1-20 of 47
Keywords: homeotic genes
Close
Sort by
Journal Articles
Journal: Development
Development (2010) 137 (21): 3633–3642.
Published: 1 November 2010
...Heike Wollmann; Erica Mica; Marco Todesco; Jeff A. Long; Detlef Weigel The ABC model of flower development explains how three classes of homeotic genes confer identity to the four types of floral organs. In Arabidopsis thaliana, APETALA2 ( AP2 ) and AGAMOUS ( AG ) represent A- and C-class genes...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2008) 135 (14): 2383–2390.
Published: 15 July 2008
... in trxG and PcG genes can antagonize each other's function, whereas mutations of genes within each group have synergistic effects. Here, we show in Drosophila that multiple trxG and PcG proteins act through the same or juxtaposed sequences in the maintenance element (ME) of the homeotic gene Ultrabithorax...
Journal Articles
Journal: Development
Development (2007) 134 (23): 4157–4166.
Published: 1 December 2007
... of Kansas, Lawrence, KS 66045, USA 7 9 2007 © 2007. 2007 Petal identity Homeotic genes MADS-box genes Poppy Papaver somniferum Nearly all angiosperm flowers possess a perianth, a series of sterile organs that surround the reproductive organs - the stamens and carpels...
Includes: Supplementary data
Journal Articles
Journal: Development
Development (2005) 132 (17): 3963–3976.
Published: 1 September 2005
...). PcG genes are essential genes in higher eukaryotes responsible for the maintenance of the spatially distinct repression of developmentally important regulators such as the homeotic genes. Their absence, as well as overexpression, causes transformations in the axial organization of the body. Although...
Includes: Multimedia, Supplementary data
Journal Articles
Journal Articles
Journal: Development
Development (2003) 130 (4): 729–739.
Published: 15 February 2003
.... * Author for correspondence (e-mail: [email protected] ) 11 11 2002 © 2003. 2003 Drosophila Transcriptional repression and activation Engrailed Hedgehog Wingless signaling Extradenticle Homeotic genes Engrailed (En) comprises a homeodomain that recognizes specific...
Journal Articles
Journal: Development
Development (2002) 129 (10): 2483–2493.
Published: 15 May 2002
...Sylvain Poux; Béatrice Horard; Christian J. A. Sigrist; Vincenzo Pirrotta Polycomb group (PcG) and Trithorax (TRX) complexes assemble at Polycomb response elements (PREs) and maintain respectively the repressed and active state of homeotic genes. Although PcG and TRX complexes are distinct...
Journal Articles
Journal Articles
Journal: Development
Development (2001) 128 (1): 75–85.
Published: 1 January 2001
... silencing Pleiohomeotic Polycomb complexes Homeotic genes Drosophila Chromatin complexes of Polycomb Group (PcG) proteins maintain the repressed state of homeotic genes in embryonic regions in which they were initially repressed by transient regulators such as Hunchback. The target of PcG...
Journal Articles
Journal Articles
Journal Articles
Journal Articles
Journal: Development
Development (1998) 125 (9): 1781–1790.
Published: 1 May 1998
... of Biologists 1998 Hox homeotic genes abdominal-A pointed odd paired wingless decapentaplegic Ultrabithorax Visceral mesoderm Ets Drosophila P1 return: GTTGTAGCCTGAACTAAAGAA; P2: GAATTGGCGATTTGTAAAACA; P2 return: CATTGTGGGAGTGGGGCGTGG. Lethal excision lines were...
Journal Articles
Journal: Development
Development (1998) 125 (1): 71–84.
Published: 1 January 1998
...Patrick Motte; Heinz Saedler; Zsuzsanna Schwarz-Sommer ABSTRACT The identity and developmental pattern of the four organ types constituting the flower is governed by three developmental functions, A, B and C, which are defined by homeotic genes and established in two adjacent whorls. In this report...
Journal Articles
Journal Articles
Journal: Development
Development (1997) 124 (21): 4343–4350.
Published: 1 November 1997
...Ana Busturia; Christopher D. Wightman; Shigeru Sakonju ABSTRACT Transcriptional silencing by the Polycomb Group of genes maintains the position-specific repression of homeotic genes throughout Drosophila development. The Polycomb Group of genes characterized to date encode chromatinassociated...
Journal Articles
Journal: Development
Development (1997) 124 (17): 3321–3331.
Published: 1 September 1997
... pathway genes, we screened for mutations on loci on the Drosophila second chromosome that interact with the homeotic gene Deformed ( Dfd ). Genetic and molecular tests on the eight genes isolated in the screen place them in three general categories. Two genes appear to encode trithorax group functions...
Journal Articles
Journal: Development
Development (1997) 124 (10): 2007–2014.
Published: 15 May 1997
... Medical Institute, Department of Genetics and Development, Columbia University, 701 West 168th Street, New York, NY 10032, USA 17 03 1997 © 1997 by Company of Biologists 1997 homeotic genes cooperative binding extradenticle pbx mouse Drosophila In Drosophila...
Journal Articles
Journal: Development
Development (1997) 124 (1): 149–157.
Published: 1 January 1997
...Bryan T. Rogers; Michael D. Peterson; Thomas C. Kaufman ABSTRACT The products of the HOM/Hox homeotic genes form a set of evolutionarily conserved transcription factors that control elaborate developmental processes and specify cell fates in many metazoans. We examined the expression...
Journal Articles
Journal: Development
Development (1995) 121 (11): 3615–3626.
Published: 1 November 1995
...). K.L.C. was supported by a Martin Foundation Postdoctoral Fellowship. This work was supported by NIH grant R01 GM39353. REFERENCES Andrew , D. J. and Scott , M. P. ( 1992 ). Downstream of the homeotic genes . New Biol . 4 , 5 – 15 . Austin , J. and Kenyon , C...