Epithelial-to-mesenchymal transition of peritoneal mesothelial cells is regulated by an ERK/NF-κB/Snail1 pathway

Peritoneal dialysis (PD) is an alternative to hemodialysis for the treatment of end-stage renal disease. During this process, the peritoneal membrane (PM) acts as a permeability barrier across which ultrafiltration and diffusion take place (Aroeira et al., 2007; Krediet et al., 1999). The PM consists of a single layer of mesothelial cells (MCs) covering a submesothelial region composed of connective tissue and small numbers of fibroblasts, mast cells, macrophages and blood vessels. Continuous exposure to hyperosmotic, hyperglycemic and acidic dialysis solutions, as well as episodes of peritonitis and hemoperitoneum, may cause acute and chronic inflammation and injury to the PM, which progressively undergoes fibrosis, angiogenesis and hyalinizing vasculopathy (Aroeira et al., 2007). PM injury is thus a serious concern during PD because it can lead to the loss of dialytic function.

Of the cytokines and growth factors produced during peritoneal inflammation, transforming growth factor (TGF)-β1 is considered the master molecule in the genesis of peritoneal fibrosis, since increased levels of TGF-β1 in peritoneal dialysate correlate with worse PD outcomes (Lin et al., 1997). Moreover, combined treatment with interleukin (IL)-1β and TGF-β1 induces biochemical and morphological changes in omental MCs that are reminiscent of those that occur during epithelial-to-mesenchymal transition (EMT) (Yañez-Mo et al., 2003). EMT is a complex step-wise phenomenon that occurs during embryonic development and tumor progression, and that has more recently been described in chronic inflammatory and fibrogenic diseases (Thiery and Sleeman, 2006). EMT is characterized by the disruption of intercellular junctions, replacement of apical-basolateral polarity with front-to-back polarity, and acquisition of migratory and invasive phenotypes. Cells that have undergone EMT also acquire the capacity to produce extracellular matrix components and a wide spectrum of inflammatory, fibrogenic and angiogenic factors.

The establishment and progression of EMT is controlled by multiple molecular mechanisms that appear to be cell-type specific. One key regulator is the transcription factor snail homolog 1 (hereafter referred to as Snail1), a potent transcriptional repressor of E-cadherin (Cano et al., 2000; Barrallo-Gimeno and Nieto, 2005). Snail1 expression integrates a complex network of intracellular signals, including integrin-linked kinase (ILK), phosphatidylinositol 3-kinase (PI3-K), the mitogen-activated protein kinases (MAPKs), glycogen synthase kinase (GSK)-3β, and the transcription factor NF-κB (De Craene et al., 2005). NF-κB has recently been shown to play a major role in EMT induction in a Ras-transformed cancer cell model (Huber et al., 2004). In resting cells, cytoplasmic NF-κB is complexed to inhibitor of kappaB (IκB), which upon activation is phosphorylated and subsequently degraded, allowing the release and nuclear translocation of NF-κB to activate target genes. Various kinases, including MAPK, have been implicated in the regulation of IκB (Perkins, 2007; Neumann and Neumann, 2007; Rangaswami et al., 2004).

Although the molecular regulation of EMT has been extensively studied in other cell systems, mostly in tumor cells, the signaling pathways underlying this process in MCs have not been reported. Here, we demonstrate that the extracellular regulated kinase (ERK)/NF-κB/Snail1 signaling pathway is a key regulator of EMT in MCs. Given that EMT by MCs is central to the onset of peritoneal fibrosis and angiogenesis, and that there is no effective treatment for the progressive loss of peritoneal dialytic capacity in PD patients, these results provide possible routes for therapeutic intervention.

Effluent-derived MCs from PD patients show phenotypic changes reminiscent of EMT – these changes correlate with PD and episodes of peritonitis or hemoperitoneum (Yañez-Mo et al., 2003). To test whether these changes could be produced in vitro, we exposed omentum-derived MCs from healthy donors (see supplementary material Fig. S1 and Methods for isolation procedures and purity) to peritoneal effluent from patients experiencing acute peritonitis during PD. Treatment with peritonitis effluent for 72 hours induced a loss of intercellular junctions, cell scattering, and adoption of a spindled fibroblastic phenotype (Fig. 1A), all of which are characteristic of EMT. Confocal immunofluorescence analysis showed that the treatment downregulated the expression of cytokeratin, an epithelial marker that is highly expressed in untreated MCs (Lopez Cabrera et al., 2006) (Fig. 1B). Expression of E-cadherin, another epithelial marker, was markedly reduced after 24 hours (Fig. 1C). Peritonitis effluent also upregulated proteins, such as fibronectin and N-cadherin, whose expression is associated with EMT (Fig. 1C; Fig. 5B). We confirmed these results in a non-dialysis setting by co-stimulating MCs with TGF-β1 plus IL-1β. Combined treatment was used throughout this study because, although individual stimulation with either cytokine induces changes associated with MC EMT, such as decreased E-cadherin and increased β1 and α2 integrin expression (Yañez Mo et al., 2003) (supplementary material Fig. S2A-B), an additive effect was obtained with the combination of both cytokines. Similarly to treatment with peritonitis effluent, TGF-β1 plus IL-1β induced a spindled phenotype (Fig. 2A) and a loss of epithelial, and acquisition of mesenchymal markers (Fig. 2B,C). These experiments indicate that both peritonitis effluent and TGF-β1 plus IL-1β induce a genuine EMT in primary MCs.

There is increasing evidence that NF-κB activation has a role in the initial stages of EMT during tumor progression (Huber et al., 2004). We found that TGF-β1 and IL-1β, both in combination or separately, potently induced NF-κB nuclear translocation (Fig. 3A; supplementary material Fig. S2); use of peritonitis effluent gave the same result (Fig. 3B). To test whether this activation pathway mediates the observed EMT, we infected primary MCs with a pRV-IRES-CopGreen bicistronic retroviral vector encoding an IκBα super-repressor, a non-degradable mutant form (S32A and S36A) of the repressor IκBα. The IκBα super-repressor blocked NF-κB nuclear translocation induced by TGF-β1 and IL-1β, whereas infection with empty pRV-IRES-CopGreen retroviral vector had no effect (Fig. 3C).

Infection with the IκBα super-repressor vector also interfered with biochemical changes associated with EMT. In cells stimulated with TGF-β1 plus IL-1β for 24 hours, expression of the IκBα super-repressor partially blocked the downregulation of E-cadherin protein expression, whereas this was unaffected in cells infected with the pRV-IRES-CopGreen control vector (Fig. 4A). This effect was also evident at the mRNA level (data not shown), although the magnitude of the effect of the IκBα super-repressor was hampered by the limited efficiency of viral infection in these primary MCs (10–40%; see Methods). This experiment was therefore repeated in the human MC line MeT-5A, which, similar to primary MCs, undergoes EMT upon treatment with TGF-β1 and IL-1β. Fluorescence-activated cell sorter (FACS)-purified cultures of retrovirally infected MeT-5A cells were stimulated, and quantitative reverse transcriptase (RT)-PCR demonstrated that expression of the IκBα super-repressor completely blocked cytokine-induced E-cadherin downregulation (Fig. 4B). Expression of the IκBα super-repressor in primary MCs also limited cytokine-induced downregulation of cytokeratin expression, as shown by confocal immunofluorescence analysis after 56 hours of treatment (Fig. 4C). The NF-κB activation pathway thus controls both E-cadherin and cytokeratin downregulation during EMT in primary MCs.

We analyzed upstream signaling events that might account for NF-κB activation in our experimental system. Recent reports in various cellular models have documented a role for MAPKs, particularly ERKs, in the establishment of EMT (Zavadil and Bottinger, 2005). Treatment of MCs with TGF-β1 plus IL-1β induced a high degree of ERK phosphorylation (Fig. 5A); peritonitis effluent produced a similar effect (Fig. 5B).

To examine the role of ERK activation in EMT, we pretreated MCs with U0126, a pharmacological inhibitor of MAPK kinase (MEK)-1/2 – the upstream activator of ERK. U0126 markedly suppressed cytokine-mediated downregulation of E-cadherin and cytokeratin protein expression (Fig. 5C,D). U0126 also inhibited cytokine-induced downregulation of E-cadherin mRNA expression at all times analyzed (Fig. 5E). Similar results were obtained with the MEK-1/2 inhibitor PD98059 (20 μM; not shown). These results strongly suggest that the ERK activation pathway mediates the TGF-β1- and IL-1β-induced downregulation of E-cadherin and cytokeratin.

We investigated whether the role of ERK signaling in EMT might be mediated through the induction of NF-κB activity. Pretreatment of MCs with U0126 reduced the intensity and persistence of NF-κB nuclear staining upon combined cytokine treatment (Fig. 6A). To test the effect of ERK on NF-κB transcriptional activity, we transfected MCs with a luciferase reporter construct containing multiple NF-κB binding sites (KBF-luc). Pretreatment of these cells with U0126 markedly reduced cytokine-induced luciferase activity (Fig. 6B). To directly examine the role of ERK signaling in NF-κB-mediated gene expression, we analyzed the effect of U0126 on the expression of cyclooxygenase-2 (COX-2), a gene whose expression is regulated by NF-κB and is induced during EMT. U0126 pretreatment potently inhibited COX-2 mRNA expression induced by TGF-β1 plus IL-1β (Fig. 6C), supporting a role for ERK in the regulation of NFκB-mediated gene expression during EMT.

Next, we analyzed signaling events downstream of NF-κB that might account for EMT induction. Snail1 is the best-known member of a family of zinc-finger transcriptional regulators involved in EMT induction. Snail1 directly blocks transcription from the E-cadherin promoter and appears to be involved in cytokeratin gene repression (Cano et al., 2000; Guaita et al., 2002). Quantitative RT-PCR showed that stimulation of primary MCs with TGF-β1 and IL-1β induced an increase in Snail1 mRNA expression, which was blocked by pretreatment with U0126 (Fig. 7A). This was accompanied by increased Snail1 expression and nuclear localization (Fig. 7B, top). Similar to its effect on Snail1 mRNA expression, pretreatment with U0126 markedly decreased Snail1 protein expression in cytokine-stimulated cells (Fig. 7B, bottom).

To analyze the role of NF-κB activity in Snail1 expression, we infected primary MCs with either the retrovirus encoding the IκBα super-repressor or the empty vector pRV-IRES-CopGreen, and stimulated them with TGF-β1 and IL-1β. Exogenous expression of the IκBα super-repressor partially reduced cytokine-induced expression of Snail1 mRNA (Fig. 7C, left). To control for the limited infection efficiency in these cells, this experiment was repeated in FACS-purified cultures of retrovirally-infected MeT-5A cells. In these cells, expression of the IκBα super-repressor effectively inhibited cytokine-induced Snail1 mRNA expression (Fig. 7C, right). These results strongly suggest a causal role for the ERK/NF-κB activation pathway in Snail1 expression in MCs.

EMT by peritoneal MCs in PD patients is linked to PM dysfunction (Aroeira et al., 2007; Yañez Mo et al., 2003; Aroeira et al., 2005; Del Peso et al., 2008). Given the role of ERK and NF-κB signaling in the genesis of EMT in cytokine-stimulated MCs in culture, we wondered whether this pathway might control the maintenance of the mesenchymal phenotype in PD effluent-derived MCs that have already undergone EMT in vivo. To investigate this, we obtained MCs from the effluents of 13 patients undergoing PD (Table 1). The parameters used to evaluate the different stages of transdifferentiation of these cells were both morphological (epithelial-like or non-epithelioid) and biochemical [reduced levels of E-cadherin and cytokeratins, increased expression of vascular endothelial growth factor (VEGF) and vimentin], as described in published studies (Yañez Mo et al., 2003; Aroeira et al., 2005) (data not shown). Western blot analysis showed that, compared with control omentum samples, untreated PD effluent-derived MCs had significantly increased levels of active ERK (Fig. 8A). PD effluent-derived MCs were either treated with U0126 or infected with retrovirus encoding the IκBα super-repressor. Microscopy of non-epithelioid effluent-derived MCs showed that treatment with U0126 reverted cells to an epithelial morphology (Fig. 8B). Western blot analysis showed that expression of E-cadherin, in both epithelial-like and non-epithelioid effluent-derived MCs, was restored in both U0126-treated and IκBα super-repressor-expressing cells (Fig. 8C). Furthermore, confocal immunofluorescence showed that U0126 treatment increased the levels of cytokeratin in non-epithelial MCs from PD effluents (Fig. 8D). U0126 also impaired NF-κB nuclear translocation (Fig. 8D). Finally, U0126 treatment of non-epithelioid effluent-derived MCs also downregulated Snail1 mRNA expression and upregulated E-cadherin mRNA expression (Fig. 8E). The reversal of EMT by blockade of ERK or NF-κB in these experiments strongly supports a role for the ERK/NF-κB activation pathway in the maintenance of the mesenchymal phenotype in the peritoneum of patients undergoing PD.

This study aimed to characterize the signaling pathways controlling the establishment of EMT in primary MCs, stimulated with either peritoneal effluent from peritonitis patients or TGF-β1 and IL-1β. Our results, obtained with pharmacological inhibitors and infection with retroviral vectors, demonstrate that an ERK/NF-κB/Snail1 signaling pathway controls cytokine-induced downregulation of E-cadherin and cytokeratin during EMT in MCs. Moreover, blockade of this signaling pathway in transdifferentiated MCs isolated from PD effluents reverses EMT.

There is increasing evidence that EMT, far from being limited to development and cancer, also occurs in other pathophysiological situations, including chronic inflammatory and fibrotic diseases affecting the kidney, liver and lung (Thiery and Sleeman, 2006; Kalluri and Neilson, 2003; Iwano et al., 2002). In peritoneal fibrosis, the presence of transdifferentiated MCs in the peritoneum and effluent of patients undergoing PD is associated with recurrent acute and chronic inflammation, and has been linked to a decline in peritoneal function (Aroeira et al., 2007; Yañez Mo et al., 2003; Aroeira et al., 2005; Del Peso et al., 2008). Our results demonstrate that the exposure of normal MCs to peritonitis effluent from patients undergoing PD is sufficient to drive MC EMT. Moreover, we obtained the same results by stimulating MCs with TGF-β1 and IL-1β at concentrations comparable to those found in inflamed peritoneum of PD patients (Yañez Mo et al., 2003; Lai et al., 2000).

Our approach of combining TGF-β1 and IL-1β attempts to reproduce something of the complex mixture of proinflammatory and profibrotic stimuli induced during peritoneal EMT in vivo. TGF-β1 alone has been widely reported to induce EMT, including in MCs (Yañez Mo et al., 2003). However, combined cytokine treatment has additive effects on cell morphology (Yañez Mo et al., 2003), E-cadherin downregulation (supplementary material Fig. S2) and increased β1 and α2 integrin expression, and enhances migration by transdifferentiated cells (Yañez Mo et al., 2003) (supplementary material Fig. S2). Moreover, there are several points of cross-talk between signaling pathways activated by TGF-β1 and IL-1β (Lu et al., 2007), thus their combined use provides a more physiological analysis for specific biological responses.

Reproduction of the effects of peritonitis effluent on primary MCs (loss of intercellular junctions, cell scattering, and acquisition of a spindle-like morphology) by the cytokine combination establishes the experimental system used here as a valid model for the study of peritoneal EMT. Cytokine treatment also triggers rapid E-cadherin internalization and degradation. In addition, we found that both peritonitis effluent and cytokine treatment induced de novo expression of fibronectin and increased expression of N-cadherin. The switch towards the expression of non-epithelial cadherins, such as N-cadherin, may be related to increased motility and invasiveness of transdifferentiated MCs. Meanwhile, expression of the extracellular matrix component fibronectin may be linked to the role of MCs in the genesis of peritoneal fibrosis (Maeda et al., 2005).

A crucial role for ERK, p38 and JNK MAPK signaling pathways in the genesis of EMT has been widely demonstrated; however, their effects appear to be cell-type specific (Grotegut et al., 2006; Santibanez, 2006; Bhowmick et al., 2001). Our results underline the importance of ERK signaling in the onset of mesothelial EMT in response to stimulation with TGF-β1 plus IL-1β. We found that inhibition of ERK signaling prevents cell scattering and the acquisition of a spindle-like phenotype, and also blocks downregulation of E-cadherin and cytokeratin during EMT. E-cadherin appears to be regulated by ERK at the level of transcription, although an effect on the E-cadherin endocytosis-degradation pathway cannot be excluded.

NF-κB activation plays a major role in EMT in a Ras-transformed cancer model (Huber et al., 2004). In our study, expression of a retrovirally encoded IκBα super-repressor demonstrates that NF-κB controls both E-cadherin and cytokeratin downregulation during MC EMT. To our knowledge, the current report is the first to demonstrate involvement of NF-κB in a primary cell culture model of EMT. Moreover, this report is the first to demonstrate a link between ERK and NF-κB signaling in relation to EMT, as indicated by impairments in both NF-κB nuclear translocation and transcriptional activity in cells pretreated with the MEK inhibitor U0126 before cytokine stimulation. This link is further supported by U0126-induced blockade of COX-2 expression – an NF-κB-induced gene that can be upregulated during EMT. Although regulation of NF-κB transcriptional activity by the ERK activation pathway has been demonstrated previously, the molecular mechanism of this effect remains unclear. The Ras-ERK pathway has been shown to mediate NF-κB-induced gene expression in macrophages through an effect on IκB kinase (IKK) α/β activation and IκBα degradation (Chen et al., 2004). ERK can phosphorylate IκB in vitro and can also bind to, and directly phosphorylate, NF-κB (Dhawan and Richmond, 2002). Our results indicate that ERK regulates NF-κB translocation in MCs, possibly via an action on IκB. There may also be a role for ERK-mediated NF-κB phosphorylation, which has been demonstrated to affect NF-κB transcriptional activity. However, it should be emphasized that the link between ERK and NF-κB does not exclude the possibility that ERK regulates EMT independently of NF-κB.

Snail1 is considered a key transcriptional regulator of EMT because of its direct inhibitory action on the E-cadherin promoter (Cano et al., 2000; Batlle et al., 2000). In addition to this, Snail1 is emerging as an overall regulator of EMT (Barrallo Gimeno and Nieto, 2005). In our experimental system, combined cytokine treatment induces a marked increase in Snail1 expression, which inversely correlates with E-cadherin expression levels. The demonstration, in pharmacological and retroviral assays, that induction of Snail1 expression is dependent on ERK and NF-κB is consistent with studies of Snail1 promoter activation (Barbera et al., 2004) and the recent confirmation that Snail1 expression is downstream of NF-κB activation (Bachelder et al., 2005). Snail1 activity has recently been shown to be regulated by phosphorylation, which regulates its subcellular localization (Dominguez et al., 2004). Our confocal immunofluorescence experiments show that cytokine-induced Snail1 expression and nuclear localization in MCs is dependent on ERK activity. The interaction between ERK, NF-κB and Snail1 may be multidirectional; ERK activation can be induced by the IKK complex (Huber et al., 2004), and can also be regulated by Snail1 (Barrallo Gimeno and Nieto, 2005). Furthermore, Snail1 also regulates ERK expression (Peiro et al., 2006). Thus, there may be a negative feedback mechanism in the regulation of Snail1 activity, which might be dysregulated under pathological conditions.

In vitro and in vivo studies have demonstrated that EMT can be reversed (Huber et al., 2004; Zeisberg et al., 2003), and cytokines such as bone morphogenetic protein-7 (BMP7) have been shown to play a role in this reversal in several organs and tissues, including transdifferentiated MCs (Zeisberg et al., 2003; Zeisberg et al., 2007; Vargha et al., 2006). Transdifferentiated cells from peritoneal effluents of patients undergoing PD express Snail1 at high levels (Yañez Mo et al., 2003). Coupled to this finding, our observation that ERK is activated in ex vivo cultured MCs from CAPD patients (Fig. 7A) suggests a role for the ERK/NF-κB/Snail1 pathway in the genesis and maintenance of EMT in these cells. This view is strongly supported by our finding that blockade of ERK or NF-κB signaling induces a reverse MET (mesenchymal to epithelial transition), characterized by adoption of epithelial cell morphology and increased protein expression of E-cadherin and cytokeratin.

Our results suggest that the ERK/NF-κB/Snail1 pathway is rapidly activated during combined stimulation with TGF-β1 plusIL-1β, and mediates the progression and stabilization of the mesenchymal state in peritoneal MCs. This study is the first extensive characterization of a signaling pathway controlling EMT in a non-tumoral primary cell culture model, and provides knowledge of basic and clinical relevance, since it could form the rationale for the development of drugs able to counteract the progressive deterioration of the PM that occurs in patients undergoing PD.

Human MCs were obtained by digestion of omentum samples from patients who were undergoing unrelated abdominal surgery (Stylianou et al., 1990). The samples were digested with a 0.125% trypsin solution containing 0.01% EDTA. Cells were cultured in Earle’s M199 medium supplemented with 20% fetal calf serum, 50 U/ml penicillin, 50 μg/ml streptomycin, and 2% Biogro-2 (containing insulin, transferrin, ethanolamine, and putrescine) (Biological Industries, Beit Haemek, Israel). To induce EMT, MCs were treated with a combination of human-recombinant TGF-β1 (0.5 ng/mL) and IL-1β (2 ng/mL) (R&D Systems, Minneapolis, MN) as described previously (Yañez Mo et al., 2003; Aroeira et al., 2005). Although both TGF-β1 and IL-1β separately are able to induce EMT phenotypic changes, combined stimulation induces a genuine EMT (Yañez Mo et al., 2003). The cytokine doses used are in the range of those detected in peritoneal-dialysis fluids in the presence of peritonitis (Lai et al., 2000) and are similar to those used in previous studies (Yañez Mo et al., 2003; Yang et al., 1999).

Effluent-derived MCs were isolated from 13 clinically stable PD patients using a method described previously (Lopez Cabrera et al., 2006). Cells were cultured as above, and after 10-15 days cultures reached confluence and were split at a ratio of 1:2. The morphological features of cells in confluent cultures were compared and remained stable during the two to three passages used for experiments. Confluent MC cultures from PD effluents show one of two major phenotypes, epithelial-like or non-epithelioid, which remain stable for two to three cell passages (Aroeira et al., 2005). Of the 13 effluent-derived MC cultures evaluated, six had the epithelial-like phenotype and seven had the non-epithelioid phenotype. To control for fibroblast contamination, the purity of omentum and effluent-derived MC cultures was determined from the expression of the standard mesothelial markers, intercellular adhesion molecule (ICAM)-1 and cytokeratins (Aroeira et al., 2007). MCs expressed high levels of ICAM-1 and low levels of the fibroblast-specific marker S100, allowing MCs to be easily distinguished from peritoneal fibroblasts (supplementary material Fig. S1). MC cultures were also negative for the endothelial marker CD31 and the macrophage marker CD45 (supplementary material Fig. S1). When isolating both omentum- and peritoneal effluent-derived MCs, we generally obtain highly purified cell populations, with <5% contaminant cells, as determined by FACS analysis (M.L.-C., unpublished results). Purified samples with >5% contaminant cells are routinely discarded.

The study was approved by the ethics committee of the Hospital Universitario de la Princesa (Madrid, Spain). Written informed consent was obtained from both PD patients included in this study, for the use of effluent samples, and from omentum donors prior to elective surgery.

The human MC line MeT-5A (ATCC, Rockville, MD) was cultured in Earle’s M199 medium, as above, and stimulated with the same doses of TGF-β1 and IL-1β. MeT-5A is an untransformed MC line, which is increasingly used in peritoneal MC research; data obtained with this cell line have shown concordance with data obtained with primary cells (Rampino et al., 2001; Bidmon et al., 2004).

The monoclonal antibody against E-cadherin was purchased from BD (Becton-Dickinson Laboratories, Mountain View, CA); monoclonal antibodies against tubulin and pan-cytokeratin were from Sigma (Saint Louis, MO); polyclonal antibodies against ERK and phospho-ERK were from Cell Signaling (Cell Signaling Technology, Danvers, MA); polyclonal antibodies against p65 NF-κB, IκBα and Snail1 were from Santa Cruz Biotechnology (Santa Cruz, CA); monoclonal antibodies against fibronectin and N-cadherin were from Zymed (Invitrogen, Carlsbad, CA); and the polyclonal antibody against S100 was purchased from Dako (Glostrub, Denmark). The monoclonal antibodies against ICAM-1 (HU5/3) and CD31 (TP1/15) were provided by Dr Sánchez Madrid (CNIC, Madrid). U0126 was from Calbiochem (EMD, Darmstad, Germany). MG132 and LiCl were from Sigma.

Monolayers of MCs were lysed in modified RIPA buffer containing: 50 mM Tris-HCl, pH 7.4; 1% NP-40; 0.1% SDS; 0.25% Nadeoxycholate; 150 mM NaCl; 1 mM EDTA; 1 mM EGTA; 1 mM PMSF; 1 μg/ml each of aprotinin, leupeptin and pepstatin; and 25 mM NaF (all from Sigma). Equal amounts of protein were resolved by SDS-PAGE. Proteins were transferred to PVDF membranes (Millipore, Bedford, VA) and probed with antibodies using standard procedures. PVDF-bound antibodies were detected by chemiluminescence with ECL (Amersham Life Sciences, Little Chalfont, UK).

Cells were fixed for 20 minutes in 3% formaldehyde in PBS, permeabilized in 0.2% Triton X-100/PBS for 5 minutes, and blocked with 2% BSA for 20 minutes. For E-cadherin staining, cells were fixed and permeabilized in cold methanol for 10 minutes. For Snail staining, cells were pretreated with LiCl and MG132 to block Snail phosphorylation, ubiquitination and subsequent degradation (Zhou et al., 2003). Secondary antibodies (conjugated to Alexa-647, -488 and -541) and Hoechst 33342 were from Pierce Chemical Company (Rockford, IL). Confocal images were acquired using a Leica SP5 spectral confocal microscope. The spectral technology allows discrimination between yellow and green fluorescence. Quantification of NF-κB nuclear intensity was performed using the Leica LAS-AF software. Briefly, nuclei were delimited using Hoechst labeling, and mean fluorescence intensity of NF-κB labeling was quantified. A minimum of three different fields per condition were acquired, with between 30 and 50 cells quantified per condition.

MeT-5A cells and omentum-derived MCs were infected with either a pRV-IRES-CopGreen retroviral vector (Genetrix, Madrid, Spain) encoding a super-repressor IκBα mutant that harbored mutations S32A and S36A, or with empty pRV-IRES-CopGreen vector as control. A crucial step in NF-κB activation is phosphorylation of IκB by the high molecular weight IKK complex (Huber et al., 2004). Mutations S32A and S36A render IκBα insensitive to IKK phosphorylation. Twenty-four hours before infection, MCs were seeded into 6-well plates (2×10⁵ cells per well) and retrovirus-producing 293T cells were seeded at 3×10⁶ cells per 10 cm plate. For infection, 293T cell supernatants were filtered through a 0.45 μm filter (Whatman, Dassel, Germany), and 5 μg/ml polybrene (Sigma-Aldrich, St Louis, MO, USA) was added to the filtrate. Thereafter, medium was removed from the MCs and replaced with 293T cell supernatants containing the retrovirus. This process was repeated twice at 24-hour intervals. Twenty-four hours after the final exposure to retrovirus, infection efficiency was monitored by fluorescence microscopy (Carl Zeiss, Standort Göttingen, Germany) or FACS analysis (BD FACS Canto, Becton-Dickinson Laboratories, Mountain View, CA). FACS analysis showed that the percentage of primary MCs infected ranged between 10 and 40% (data not shown), indicating that infection efficiency could lead to an underestimation of the effect of the IκBα super-repressor. As a control for this, pure cultures of infected MeT-5A cells were obtained by sorting using a Dako MoFlo cell sorter (Glostrub, DK).

NF-κB transcriptional activity was measured by transient transfection of MeT-5A cells with the KBF-luc reporter plasmid and subsequent luciferase activity assay (Castellanos et al., 1997). Briefly, 2×10⁵ cells were transfected with 2 μg of the KBF-luc reporter plasmid together with 500 ng of the reporter plasmid pRL-null, which bears a promoter-less Renilla luciferase gene (Promega, Madison, WI). Transfections were performed by incubating cells for 4 hours with a mixture of DNA and lipofectamine at a ratio of 1:2.5 (Lipofectamine 2000; Invitrogen, Carlsbad, CA, USA) in serum-free medium. After transfection, cells were pretreated overnight with vehicle (DMSO) or U0126 (20 μM). Cells were then stimulated with TGF-β1 and IL-1β for the times indicated. Luciferase activity was measured with the dual-luciferase reporter assay system (Promega) according to the manufacturer’s instructions and determined in a Sirius single tube luminometer (Berthold Detection Systems GmbH, Pforzheim, Germany). All experiments were carried out in duplicate.

Total RNA was extracted with the RNeasy kit (Qiagen GmbH, Hilden, Germany), and the cDNA was obtained from 500 ng of total RNA by using an Omniscript RT kit (Qiagen). Quantitative PCR was carried out in a LightCycler (Roche Diagnostics GmbH, Mannheim, Germany) using a SYBR Green kit (Roche Diagnostics GmbH) and the following specific primer sets: 5′TGAAGGTGACAGAGCCTCTG3′ and 5′TGGGTGAATTCGGGCTTGTT3′ for E-cadherin; 5′GCAAATACTGCAACAAGG3′ and 5′GCACTGGTACTTCTTGACA3′ for Snail1; 5′AAAGCCGCTCGCAAGAGTGCG3′ and 5′-ACTTGCCTCCTGCAAAGCAC3′ for histone H3 (used for normalization). The annealing temperature for E-cadherin and H3 amplification was 62°C, and fluorescence was measured at the end of each elongation cycle. For Snail1 amplification, the annealing temperature was 55°C and fluorescence was measured at 88°C, after each elongation cycle. All experiments were carried out in duplicate. After amplification, the PCR products were confirmed by melting-curve analysis and gel electrophoresis. COX-2 mRNA levels were estimated by 35 cycles of qualitative PCR with an annealing temperature of 63°C and the following primers: 5′TTCAAATGAGATTGTGGAAAAATTGCT3′ and 5′AGATCATCTCTGCCTGAGTATCTT3′.

Statistical significance was determined with a t-test with OriginPro7 software (OriginLab Co.). P values of <0.05 were considered significant.

This work was supported by the MICINN (Spanish Ministry of Science and Innovation) through grants SAF2005–00493, GEN2003-20239-C06-04, and RTICC (Cancer Research Network) to M.A.d.P., EUROHORCS (European Heads Of Research Councils) and the European Science Foundation (ESF) through a EURYI (European Young Investigator) award to M.A.d.P., the EMBO Young Investigator Programme, and by the European Union 6th Framework Programme through a Marie Curie International Reintegration Grant (MIRG-CT-2005-016427) to M.A.d.P. This work was also supported by MICINN grants to M.L.-C. (SAF2007–61201 and PET2006-0256). R.S. was first supported by a fellowship from the FIRC (Fondazione Italiana per la Ricerca sul Cancro) and then by a Río Hortega Contract (Instituto de Salud Carlos III). I.B. is a recipient of a CIBERehd fellowship (MICINN). Editorial assistance was provided by Simon Bartlett. The CNIC is supported by the Spanish Ministry of Health and Consumer Affairs and the Pro-CNIC Foundation. Deposited in PMC for immediate release.