ translocation into the nucleus is due to an abnormal phosphorylation. They simply suggest that α1-PDX prevents PC activation of proproteins involved in the signaling pathways leading to C/EBP activation and nuclear translocation. The identity of these precursors remains to be determined.

A signaling pathway that is most certainly affected by this inhibitor involves the InsR/IGF-1R and the mitogen-activated protein kinase pathway(Boney et al., 1998). Both receptors are proven furin substrates(Bravo et al., 1994;Lehmann et al., 1998). Both are known to be crucial for the proliferation and adipocyte conversion of 3T3-L1 cells (Accili and Taylor,1991; Smith et al.,1988). In this study, we have shown that α1-PDX as well as a synthetic inhibitor of PCs can block proIGF-1R proteolytic maturation to IGF-1R in preadipocyte cells. Unprocessed receptors would not efficiently bind IGF-1 or insulin and would thus be unable to initiate the downstream signaling normally observed with their processed forms. Signal transduction by these peptides leads to phosphorylation of insulin-receptor substrate 1 (IRS-1)(Myers et al., 1994). We show in this study that this phosphorylation does not occur in insulin-stimulatedα1-PDX-expressing 3T3-L1 cells. We also show the mitotic clonal expansion step, which depends on insulin induction(Qiu et al., 2001), is inhibited in α1-PDX cells..

For optimal inhibitory effect, the synthetic inhibitor dec-RVKR-CMK must be added to post-confluent cells 24 hours before and 48 hours during adipogenic treatment. This timing is required presumably to reduce the amounts of pre-existing active PCs and PC-processed adipogenic products, such as IGF-1R,and to prevent activation of those induced during adipogenesis. The differentiation block is not reversed by removal of the inhibitor, suggesting that active PCs are most crucial in the early steps of adipocyte conversion.

Which, among furin, PACE4 and PC7, is the most critical enzyme for the adipocyte differention of 3T3-L1 cannot be determined solely from the use of the dec-RVKR-CMK synthetic inhibitor, as the latter inhibits all three convertases indiscrimately. However, there are several reasons to believe that furin is the determining enzyme in this process. First, it is the primary maturation enzyme for several adipocyte signaling molecules including IGF-1R,InsR and the low density lipoprotein receptor-related protein(Bravo et al., 1994;Ko et al., 1998;Lehmann et al., 1998). Second,its rapid induction early during adipogenic stimulation, in the same time window as when blockage of differentiation by the synthetic PC inhibitor is most effective, suggests that it is needed to promote the processing of these and other precursor proteins. Third, of the major three PCs found in 3T3-L1 preadipocytes, PACE4 is barely detectable at the crucial early steps of induction and PC7, which is more readily detected in these cells, is poorly inhibitable by α1-PDX compared with furin(Benjannet et al., 1997;Jean et al., 1998). Finally,furin has been implicated in the regulation of growth and differentiation of other cell types including gastric surface mucous cells and cardiocytes(Konda et al., 1997;Sawada et al., 1997). Moreover, it is interesting to note that the furin gene maps in a mouse chromosome 7 region that has been shown by quantitative trait linkage analysis to affect adiposity in a dominant fashion(Taylor and Phillips, 1996). As for PACE4 and PC7, their expression pattern would be compatible with yet unknown roles late in adipocyte differentiation.

To summarize, we have presented evidence that PCs play an important role in the adipocyte differentiation of 3T3-L1 cells. We have shown that blockage of adipose conversion with PC-specific inhibitors is associated with a dramatic reduction of the nuclear translocation of the C/EBPβ factor.

Acknowledgements

The authors are grateful to Gary Thomas for the gift of the α1-PDX cDNA and to Alexander Sorisky for his critical reading of this manuscript. This work was supported by the Medical Research Council of Canada (to N.G.S. and M.C.) and the Natural Sciences and Engineering Council of Canada (to M.M. and A.B.). G.C. was a postdoctoral fellow of France's Association pour la recherche contre le cancer.

References

Accili, D. and Taylor, S. I. (
1991
). Targeted inactivation of the insulin receptor gene in mouse 3T3-L1 fibroblasts via homologous recombination.
Proc. Natl. Acad. Sci. USA
88
,
4708
-4712.
Anderson, E. D., Thomas, L., Hayflick, J. S. and Thomas, G.(
1993
). Inhibition of HIV-1 gp160-dependent membrane fusion by a furin-directed alpha 1-antitrypsin variant.
J. Biol. Chem.
268
,
24887
-24891.
Angliker, H. (
1995
). Synthesis of tight binding inhibitors and their action on the proprotein-processing enzyme furin.
J. Med. Chem.
38
,
4014
-4018.
Ayoubi, T. A., Creemers, J. W., Roebroek, A. J. and Van de Ven,W. J. (
1994
). Expression of the dibasic proprotein processing enzyme furin is directed by multiple promoters.
J. Biol. Chem.
269
,
9298
-9303.
Benjannet, S., Savaria, D., Laslop, A., Munzer, J. S.,Chrétien, M., Marcinkiewicz, M. and Seidah, N. G.(
1997
). Alphal-antitrypsin Portland inhibits processing of precursors mediated by proprotein convertases primarily within the constitutive secretory pathway.
J. Biol. Chem.
272
,
26210
-26218.
Boney, C. M., Smith, R. M. and Gruppuso, P. A.(
1998
). Modulation of insulin-like growth factor I mitogenic signaling in 3T3-L1 preadipocyte differentiation.
Endocrinology
139
,
1638
-1644.
Bravo, D. A., Gleason, J. B., Sanchez, R. I., Roth, R. A. and Fuller, R. S. (
1994
). Accurate and efficient cleavage of the human insulin proreceptor by the human proprotein-processing protease furin. Characterization and kinetic parameters using the purified, secreted soluble protease expressed by a recombinant baculovirus.
J. Biol. Chem.
269
,
25830
-25837.
Brown, M. S. and Goldstein, J. L. (
1999
). A proteolytic pathway that controls the cholesterol content of membranes, cells,and blood.
Proc. Natl. Acad. Sci. USA
96
,
11041
-11048.
Brun, R. P., Kim, J. B., Hu, E., Altiok, S. and Spiegelman, B. M. (
1996
). Adipocyte differentiation: a transcriptional regulatory cascade.
Curr. Opin. Cell Biol.
8
,
826
-832.
Cao, Z., Umek, R. M. and McKnight, S. L.(
1991
). Regulated expression of three C/EBP isoforms during adipose conversion of 3T3-L1 cells.
Genes Dev.
5
,
1538
-1552.
Caron, M., Auclair, M., Vigouroux, C., Glorian, M., Forest, C. and Capeau, J. (
2001
). The HIV protease inhibitor Indinavir impairs sterol regulatory element-binding protein-1 intranuclear localization,inhibits preadipocyte differentiation and induces insulin resistance.
Diabetes
50
,
1378
-1388.
Carr, A. (
2000
). HIV protease inhibitor-related lipodystrophy syndrome.
Clin. Infect. Dis.
30
Suppl. 2,
S135
-S142.
Day, R., Schafer, M. K., Watson, S. J., Chrétien, M. and Seidah, N. G. (
1992
). Distribution and regulation of the prohormone convertases PC1 and PC2 in the rat pituitary.
Mol. Endocrinol.
6
,
485
-497.
Dent, C. L. and Latchman, D. S. (
1993
).
Transcription factors: a practical approach
. New York: Oxford University Press.
Dowell, P., Flexner, C., Kwiterovich, P. O. and Lane, M. D.(
2000
). Suppression of preadipocyte differentiation and promotion of adipocyte death by HIV protease inhibitors.
J. Biol. Chem.
275
,
41325
-41332.
Dufour, E. K., Denault, J. B., Hopkins, P. C. and Leduc, R.(
1998
). Serpinlike properties of alpha1-antitrypsin Portland towards furin convertase.
FEBS Lett
.
426
,
41
-46.
Fajas, L., Schoonjans, K., Gelman, L., Kim, J. B., Najib, J.,Martin, G., Fruchart, J. C., Briggs, M., Spiegelman, B. M. and Auwerx, J.(
1999
). Regulation of peroxisome proliferator-activated receptor gamma expression by adipocyte differentiation and determination factor 1/sterol regulatory element binding protein 1: implications for adipocyte differentiation and metabolism.
Mol. Cell. Biol.
19
,
5495
-5503.
Freytag, S. O., Paielli, D. L. and Gilbert, J. D.(
1994
). Ectopic expression of the CCAAT/enhancer-binding protein alpha promotes the adipogenic program in a variety of mouse fibroblastic cells.
Genes Dev.
8
,
1654
-1663.
Green, H. and Kehinde, O. (
1975
). An established preadipose cell line and its differentiation in culture. II. Factors affecting the adipose conversion.
Cell
5
,
19
-27.
Gregoire, F. M., Smas, C. M. and Sul, H. S.(
1998
). Understanding adipocyte differentiation.
Physiol. Rev.
78
,
783
-809.
Hwang, C. S., Loftus, T. M., Mandrup, S. and Lane, M. D.(
1997
). Adipocyte differentiation and leptin expression.
Annu. Rev. Cell Dev. Biol.
13
,
231
-259.
Jean, F., Stella, K., Thomas, L., Liu, G., Xiang, Y., Reason, A. J. and Thomas, G. (
1998
). Alpha1-Antitrypsin Portland, a bioengineered serpin highly selective for furin: application as an antipathogenic agent.
Proc. Natl. Acad. Sci. USA
95
,
7293
-7298.
Kim, J. B. and Spiegelman, B. M. (
1996
). ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism.
Genes Dev.
10
,
1096
-1107.
Ko, K. W., McLeod, R. S., Avramoglu, R. K., Nimpf, J.,FitzGerald, D. J., Vukmirica, J. and Yao, Z. (
1998
). Mutation at the processing site of chicken low density lipoprotein receptor-related protein impairs efficient endoplasmic reticulum exit, but proteolytic cleavage is not essential for its endocytic functions.
J. Biol. Chem.
273
,
27779
-27785.
Konda, Y., Yokota, H., Kayo, T., Horiuchi, T., Sugiyama, N.,Tanaka, S., Takata, K. and Takeuchi, T. (
1997
). Proprotein-processing endoprotease furin controls the growth and differentiation of gastric surface mucous cells.
J. Clin. Invest.
99
,
1842
-1851.
Lehmann, M., Andre, F., Bellan, C., Remacle-Bonnet, M.,Garrouste, F., Parat, F., Lissitsky, J. C., Marvaldi, J. and Pommier, G.(
1998
). Deficient processing and activity of type I insulin-like growth factor receptor in the furin-deficient LoVo-C5 cells.
Endocrinology
139
,
3763
-3771.
Lönnqvist, L., Reinhardt, D., Sakai, L. and Peltonen,L. (
1998
). Evidence for furin-type activity-mediated C-terminal processing of profibrillin-1 and interference in the processing by certain mutations.
Hum. Mol. Genet.
7
,
2039
-2044.
Molloy, S. S., Thomas, L., VanSlyke, J. K., Stenberg, P. E. and Thomas, G. (
1994
). Intracellular trafficking and activation of the furin proprotein convertase: localization to the TGN and recycling from the cell surface.
EMBO J.
13
,
18
-33.
Munzer, J. S., Basak, A., Zhong, M., Mamarbachi, A., Hamelin,J., Savaria, D., Lazure, C., Benjannet, S., Chrétien, M. and Seidah, N. G. (
1997
). In vitro characterization of the novel proprotein convertase PC7.
J. Biol. Chem.
272
,
19672
-19681.
Myers, M. G. J., Sun, X. J. and White, M. F.(
1994
). The IRS-1 signaling system.
Trends Biochem. Sci.
19
,
289
-293.
Nguyen, A. T., Gagnon, A., Angel, J. B. and Sorisky, A.(
2000
). Ritonavir increases the level of active ADD-1/SREBP-1 protein during adipogenesis.
AIDS
14
,
2467
-2473.
Osada, S., Yamamoto, H., Nishihara, T. and Imagawa, M.(
1996
). DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family.
J. Biol. Chem.
271
,
3891
-3896.
Piwien-Pilipuk, G., Van Mater, D., Ross, S. E., MacDougald, O. A. and Schwartz, J. (
2001
). Growth hormone regulates phosphorylation and function of CCAAT/enhancer-binding protein β by modulating Akt and glycogen synthase kinase-3.
J. Biol. Chem.
276
,
19664
-19671.
Qiu, Z., Wei, Y., Chen, N., Jiang, M., Wu, J. and Liao, K.(
2001
). DNA synthesis and mitotic clonal expansion is not a required step for 3T3-L1 preadipocyte differentiation into adipocytes.
J. Biol. Chem.
276
,
11988
-11995.
Rubin, C. S., Hirsch, A., Fung, C. and Rosen, O. M.(
1978
). Development of hormone receptors and hormonal responsiveness in vitro. Insulin receptors and insulin sensitivity in the preadipocyte and adipocyte forms of 3T3-L1 cells.
J. Biol. Chem.
253
,
7570
-7578.
Sakai, J., Rawson, R. B., Espenshade, P. J., Cheng, D.,Seegmiller, A. C., Goldstein, J. L. and Brown, M. S. (
1998
). Molecular identification of the sterol-regulated luminal protease that cleaves SREBPs and controls lipid composition of animal cells.
Mol. Cell
2
,
505
-514.
Santavicca, M., Noel, A., Angliker, H., Stoll, I., Segain, J. P., Anglard, P., Chretien, M., Seidah, N. and Basset, P.(
1996
). Characterization of structural determinants and molecular mechanisms involved in prostromelysin-3 activation by 4-aminophenylmercuric acetate and furin-type convertases.
Biochem. J.
315
,
953
-958.
Sawada, Y., Suda, M., Yokoyama, H., Kanda, T., Sakamaki, T.,Tanaka, S., Nagai, R., Abe, S. and Takeuchi, T. (
1997
). Stretch-induced hypertrophic growth of cardiocytes and processing of brain-type natriuretic peptide are controlled by proprotein-processing endoprotease furin.
J. Biol. Chem.
272
,
20545
-20554.
Seidah, N. G. and Chretien, M. (
1999
). Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypeptides.
Brain Res
.
848
,
45
-62.
Seidah, N. G., Mowla, S. J., Hamelin, J., Mamarbachi, A. M.,Benjannet, S., Touré, B. B., Basak, A., Munzer, J. S., Marcinkiewicz,J., Zhong, M. et al. (
1999
). Mammalian subtilisin/kexin isozyme SKI-1: A widely expressed proprotein convertase with a unique cleavage specificity and cellular localization.
Proc. Natl. Acad. Sci. USA
96
,
1321
-1326.
Smas, C. M. and Sul, H. S. (
1995
). Control of adipocyte differentiation.
Biochem. J.
309
,
697
-710.
Smith, P. J., Wise, L. S., Berkowitz, R., Wan, C. and Rubin, C. S. (
1988
). Insulin-like growth factor-I is an essential regulator of the differentiation of 3T3-L1 adipocytes.
J. Biol. Chem.
263
,
9402
-9408.
Tang, Q.-Q. and Lane, M. D. (
1999
). Activation and centromeric localization of CCAAT/enhancer-binding proteins during the mitotic clonal expansion of adipocyte differentiation.
Genes Dev.
13
,
2231
-2241.
Taylor, B. A. and Phillips, S. J. (
1996
). Detection of obesity QTLs on mouse chromosomes 1 and 7 by selective DNA pooling.
Genomics
34
,
389
-398.
Tontonoz, P., Hu, E. and Spiegelman, B. M.(
1994
). Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor
Cell
79
,
1147
-1156.
Trautwein, C., Caelles, C., van der Geer, P., Hunter, T., Karin,M. and Chojkier, M. (
1993
). Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain.
Nature
364
,
544
-547.
Trautwein, C., van der Geer, P., Karin, M., Hunter, T. and Chojkier, M. (
1994
). Protein kinase A and C site-specific phosphorylation of LAP (NF-IL6) modulate its binding affinity to DNA recognition elements.
J. Clin. Invest.
93
,
2554
-2561.
Tsuji, A., Hashimoto, E., Ikoma, T., Taniguchi, T., Mori, K.,Nagahama, M. and Matsuda, Y. (
1999a
). Inactivation of proprotein convertase, PACE4, by alpha1-antitrypsin Portland (alpha1-PDX), a blocker of proteolytic activation of bone morphogenetic protein during embryogenesis: evidence that PACE4 is able to form an SDS-stable acyl intermediate with alpha1-PDX.
J. Biochem.
126
,
591
-603.
Tsuji, A., Yoshida, S., Hasegawa, S., Bando, M., Yoshida, I.,Koide, S., Mori, K. and Matsuda, Y. (
1999b
). Human subtilisin-like proprotein convertase, PACE4 (SPC4) gene expression is highly regulated through E-box elements in HepG2 and GH4C1 cells.
J. Biochem.
126
,
494
-502.
Wu, Z., Bucher, N. L. and Farmer, S. R. (
1996
). Induction of peroxisome proliferator-activated receptor gamma during the conversion of 3T3 fibroblasts into adipocytes is mediated by C/EBPbeta,C/EBPdelta, and glucocorticoids.
Mol. Cell. Biol.
16
,
4128
-4136.
Yana, I. and Weiss, S. J. (
2000
). Regulation of membrane type-1 matrix metalloproteinase activation by proprotein convertases.
Mol. Biol. Cell
11
,
2387
-2401.
Yeh, W. C., Cao, Z., Classon, M. and McKnight, S. L.(
1995
). Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins.
Genes Dev.
9
,
168
-181.
Zhou, A., Webb, G., Zhu, X. and Steiner, D. F.(
1999
). Proteolytic processing in the secretory pathway.
J. Biol. Chem.
274
,
20745
-20748.
Zhu, Y., Qi, C., Korenberg, J. R., Chen, X. N., Noya, D., Rao,M. S. and Reddy, J. K. (
1995
). Structural organization of mouse peroxisome proliferator-activated receptor gamma (mPPAR gamma) gene:alternative promoter use and different splicing yield two mPPAR gamma isoforms.
Proc. Natl. Acad. Sci. USA
92
,
7921
-7925.