In order to identify a protein interacting with RCC1, a guanine nucleotide-exchange factor for the nuclear GTPase Ran, we isolated a series of cold-sensitive suppressors of mtr1-2, a temperature-sensitive mutant of the Saccharomyces cerevisiae RCC1 homologue. One of the isolated suppressor mutants was mutated in the putative GTPase Gtr1p, being designated as gtr1-11. It also suppressed other alleles of mtr1-2, srm1-1 and prp20-1 in contrast to overexpression of the S. cerevisiae Ran/TC4 homologue Gsp1p, previously reported to suppress prp20-1, but not mtr1-2 or srm1-1. Furthermore, gtr1-11 suppressed the rna1-1, temperature-sensitive mutant of the Gsp1p GTPase-activating protein, but not the srp1-31, temperature-sensitive mutant of the S. cerevisiae importin α homologue. mtr1-2, srm1-1 and prp20-1 were also suppressed by overexpression of the mutated Gtr1p, Gtr1-11p. In summary, Gtr1p that was localized in the cytoplasm by immunofluoresence staining was suggested to function as a negative regulator for the Ran/TC4 GTPase cycle.

RCC1 was identified as a mutated gene in a temperaturesensitive (ts) mutant of the hamster BHK21 cell line, tsBN2, which shows cell cycle-specific phenotypes such as G1 arrest or premature chromatin condensation (Uchida et al., 1990; Nishitani et al., 1991). Subsequently, ts mutants of the S. cerevisiae RCC1 homologue have been independently isolated from diverse viewpoints of cellular function such as mating pathway (srm1) (Clark and Sprague, 1989), mRNA splicing (prp20) (Aebi et al., 1990) and mRNA export (mtr1) (Kadowaki et al., 1993), while from Schizosaccharomyces pombe, a ts mutant of the RCC1 homologue pim1-D1, has been isolated either as a mutant defective in coupling between DNA replication and mitosis (Matsumoto and Beach, 1991) or as a mutant defective in chromosome decondensation following the completion of mitosis (Sazer and Nurse, 1994).

RCC1 is a guanine nucleotide-exchanging factor (GEF) acting on G protein Ran/TC4 (Bischoff and Ponstingl, 1991a). The TC4 cDNA was originally cloned as one of the Ras-like G proteins using a mixed-oligonucleotide probe (Drivas et al., 1990) and Ran was identified as a protein tightly bound to RCC1 (Bischoff and Ponstingl, 1991b). The yeast Ran/TC4 homologues, S. cerevisiae GSP1 and S. pombe spi1/fyt1 were identified as a multicopy suppressor of prp20-1 and pim1-46, respectively (Matsumoto and Beach, 1991; Belhumeur et al., 1993; Sazer and Nurse, 1994). On the other hand, using a permeabilized HeLa cell system, Ran/TC4 was also identified as a protein essential for nuclear import of proteins (Moore and Blobel, 1993; Melchior et al., 1993). Proteins that carry a nuclear location signal (NLS) bind to NLS-receptors that consist of importin α/karyopherin α/p60 and importin β/karyopherin β/p90, and then such complexes are transferred onto the nuclear pore complex (Rexach and Blobel, 1996). For nuclear translocation of proteins, the hydrolysis of GTP-Ran is required (Melchior et al., 1995). Like other Ras family members, Ran/TC4 GTPase activity is very low and can be activated by a Ran/TC4 GTPase-activating protein (RanGAP) encoded by rna1+/RNA1 (Bischoff et al., 1994, 1995; Becker et al., 1995). In accordance with involvement of Ran/TC4 in nuclear transport of proteins, both rcc1 and rna1 show a defect in the nucleocytoplasmic transport of proteins and RNA (Amberg et al., 1993; Kadowaki et al., 1993; Tachibana et al., 1994; Corbett et al., 1995). Diverse phenotypes of S. cerevisiae rcc1 (mtr1, srm1 and prp20), therefore, have been argued to be a consequence of defects in nucleocytoplasmic transport (Melchior and Gerace, 1995). In fact, there has been one report showing that a loss of nuclear protein import induces a cell cycle-specific defect (Loeb et al., 1995).

However, RCC1 has a DNA-binding activity and is located on chromatin in a ratio of one molecule per 1 to 10 nucleosomes (Dasso et al., 1992). On the other hand, Ran/TC4 has a 25-fold molar excess over RCC1 in HeLa cells (Bischoff and Ponstingl, 1991a) and is located within the nucleoplasm (Ren et al., 1993). In contrast with other Ras-family members, Ran/TC4 itself and its interacting proteins are not posttranslationally modified. They interact with each other in homogeneous solution rather than on the membrane surface (Klebe et al., 1995), suggesting that Ran/TC4 is involved in multiple pathways.

By analogy to Ras (Boguski and McCormick, 1993), Ran may function as a molecular switch for cellular functions that takes upstream signals and transfers them to downstream events. In this context, it is an intriguing idea that RCC1 may check the progression of DNA replication on the chromatin, as an upstream sensor of the Ran/TC4 pathway. Since an RCC1 mutant deleted of the DNA-binding domain can complement a tsBN2 mutation and binds to the chromatin in ts+ transformants of tsBN2 cells (Seino et al., 1992), RCC1 is assumed to be tethered to chromosomal DNA by other proteins. Consistently, the BJ1 Drosophila RCC1 homologue makes a salt-labile protein complex on the chromatin (Frasch, 1991) and S. cerevisiae Prp20p comprises a large complex of more than 150 kDa (Lee et al., 1993). In order to identify proteins that functionally interact with RCC1, we have been isolating a series of extragenic suppressors of mtr1-2. In this report, a coldsensitive mutation of the putative GTPase Gtr1p (Bun-ya et al., 1992) was found to suppress mtr1-2, srm1-1 and prp20-1. Suppressors of S. cerevisiae rcc1 found thus far rescue either srm1-1 and mtr1-2 or prp20-1, but not all three rcc1 mutants (Kadowaki et al., 1993; Lee et al., 1994; Hayashi et al., 1996). Furthermore, the suppressor, gtr1-11, also suppress rna1-1, but not the srp1-31 ts mutant of the S. cerevisiae homologue of Importin a/karyopherin a/p60 (Yano et al., 1994). Recently, the mammalian homologue of GTR1 has been cloned (Schürmann et al., 1995), indicating that GTR1 is conserved throughout evolution.

Strains, plasmids and media

S. cerevisiae strains and plasmids constructed by standard genetic manipulations (Sherman et al., 1982) for this study are described in Table 1 and 2, respectively. S. cerevisiae and Escherichia coli strains were cultured and transformed as described previously (Nishiwaki et al., 1987; Hayashi et al., 1995; Ito et al., 1983). In order to isolate mutants, cells were irradiated with 5 mJ/cm2 of ultraviolet using UV linker FS1500 (Funakoshi).

Table 1.

Yeast strains used in this study

Yeast strains used in this study
Yeast strains used in this study
Table 2.

Yeast plasmids used in this study

Yeast plasmids used in this study
Yeast plasmids used in this study

S. cerevisiaegenomic library

A yeast genomic DNA library constructed by partial digestion of S. cerevisiae genomic DNA with Sau3AI and ligation into the BamHI site of YCp50 vector (Parent et al., 1985) was a gift from K. Matsumoto (Nagoya University).

Cloning of the gtr1-11 allele

The 2.3 kb EcoRI/HindIII genomic DNA fragment of pL3 (Table 2) was inserted into the EcoRI/HindIII site of the YIp5 vector (Parent et al., 1985). The resulting plasmid, pL50 (Table 2) was digested with BglII and introduced into a haploid strain T18-5c (Table 1). Ura+ colonies were selected on a synthetic uramedium plate. Genomic DNA of these colonies was prepared, digested with BamHI enzyme and then transformed into E. coli XLI-blue after self-ligation of digested fragments, in order to recover the YIp plasmid possessing a full-length mutated GTR1, gtr1-11.

Construction of HA fused Gtr1p

The HA sequence of pBluescript HA (a gift from B. Futcher, Cold Spring Harbor Laboratory) (Tyers et al., 1992) was amplified by PCR using as primers, 5′GCGGCCATATGTTTTACCCATAC3′ and 5′GAATCCCATGGTTCTAGAGC3′, together with pfu DNA polymerase (Stratagene, USA), and it was then integrated into the HincII site of pBluescriptIITKS(+) (Ichihara and Kurosawa, 1993), resulting in a plasmid pTKS-HA1. The 1.5 kb NcoI/BamHI fragment of GTR1 carried on pUC29 (Benes et al. 1993) was inserted into the NcoI/BglII site of pTKS-HA1, resulting in a plasmid pL46. The 1.5 kb XhoI/SpeI fragment of GTR1HA was cut out from pL46 and inserted into the XhoI/SpeI site of the pNV7 vector (Ninomiya-Tsuji et al., 1991), resulting in plasmid pL48 containing GTR1HA at the downstream site of the GAL1-10 promoter. Finally, the 2.0 kb SalI/SpeI fragment covering GAL1-10: GTR1HA was cut out from pL48 and inserted into the SalI/NheI site of the YIp5 vector, resulting in plasmid pL78 (Table 2).

The obtained plasmid pL78 was introduced into a strain NBW5∆ GTR (Table 1).

Immunofluorescence microscopy

S. cerevisiae strains were processed and fixed with the method described by Hagan and Hyams (1988). Cellular DNA was stained with Hoechst 33342, and HA-fused proteins were stained by the 12CA5 mouse monoclonal antibody to the influenza hemagglutinin peptide HA1 (a gift from H. Shiomi) and then FITC-conjugated goat anti-mouse antibody.

Isolation of a suppressor of mtr1-2

A series of suppressors was isolated as cold sensitive mutants, from the T18 strain of S. cerevisiae mtr1-2, which has been isolated as a ts mutant defective in mRNA export (Kadowaki et al., 1993). Cultures of the T18 strain grown at 26°C, were plated out on YEPD plates at 1×107 cells/100 mm diameter dish, and irradiated with UV as described in Materials and Methods. UV-irradiated cultures were incubated at 26°C for one day and then incubated for 3 days at 30°C, the restrictive temperature for mtr1-2. Colonies which appeared were screened for cold-sensitivity (cs-) by replica-plating and incubation at 14°C for 7 days. From 30 revertants, only one clone designated as T18-5c, did not grow at 14°C.

The T18-5c strain was crossed with the T14 strain of mtr1-2 (Hayashi et al., 1995) and the resulting diploids grew at 14°C, but not at 30°C. These were then sporulated and dissected. Two viable and two nonviable segregants in 10 tetrads were observed at 14°C, and all the segregants which did not grow at 14°C grew at 30°C, and vice versa. Thus, the ability to rescue mtr1-2 and a cold-sensitive phenotype were genetically linked, demonstrating that these two phenotypes are caused by mutation in a single gene, and that the suppressor mutation is recessive with regard to both phenotypes.

When the T18-5c strain was crossed with the wild-type strain, tetrads resulted in a 2+:2-segregation at 14°C on YEPD, whereas they showed 4+:0-, 3+:1- and 2+:2-segregation patterns at 30°C. Thus, the suppressor mutation was confirmed to be recessive and was not linked to mtr1-2.

The cold-sensitive suppressor of mtr1-2 has a defect in GTR1

The YCp50 genomic library of S. cerevisiae was introduced into the cs- strain T18-5c, and transformants were screened for growth ability at 14°C. Three clones out of 3,000 transformants grew at 14°C and turned out to contain the same plasmid DNA designated as pL3. Restriction enzyme sites of the cloned DNA are shown in Fig. 1A. In order to determine the position of cloned DNA in S. cerevisiae genomic DNA, a fragment of 5.2 kb from the SalI site (outside the second BamHI site, B2) to the second XbaI site (Xb2) was subcloned into the XbaI/SalI sites of pUC29 and the nucleotide sequence was partly determined from the XbaI site of cloned DNA. In comparison with the S. cerevisiae genomic sequence, pL3 turned out to contain a part of TUB3, PHO84 and GTR1 of the S. cerevisiae genomic DNA previously reported (Bun-ya et al., 1992). In order to assign the region essential for conferring the cs+ phenotype on the T18-5c strain, the inserted DNA was digested into smaller DNA fragments as shown in Fig. 1A. All those plasmids which contained the whole region of GTR1 conferred the cs+ phenotype, but not the ts+ phenotype, on the T18-5c strain (Fig. 1B), proving that a recessive mutation (designated gtr1-11) in the GTR1 gene is responsible for suppressing the mtr1-2 mutation and for conferring the cs- phenotype.

Fig. 1.

A cold-sensitive mutation of GTR1 suppressed mtr1-2. (A) 5. cerevisiae genomic DNA complementing the coldsensitive suppressor. The thick bar indicates the cloned DNA fragment designated as pL3, which complemented the coldsensitivity of the T18-5c strain and which was isolated from the genomic DNA library. Determined restriction enzyme sites are shown. E, EcoRI; Xb, Xba I; C, ClaI; Bg, Bgl II; Hd, Hin dIII; Kp, Kpn I; B, Bam HI. pL3∆ Xb and pL3∆ C were self-ligated products of pL3 digested with Xba I and Cla I, respectively. pL63 was YEplac195 vector possessing the 3.4 kb Kpn I/Bam HI fragment of pL3 at Kpn I/Bam HI sites. (B) Suppression of mtr1-2 by gtr1-11. Strains T18 (mtr1-2), T18-5c (mtr1-2, gtr1-11) and their derivatives, which harbor the plasmid PL3∆ C containing the GTR1 gene, were plated on a YEPD plate and incubated either at 14°C or at 30°C as indicated.

Fig. 1.

A cold-sensitive mutation of GTR1 suppressed mtr1-2. (A) 5. cerevisiae genomic DNA complementing the coldsensitive suppressor. The thick bar indicates the cloned DNA fragment designated as pL3, which complemented the coldsensitivity of the T18-5c strain and which was isolated from the genomic DNA library. Determined restriction enzyme sites are shown. E, EcoRI; Xb, Xba I; C, ClaI; Bg, Bgl II; Hd, Hin dIII; Kp, Kpn I; B, Bam HI. pL3∆ Xb and pL3∆ C were self-ligated products of pL3 digested with Xba I and Cla I, respectively. pL63 was YEplac195 vector possessing the 3.4 kb Kpn I/Bam HI fragment of pL3 at Kpn I/Bam HI sites. (B) Suppression of mtr1-2 by gtr1-11. Strains T18 (mtr1-2), T18-5c (mtr1-2, gtr1-11) and their derivatives, which harbor the plasmid PL3∆ C containing the GTR1 gene, were plated on a YEPD plate and incubated either at 14°C or at 30°C as indicated.

gtr1 suppressed both srm1 and prp20

So far, either overexpression of Gsp1p (Belhumeur et al., 1993) or ded1-21 (Hayashi et al., 1996) have been found to suppress S. cerevisiae rcc1. Curiously, overexpression of Gsp1p suppresses the rcc1 mutants mapped in the C terminus of the RCC1 repeat, such as prp20-1, but not the rcc1 mutants mapped in the N terminus of the RCC1 repeat, such as srm1-1 and mtr1-2 (Kadowaki et al., 1993; Lee et al., 1994). On the contrary, ded1-21 suppresses srm1-1 and mtr1-2, but not prp20-1 (Hayashi et al., 1996). In order to determine whether gtr1-11 can suppress other alleles of mtr1-2 such as prp20-1 and srm1-1, haploid strains containing double mutations srm1-1 gtr1-11 (NN22-4c) and prp20-1 gtr1-11 (NN23-7a) were constructed, and then incubated on YEPD plates at 14°C, the restrictive temperature for gtr1-11, and at a high temperature, either at 32°C the restrictive temperature for the srm1-1 or at 33°C the restrictive temperature for the prp20-1. Surprisingly, gtr1-11 suppressed both srm1-1 and prp20-1 (Fig. 2).

Fig. 2.

gtr1-11 suppressed both srm1-1 andprp20-1. Upper panel: indicated segregants NN22-4c (mtr1-2 gtr1-11) and NN22-4a (srm1-1) of diploid NN22 were plated and incubated either at 14°C or at 32°C on YEPD plates as indicated. Lower panel: indicated segregants NN23-7a (prp20-1 gtr1-11) and NN23-7d (prp20-1) of diploid NN23 were plated and incubated either at 14°C or at 33°C on YEPD plates as indicated.

Fig. 2.

gtr1-11 suppressed both srm1-1 andprp20-1. Upper panel: indicated segregants NN22-4c (mtr1-2 gtr1-11) and NN22-4a (srm1-1) of diploid NN22 were plated and incubated either at 14°C or at 32°C on YEPD plates as indicated. Lower panel: indicated segregants NN23-7a (prp20-1 gtr1-11) and NN23-7d (prp20-1) of diploid NN23 were plated and incubated either at 14°C or at 33°C on YEPD plates as indicated.

gtr1 suppressed rna1, but not srp1

The finding that the same mutation suppressed not only mtr1- 2 and srm1-1, but also prp20-1 raised the question of whether the gtr1-11 mutation is a general suppressor of defects in the Ran pathway. In order to address this issue, we chose the ts mutant, rna1-1 which is defective in Gsp1 GTPase activating protein. Four segregants obtained from the NN39 diploid strain harboring gtr1-11 and rna1-1 (Table 1) were plated out and incubated on YEPD plates either at 14°C, the restrictive temperature for gtr1-11, or 33°C, the restrictive temperature for rna1-1. As shown in Fig. 3A, the gtr1-11 conferred ts+ phenotype to rna1-1 as well.

Fig. 3.

gtr1-11 suppressed rna1-1, but not srp1-31. (A) Four segregants from the identical ascus of diploid NN39 conjugated between gtr1-11 and rna1-1 were incubated either at 14°C or at 33°C. (B) Four segregants from the identical ascus of diploid NN61 conjugated between gtr1-11 and srp1-31 were incubated either at 14°C or at 35°C on YEPD plates.

Fig. 3.

gtr1-11 suppressed rna1-1, but not srp1-31. (A) Four segregants from the identical ascus of diploid NN39 conjugated between gtr1-11 and rna1-1 were incubated either at 14°C or at 33°C. (B) Four segregants from the identical ascus of diploid NN61 conjugated between gtr1-11 and srp1-31 were incubated either at 14°C or at 35°C on YEPD plates.

Since the Ran pathway is involved in the nucleocytoplasmic transport of proteins and RNA, we then asked whether gtr1-11 also suppressed mutations defective in this process. In order to address this issue, we chose a ts mutation of Srp1p that interacts with various nuclear proteins and controls nuclear pore transport functions (Yano et al., 1994). The diploid strain NN61 harboring both srp1-31 and gtr1-11 was sporulated. Four spores segregated in Tetra type were obtained, plated out and incubated on YEPD plates at either 14°C or 35°C the restrictive temperature for srp1-31 (Yano et al., 1994). As shown in Fig. 3B, gtr1-11 did not suppress srp1-31.

Suppression of mtr1-2by a partial deletion of GTR1

The GTR1 gene has been shown not to be essential for growth, while its deletion makes yeast cold-sensitive (Bun-ya et al., 1992). In order to examine whether the suppression of both mtr1-2 and rna1-1 by gtr1-11 is allele specific or not, the GTR1 gene from the T18 strain (mtr1-2) was deleted either partly or completely using the previously reported plasmids, pMB130 and pAC609 (Bun-ya et al., 1992), respectively. Upon deletion of the whole of GTR1, we could not see any clear suppression of mtr1-2. However, a weak but significant suppression of mtr1-2 was observed by partial deletion of GTR1 (Fig. 4) in which one third of the gene was deleted in the C terminus (Bun-ya et al., 1992). Thus, suppression of mtr1-2 is not specific to the allele of gtr1-11, while the ability of a deletion mutant to suppress mtr1-2 is weaker than that of gtr1-11.

Fig. 4.

A partial deletion of the GTR1 gene suppressed mtr1-2. Haploid strains T18∆ GTR1/3 (mtr1-2 gtr1-3∆), T18-5c (mtr1-2 gtr1-11) and T18 (mtr1-2) were incubated on YEPD plates either at 14°C or at 30°C as indicated. gtr1-3∆ encodes a deleted Gtr1p (Bun-ya et al., 1992).

Fig. 4.

A partial deletion of the GTR1 gene suppressed mtr1-2. Haploid strains T18∆ GTR1/3 (mtr1-2 gtr1-3∆), T18-5c (mtr1-2 gtr1-11) and T18 (mtr1-2) were incubated on YEPD plates either at 14°C or at 30°C as indicated. gtr1-3∆ encodes a deleted Gtr1p (Bun-ya et al., 1992).

Suppression of S. cerevisiaercc1 by overexpression of Gtr1-11p

The finding that a partial, but not total, deletion of the GTR1 gene suppressed mtr1-2 may indicate that the presence of mutated or deleted Gtr1p is important for suppressing mtr1-2. If this is true, overexpression of the mutated Gtr1p, Gtr1-11p, may suppress mtr1-2 even though gtr1-11 was recessive, as shown in Fig. 1B. In order to address this issue, gtr1-11 was cloned by the eviction method (Winston et al., 1983) as described in Materials and Methods, and introduced into the YEplac195 plasmid (Gietz and Sugino, 1988). The resulting plasmid, pL64, containing 2µURA3 gtr1-11 and the controls pL63, containing 2µURA3, GTR1 and the vector alone, were introduced into mtr1-2, srm1-1 and prp20-1, and the resulting transformants were plated and incubated on YEPD medium at the critical temperature to restrict the growth of each allele. In all rcc1 examined, a weak, but significant recovery of growth was observed. A representative result for prp20-1 is shown in Fig. 5. Thus, the gtr1-11 on the multicopy vector has a negative dominant effect on rcc1.

Fig. 5.

Overexpression of gtr1-11 suppressedprp20-1. Haploid strain prp2O/2c (prp20-1) harboring pL64: 2µURA3 gtr1-11 or pL63: 2µURA3 GTR1 or vector alone were incubated either at 26°C or at 30°C on synthetic ura-medium as indicated.

Fig. 5.

Overexpression of gtr1-11 suppressedprp20-1. Haploid strain prp2O/2c (prp20-1) harboring pL64: 2µURA3 gtr1-11 or pL63: 2µURA3 GTR1 or vector alone were incubated either at 26°C or at 30°C on synthetic ura-medium as indicated.

Cellular location of Gtr1p

Next, we investigated the cellular localization of Gtr1p in S. cerevisiae. To do that, the open-reading frame of GTR1 fused with the HA antigen was engineered as described in Materials and Methods and integrated into the downstream site of the galactose inducible promoter in pL78 (Table 2). Transformants of the strain NBW5∆ GTR harboring pL78 could not grow at 14°C in glucose medium but normally grow in galactose medium, proving that the recombinant Gtr1p fused with HA is functional (data not shown). After growing in glucose medium at 30°C, half of the cultures were incubated in galactose medium. Cells grown in either glucose or galactose medium for 12 hours were stained with the monoclonal antibody to HA, as described in Materials and Methods. After galactose induction, the anti-HA antibody stained the cytoplasm clearly and the nucleus faintly. In contrast, there was no significant staining of cells cultured in glucose medium (Fig. 6).

Homologues of RCC1 have a common repeated motif which is responsible for in vivo RCC1 function (Dasso, 1993). The mutations of S. cerevisiae RCC1 homologue that have been mapped so far are located in the second and the last two repeats of this motif (Kadowaki et al., 1993; Lee et al., 1994). The C-terminal, but not the N-terminal rcc1 can be suppressed by overexpression of Gsp1p. On the other hand, the recently isolated suppressor mutation of srm1-1, that is, ded1-21, which is a cold-sensitive mutation of the DED1 encoding a putative ATP-dependent RNA helicase (Schmid and Linder, 1992) suppresses the N-terminal, but not the C-terminal rcc1 (Hayashi et al., 1996). In this paper we have identified the third suppressor of S. cerevisiae rcc1, gtr1-11, which suppresses both N-terminal and C-terminal rcc1, in addition to rna1, but not srp1.

Fig. 6.

Localization of Gtr1p in 5. cerevisiae. NBW5∆ GTR strains (gtr1-1∆ ade2 ura3-1,2 his3-532, leu2-3,112 trp1-289 can1)/pL78 (URA3 GAL1-GTR1HA) were grown at 30°C either in the presence of either glucose (A,C) or galactose (B,D) for 12 hours. In A and B, cells were stained by the monoclonal antibody 12CA5 and FITC. In C and D, cells were stained by Hoechst 33342.

Fig. 6.

Localization of Gtr1p in 5. cerevisiae. NBW5∆ GTR strains (gtr1-1∆ ade2 ura3-1,2 his3-532, leu2-3,112 trp1-289 can1)/pL78 (URA3 GAL1-GTR1HA) were grown at 30°C either in the presence of either glucose (A,C) or galactose (B,D) for 12 hours. In A and B, cells were stained by the monoclonal antibody 12CA5 and FITC. In C and D, cells were stained by Hoechst 33342.

The allele-specific suppression of S. cerevisiae rcc1 suggests that RCC1 has two functional domains within the repeated region. In agreement with this assumption, the steady-state kinetics analysis of alanine-replaced RCC1 mutants indicates that the two ends of the RCC1 repeated domain are functionally different (Azuma et al., 1996). The finding that the gtr1-11 mutation that suppresses rcc1 maps in either the N terminus or the C terminus of the repeat therefore indicates that gtr1-11 is a general suppressor of the Ran pathway. In accordance with this notion, the ts mutant of the RanGAP homologue, rna1-1, was also suppressed by gtr1-11, although it remains to be examined whether the suppression of rna1-1 by gtr1-11 is specific to this allele of rna1.

Srp1p is located at the periphery of the nucleus and is involved in multiple cellular functions such as microtubule-related functions, nucleolar structure maintenance, nuclear pore function and RNA polymerase I function (Yano et al., 1994). Genetically SRP1 has been reported to interact with a wide variety of other nuclear genes (Yano et al., 1994; Belanger et al., 1994). Such diverse interactions of SRP1 are assumed to reflect the presence of multiple systems that utilize Srp1p and control the organization of nuclear structures and functions, or nuclear pore transport function. Based on these previous reports, we chose a ts mutant of SRP1, in order to examine the possibility that gtr1-11 is a general suppressor of defects in the nuclear pore transport function in which the Ran pathway is involved. While we could not exclude the possibility of an allele-specific result, the inability of gtr1-11 to suppress srp1-31 indicates that the GTR1-pathway has no functional relationship to Srp1p function.

RCC1 and Rna1p function on Ran as GEF and RanGAP, respectively. Both proteins, therefore, control the Ran pathway in an opposite manner. Since GEF and GAP are the main regulators of the Ras family (Boguski and McCormick, 1993), the fact that defects in both proteins are suppressed by the coldsensitive mutation of GTR1, gtr1-11, indicates that Gtr1p controls the Ran pathway, probably as a negative regulator, since gtr1-11 is recessive and a partial deletion of GTR1 suppresses rcc1. Loss of GTR1-function may enhance the nuclear pore transport that was retarded by mutations in the Ran pathway. However, this idea cannot apply to the case of srm1-1, which did not cause any defect in export of poly(A)+ RNA (Kadowaki et al., 1993). Moreover, there was no suppression of srp1-31 by gtr1-11.

Gtr1p possesses the characteristic tripartite consensus elements for binding GTP that are conserved in GTP-binding proteins in the N-terminal region, together with a long C terminus. It is notable that Gtr1p does not contain lipid modification motifs at the C terminus, similar to Ran. In this context, both Ran and Gtr1p may function in a similar manner, that is, they interact with their related proteins in homogeneous solution. E. coli-produced Gtr1p bound to GTP in a one to one molar ratio, although it did not bind to GDP (N. Nakashima, unpublished), indicating that Gtr1p does not function like a real G protein. Since the complete deletion of Gtr1p did not suppress mtr1-2, a simple inactivation of the Gtr1p pathway does not suppress rcc1. On the other hand, overexpression of Gtr1-11p suppressed the rcc1 weakly but significantly. Considering these findings together, the presence of mutated or partly deleted Gtr1p proteins is important for rescuing defects in the Ran pathway. Probably, overproduced Gtr1-11p titrated out some factors which function against the Ran/TC4 GTPase cycle.

Recently, mammalian RagA and RagB genes encoding a protein homologous to Gtr1p have been cloned (Schürmann et al., 1995). Rat RagA/B is 52% identical to Gtr1p. Rat RagA/B and Gtr1p are very similar in the N-terminal half which comprises the domains responsible for GTP-binding, suggesting that both proteins function as a G protein in a similar way. Thus, the Gtr1p pathway is well conserved through evolution, indicating that Gtr1p plays some important role for cells, with regard to the Ran pathway.

We thank Drs T. Kadowaki and A. M. Tartakoff (Case Western Reserve University) for T14 and T18 strains; M. Nomura (University of California) for S. cerevisiae strains (srp1-31); Y. Oshima and S. Harashima (Osaka University) for GTR1 plasmids; A. Toh-e (Tokyo University) for the rna1-1 strain; K. Matsumoto (Nagoya University) for the genomic library of S. cerevisiae; B. Futcher (Cold Spring Harbor Laboratory) for pBluescript HA; H. Shiomi (University of Pennsylvania) for the anti-HA antibody; and the Human Genomic Center for supplying the sequence data. This work was supported by Grants-in-Aid for Scientific Research and for Cancer Research from the Ministry of Education, Science and Culture of Japan, and by the HFSP. The English used in this manuscript was revised by Miss K. Miller (Royal English Language Centre, Fukuoka, Japan).

Aebi
,
M.
,
Clark
,
M. W.
,
Vijayraghavan
,
U.
and
Abelson
,
J.
(
1990
).
A yeast mutant, PRP20, altered in mRNA metabolism and maintenance of the nuclear structure, is defective in a gene homologous to the human gene RCC1 which is involved in the control of chromosome condensation
.
Mol. Gen. Genet
.
224
,
72
80
Amberg
,
D. C.
,
Fleischmann
,
M.
,
Stagljar
,
I.
,
Cole
,
C. N.
and
Aebi
,
M.
(
1993
).
Nuclear PRP20 protein is required for mRNA export
.
EMBO J
.
12
,
233
241
.
Azuma
,
Y.
,
Seino
,
H.
,
Seki
,
T.
,
Uzawa
,
S.
,
Klebe
,
C.
,
Ohba
,
T.
,
Wittinghofer
,
A.
,
Hayashi
,
N.
and
Nishimoto
,
T.
(
1996
).
Conserved histidine residues of RCC1 are essential for nucleotide exchange on Ran
.
J. Biochem
.
120
,
82
91
.
Becker
,
J.
,
Melchior
,
F.
,
Gerke
,
V.
,
Bischoff
,
F. R.
,
Ponstingl
,
H.
and
Wittinghofer
,
A.
(
1995
).
RNA1 encodes a GTPase-activating protein specific for Gsp1, the Ran/TC4 homologue of Saccharomyces cerevisiae
.
J. Biol. Chem
.
270
,
11860
11865
.
Belanger
,
K. D.
,
Kenna
,
M. A.
,
Wei
,
S.
and
Davis
,
L.
(
1994
).
Genetic and physical interactions between Srp1p and nuclear pore complex proteins Nup1p and Nup2p
.
J. Cell Biol
.
126
,
619
630
.
Belhumeur
,
P.
,
Lee
,
A.
,
Tam
,
R.
,
D’Paolo
,
T.
,
Fortin
,
N.
and
Clark
,
M. W.
(
1993
).
GSP1 and GSP2, genetic supressors of prp20-1 mutant in Saccharomyces cerevisiae: GTP-binding proteins involved in the maintenance of nuclear organization
.
Mol. Cell. Biol
.
13
,
2152
2161
.
Benes
,
V.
,
Hostomsky
,
Z.
,
Arnold
,
L.
and
Paces
,
V.
(
1993
).
M13 and pUC vectors with new unique restriction sites for cloning
.
Gene
130
,
151
152
.
Bischoff
,
F. R.
and
Ponstingl
,
H.
(
1991a
).
Catalysis of guanine nucleotide exchange on Ran by the mitotic regulator RCC1
.
Nature
354
,
80
82
.
Bischoff
,
F. R.
and
Ponstingl
,
H.
(
1991b
).
Mitotic regulator protein RCC1 is complexed with a nuclear ras-related polypeptide
.
Proc. Nat. Acad. Sci. USA
88
,
10830
10834
.
Bischoff
,
F. R.
,
Klebe
,
C.
,
Kretschmer
,
J.
,
Wittinghofer
,
A.
and
Ponstingl
,
H.
(
1994
).
RanGAP1 induces GTPase activity of nuclear Ras-related Ran
.
Proc. Nat. Acad. Sci. USA
91
,
2587
2591
.
Bischoff
,
F. R.
,
Krebber
,
H.
,
Kempf
,
T.
,
Hermes
,
I.
and
Ponstingl
,
H.
(
1995
).
Human RanGTPase-activating protein RanGAP1 is a homologue of yeast Rna1p involved in mRNA processing and transport
.
Proc. Nat. Acad. Sci. USA
92
,
1749
1753
.
Bun-ya
,
M.
,
Harashima
,
S.
and
Oshima
,
Y.
(
1992
).
Putative GTP-binding protein, Gtr1, associated with the function of the Pho84 inorganic phosphate transporter in Saccharomyces cerevisiae
.
Mol. Cell. Biol
.
12
,
2958
2966
.
Boguski
,
M.
and
McCormick
,
F.
(
1993
).
Proteins regulating Ras and its relatives
.
Nature
366
,
643
653
.
Clark
,
K. L.
and
Sprague
,
G. F.
Jr
(
1989
).
Yeast pheromone response pathway: Characterization of a suppressor that restores mating to receptor less mutants
.
Mol. Cell. Biol
.
9
,
2682
2694
.
Corbett
,
A. H.
,
Koepp
,
D. M.
,
Schlenstedt
,
G.
,
Lee
,
M. S.
,
Hopper
,
A. K.
and
Silver
,
P. A.
(
1995
).
Rna1p, a Ran/TC4 GTPase activating protein, is required for nuclear import
.
J. Cell Biol
.
130
,
1017
1026
.
Dasso
,
M.
,
Nishitani
,
H.
,
Kornbluth
,
S.
,
Nishimoto
,
T.
and
Newport
,
J.
(
1992
).
RCC1, a regulator of mitosis, is essential for DNA replication
.
Mol. Cell. Biol
.
12
,
3337
3345
.
Dasso
,
M.
(
1993
).
RCC1 in the cell cycle: The regulator of chromosome condensation takes on new roles
.
Trends Biochem. Sci
.
16
,
96
101
.
Drivas
,
G. T.
,
Shih
,
A.
,
Coutavas
,
E.
,
Rush
,
M. G.
and
D’Eustachio
,
P.
(
1990
).
Characterization of four novel RAS-related genes expressed in a human teratocarcinoma cell line
.
Mol. Cell. Biol
.
10
,
1793
1798
.
Frasch
,
M.
(
1991
).
The maternally expressed Drosophila gene encoding the chromatin-binding protein BJ1 is a homologue of the vertebrate gene regulator of chromosome condensation, RCC1
.
EMBO J
.
10
,
1225
1236
.
Gietz
,
R. D.
and
Sugino
,
A.
(
1988
).
New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites
.
Gene
74
,
527
534
.
Hagan
,
I. M.
and
Hyams
,
J. S.
(
1988
).
The use of cell division cycle mutants to investigate the control of microtubule distribution in fission yeast Schizosaccharomyces pombe
.
J. Cell Sci
.
89
,
343
357
.
Hayashi
,
N.
,
Yokoyama
,
N.
,
Seki
,
T.
,
Azuma
,
Y.
,
Ohba
,
T.
and
Nishimoto
,
T.
(
1995
).
RanBP1, a Ras-like nuclear G-protein binding to Ran/TC4, inhibits RCC1 via Ran/TC4
.
Mol. Gen. Genet
.
247
,
661
669
.
Hayashi
,
N.
,
Seino
,
H.
,
Irie
,
K.
,
Watanabe
,
M.
,
Clark
,
K. L.
,
Matsumoto
,
K.
and
Nishimoto
,
T.
(
1996
).
Genetical interaction of DED1 encoding a putative ATP-dependent RNA helicase with SRM1 encoding a mammalian RCC1 homologue in Saccharomyces cerevisiae
.
Mol. Gen. Genet. (in press)
.
Ichihara
,
Y.
and
Kurosawa
,
Y.
(
1993
).
Construction of new T vectors for direct cloning of PCR products
.
Gene
130
,
153
154
.
Ito
,
H.
,
Fukuda
,
Y.
,
Murata
,
K.
and
Kimura
,
A.
(
1983
).
Transformation of intact S. cerevisiae cells treated with alkali cations
.
J. Bacteriol
.
153
,
163168
.
Kadowaki
,
T.
,
Goldfarb
,
D.
,
Spitz
,
L. M.
,
Tartakoff
,
A. M.
and
Ohno
,
M.
(
1993
).
Regulation of RNA processing and transport by a nuclear guanine nucleotide release protein and members of the Ras superfamily
.
EMBO J
.
12
,
2929
2937
.
Klebe
,
C.
,
Prinz
,
H.
,
Wittinghofer
,
A.
and
Goody
,
R. S.
(
1995
).
The kinetics mechanism of Ran-nucleotide exchange catalyzed by RCC1
.
Biochemistry
34
,
12543
12552
.
Lee
,
A.
,
Tam
,
R.
,
Belhumeur
,
P.
,
Dipaolo
,
T.
and
Clark
,
M. W.
(
1993
).
Prp20, the Saccharomyces cerevisiae homolog of the regulator of chromosome condensation, RCC1, interacts with double-stranded DNA through a multi-component complex containing GTP-binding protein
.
J. Cell Sci
.
106
,
287
298
.
Lee
,
A.
,
Clark
,
K. L.
,
Fleischmann
,
M.
,
Aebi
,
M.
and
Clark
,
M. W.
(
1994
).
Site-directed mutagenesis of the yeast PRP20/SRM1 gene reveals distinct activity domains in the protein product
.
Mol. Gen. Genet
.
245
,
32
44
.
Loeb
,
J. D. J.
,
Schlenstedt
,
G.
,
Pellman
,
D.
,
Kornitzer
,
D.
,
Silver
,
P. A.
and
Fink
,
G. R.
(
1995
).
The yeast nuclear import receptor is required for mitosis
.
Proc. Nat. Acad. Sci. USA
92
,
7647
7651
.
Matsumoto
,
T.
and
Beach
,
D.
(
1991
).
Premature initiation of mitosis in yeast lacking RCC1 or an interacting GTPase
.
Cell
66
,
347
360
.
Melchior
,
F.
,
Paschal
,
B.
,
Evans
,
J.
and
Gerace
,
L.
(
1993
).
Inhibition of nuclear protein import by nonhydrolyzable analogues of GTP and identification of the small GTPase Ran/TC4 as an essential transport factor
.
J. Cell Biol
.
123
,
1649
1659
.
Melchior
,
F.
and
Gerace
,
L.
(
1995
).
Mechanisms of nuclear protein import
.
Curr. Opin. Cell Biol
.
7
,
310
318
.
Melchior
,
F.
,
Guan
,
T.
,
Yokoyama
,
N.
,
Nishimoto
,
T.
and
Gerace
,
L.
(
1995
).
Hydrolysis of GTP by Ran is an early step of nuclear protein import that occurs at the cytoplasmic periphery of the nuclear pore complex
.
J. Cell Biol
.
131
,
571
581
.
Moore
,
M. S.
and
Blobel
,
G.
(
1993
).
The GTP-binding protein Ran/TC4 is required for protein import into the nucleus
.
Nature
365
,
661
663
.
Nishitani
,
H.
,
Ohtsubo
,
M.
,
Yamashita
,
K.
,
Iida
,
H.
,
Pines
,
J.
,
Yasuda
,
H.
,
Shibata
,
Y.
,
Hunter
,
T.
and
Nishimoto
,
T.
(
1991
).
Loss of RCC1, a nuclear DNA-binding protein, uncouples the completion of DNA replication from the activation of cdc2 protein kinase and mitosis
.
EMBO J
.
10
,
1555
1564
.
Nishiwaki
,
H.
,
Hayashi
,
N.
,
Irie
,
S.
,
Chung
,
D.-H.
,
Harashima
,
S.
and
Oshima
,
Y.
(
1987
).
Structure of the yeast HIS5 gene responsive to general control of amino acid biosynthesis
.
Mol. Gen. Genet
.
208
,
159
167
.
Ninomiya-Tsuji Nomoto
,
S.
,
Yasuda
,
H.
,
Reed
,
S. I.
and
Matsumoto
,
K.
(
1991
).
Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation
.
Proc. Nat. Acad. Sci. USA
80
,
4949
4953
.
Parent
,
S. A.
,
Fenimore
,
C. M.
,
Bostian
,
K.
(
1985
).
Vector systems for the expression, analysis and cloning of DNA sequences in S. cerevisiae. Yeast
1
,
83
138
.
Ren
,
M.
,
Drivas
,
G.
,
D’Eustachio
,
P.
and
Rush
,
M. G.
(
1993
).
Ran/TC4: a small nuclear GTP-binding protein that regulates DNA synthesis
.
J. Cell Biol
.
120
,
313
323
.
Rexach
,
M.
and
Blobel
,
G.
(
1996
).
Protein import into nuclei: association and dissociation reactions involving transport substrate, transport factors, and nucleoporins
.
Cell
83
,
683
692
.
Sazer
,
S.
and
Nurse
,
P.
(
1994
).
A fission yeast RCC1-related protein is required for the mitosis to interphase transition
.
EMBO J
.
13
,
606
615
.
Seino
,
H.
,
Hisamoto
,
N.
,
Uzawa
,
S.
,
Sekiguchi
,
T.
and
Nishimoto
,
T.
(
1992
).
DNA-binding domain of RCC1 protein is not essential for coupling mitosis with DNA replication
.
J. Cell Sci
.
102
,
393
400
.
Schmid
,
S. R.
and
Linder
,
P.
(
1992
).
D-E-A-D protein family of putative RNA helicases
.
Mol. Microbiol
.
6
,
283
292
.
Sherman
,
F.
,
Fink
,
G. R.
and
Hicks
,
J. B.
(
1982
).
Methods in S. cerevisiae Genetics
.
Cold Spring Harbor Laboratory Press
,
Cold Spring Harbor, NY
.
Schürmann
,
A.
,
Brauers
,
A.
,
Maßmann
,
S.
,
Becker
,
W.
and
Joost
,
H.-G.
(
1995
).
Cloning of a novel family of mammalian GTP-binding proteins (RagA, RagBs, RagB1) with remote similarity to the Ras-related GTPase
.
J. Biol. Chem
.
270
,
28982
28988
.
Tachibana
,
T.
,
Imamoto
,
N.
,
Seino
,
H.
,
Nishimoto
,
T.
and
Yoneda
,
Y.
(
1994
).
Loss of RCC1 leads to suppression of nuclear protein import in living cells
.
J. Biol. Chem
.
269
,
24542
24545
.
Tyers
,
M.
,
Tokiwa
,
G.
,
Nash
,
R.
and
Futcher
,
B.
(
1992
).
The Cln3-Cdc28 kinase complex of S. cerevisiae is regulated by proteolysis and phosphorylation
.
EMBO J
.
11
,
1773
1784
.
Uchida
,
S.
,
Sekiguchi
,
T.
,
Nishitani
,
H.
,
Miyauchi
,
K.
,
Ohtsubo
,
M.
and
Nishimoto
,
T.
(
1990
).
Premature chromosome condensation is induced by a point mutation in the hamster RCC1 gene
.
Mol. Cell. Biol
.
10
,
577
584
.
Winston
,
F.
,
Chumley
,
F.
and
Fink
,
G. R.
(
1983
).
Eviction and transplacement of mutant genes in yeast
.
Meth. Enzymol
.
101
,
211
228
.
Yano
,
R.
,
Oakes
,
M. L.
,
Tabb
,
M. M.
and
Nomura
,
M.
(
1994
).
Yeast Srp1p has homology to armadillo/plakoglobin/β-catenin and participates in apparently multiple nuclear functions including the maintenance of the nucleolar structure
.
Proc. Nat. Acad. Sci. USA
91
,
6880
6884
.