Precise genome manipulation in specific cell types and subtypes in vivo is crucial for neurobiological research because of the cellular heterogeneity of the brain. Site-specific recombinase systems in the mouse, such as Cre-loxP, improve cell type-specific genome manipulation; however, undesirable expression of cell type-specific Cre can occur. This could be due to transient expression during early development, natural expression in more than one cell type, kinetics of recombinases, sensitivity of the Cre reporter, and disruption in cis-regulatory elements by transgene insertion. Moreover, cell subtypes cannot be distinguished in cell type-specific Cre mice. To address these issues, we applied an intersectional genetic approach in mouse using triple recombination systems (Cre-loxP, Flp-FRT and Dre-rox). As a proof of principle, we labelled heterogeneous cell subtypes and deleted target genes within given cell subtypes by labelling neuropeptide Y (NPY)-, calretinin (calbindin 2) (CR)- and cholecystokinin (CCK)-expressing GABAergic neurons in the brain followed by deletion of RNA-binding Fox-1 homolog 3 (Rbfox3) in our engineered mice. Together, our study applies an intersectional genetic approach in vivo to generate engineered mice serving dual purposes of simultaneous cell subtype-specific labelling and gene knockout.

Single-cell RNA sequencing reveals cellular heterogeneity in organs, with especially high levels of heterogeneity in the brain (Darmanis et al., 2015; Vinsland and Linnarsson, 2022). In the field of neurobiology, one of the challenges is the precise labelling of specific cell types to accomplish gene manipulation in a cell type-specific manner in rodents, which currently depends on the mouse Cre-loxP system. However, undesirable expression of cell type-specific Cre, which could be due to transient expression during early development but shut down in adulthood, its natural expression in more than one cell type, kinetics of recombinases, sensitivity of the Cre reporter, and disruption in cis-regulatory elements by transgene insertion present a disadvantage when attempting to label heterogeneous cell subtypes for precise deletion of target genes in organs, especially the brain (Leshan et al., 2012; Taniguchi et al., 2011). An intersectional approach with the use of two site-specific recombinases (SSRs) can overcome this disadvantage in mice, thereby resulting in more precise genetic lineage tracing (He et al., 2017), specific cell-type targeting in the brain (He et al., 2016), and accurate gene knockout (Han et al., 2021) or activation (Awatramani et al., 2003). Transgenic mice and related adenoviruses have been developed for intersectional targeting with high specificity and performance (Madisen et al., 2015). The Flp-FRT and Dre-rox SSR systems have been used to target neural circuits with cell type and projection type specificity (Anastassiadis et al., 2009; Han et al., 2021; He et al., 2016; Karimova et al., 2018; Li et al., 2020; Liu et al., 2020; Madisen et al., 2015; Plummer et al., 2015; Sajgo et al., 2014). Although an intersectional approach for gene deletion and cell type-specific labelling has been achieved within defined brain regions using a retrograde virus or a combination of a Flp driver, a Flp-dependent-Cre virus, and a Cre-dependent fluorescence expression allele (Jung et al., 2019), mice with both cell type-specific labelling and gene knockout are not currently available.

To address this issue, we applied triple recombination comprising Cre-loxP SSR, Flp-FRT SSR and Dre-rox SSR to generate reporter-and-Dre-recombinase bicistronic knock-in mice and rox-flanked gene knockout mice. These engineered mice serve dual purposes of having both selective labelling of specific cell types and precise deletion of target genes within given cell types simultaneously. As a proof of principle, we labelled GABAergic neurons expressing neuropeptide Y (NPY), calretinin (calbindin 2) (CR) and cholecystokinin (CCK), using the intersectional crosses of corresponding Cre mice (NPY-Cre, CR-Cre and CCK-Cre) in conjunction with Flp mice expressing all GABAergic neurons (Dlx5/6-Flp). Next, using our engineered mice, we precisely deleted Rbfox3 (RNA binding fox-1 homolog 3) from each of the above three subtypes of GABAergic neurons using the Dre-rox system. RBFOX3 is a neuronal splicing regulator and regulates hippocampal circuit balance and function, in addition to adult neurogenesis and synaptogenesis (Huang et al., 2022; Lin et al., 2018, 2016b; Wang et al., 2015). We deleted target candidate genes in precise cell subtypes of corresponding conditional knockout (cKO) mice. This approach eliminates the problem of undesirable expression that occurs with cell type-specific Cre mice and provides a system for simultaneously labelling heterogeneous cell subtypes and deleting target genes within given cell subtypes in the mouse brain. The specificity of these cKO mice facilitate a more precise interpretation of gene expression in a cell type-specific manner. The use of cKO mice combined with other approaches would also provide information on causality between target gene candidates and their downstream functional readouts with cell type-specific resolution in addition to lineage tracing. In short, our triple SSR mice provide advantages for simultaneous cell type-specific labelling and genome engineering in vivo.

Validation of Dre knock-in and Rbfox3rox/rox mice

Cre-loxP, Flp-FRT and Dre-rox are three known systems that mediate SSR events in genomic DNA. An intersectional approach results in transgene expression that is more cell type-specific by combining different recombination systems that have distinct promoters and provide precise site-specific deletions. Therefore, we combined the Cre-loxP, Flp-FRT and Dre-rox systems to delete a target gene in a specific cell type of the mouse brain. First, we generated Dre knock-in mice with two STOP cassettes, with the first flanked by FRT and the second flanked by loxP, which precedes the tdTomato-P2A-DreO sequences (Fig. 1A, Fig. S1). Critical genomic sequences were validated by PCR and Sanger sequencing (Fig. 1B) and Southern blot (Fig. S1B,C). Next, we generated Rbfox3 (RNA binding fox-1 homolog 3) conditional knockout (cKO) mice with key exons flanked by rox sequences (Fig. 1C). Genotyping was employed to distinguish wild-type (WT), heterozygous (HET) and homozygous (Homo) cKO mice (Fig. 1D). The 5′ and 3′ rox sites were validated by Sanger sequencing (Fig. 1E,F). To further validate the occurrence of recombination and the presence of 5′rox and 3′rox sites on the same chromosome, we examined the rox recombination sites in DNA from the brains of Npy-Cre::Dlx5/6-Flp::Dre/+::rox/+ mice with 5′rox/F and 3′rox/R primers. PCR analysis demonstrated the correct rox recombination site in these mice (Fig. 1G). We also confirmed whether two STOP cassettes were removed under Cre and Flp expression in DNA from the brains of Npy-Cre::Dlx5/6-Flp::Dre/+::rox/+ mice with CAG/F and td/R primers using PCR analysis (Fig. 1H). Collectively, these findings validate the genomic structures of our Dre knock-in and Rbfox3rox/rox mice.

Fig. 1.

Generation of a triple recombination system in the mouse. (A) Schematic of the targeting locus on the ROSA26 gene. The sizes for the CAG promoter, 3XpA, tdTomato-p2A-DreO and Neo are 1.7, 1.0, 3.5 and 1.9 kb, respectively. pA1 is synthetic polyA; pA2 is bGH polyA; pA3 is HSV TK polyA; pA4 is SV40 polyA; and pA5 is PGK polyA. The distance between pA1 and pA2 is 10 bp. The distance between pA2 and pA3 is 80 bp. The distance between pA4 is 121 bp. DreO is a mammalian codon-optimized bacteriophage D6 site-specific recombinase. (B) Representative PCR products showing critical genomic loci. R26 L/F and R26/R/R primers were located within their corresponding targeting arms. (C) Schematic of the targeting locus on the Rbfox3 gene. (D) Genotyping results for rox conditional knockout mice. (E,F) 5′- and 3′-rox sites were verified with Sanger sequencing of the PCR products inserted into a TA cloning vector using 5′rox/F&R and 3′rox/F&R primers, respectively. (G) rox recombination sites were identified using 5′rox/F and 3′rox/R primers from brain tissues of Npy-Cre::Dlx5/6::Dre/+::rox/+ mice. (H) Successful FRT and loxP recombination sites were verified using CAG/F and td/R primers from brain tissues of Npy-Cre::Dlx5/6::Dre/+::rox/+ mice.

Fig. 1.

Generation of a triple recombination system in the mouse. (A) Schematic of the targeting locus on the ROSA26 gene. The sizes for the CAG promoter, 3XpA, tdTomato-p2A-DreO and Neo are 1.7, 1.0, 3.5 and 1.9 kb, respectively. pA1 is synthetic polyA; pA2 is bGH polyA; pA3 is HSV TK polyA; pA4 is SV40 polyA; and pA5 is PGK polyA. The distance between pA1 and pA2 is 10 bp. The distance between pA2 and pA3 is 80 bp. The distance between pA4 is 121 bp. DreO is a mammalian codon-optimized bacteriophage D6 site-specific recombinase. (B) Representative PCR products showing critical genomic loci. R26 L/F and R26/R/R primers were located within their corresponding targeting arms. (C) Schematic of the targeting locus on the Rbfox3 gene. (D) Genotyping results for rox conditional knockout mice. (E,F) 5′- and 3′-rox sites were verified with Sanger sequencing of the PCR products inserted into a TA cloning vector using 5′rox/F&R and 3′rox/F&R primers, respectively. (G) rox recombination sites were identified using 5′rox/F and 3′rox/R primers from brain tissues of Npy-Cre::Dlx5/6::Dre/+::rox/+ mice. (H) Successful FRT and loxP recombination sites were verified using CAG/F and td/R primers from brain tissues of Npy-Cre::Dlx5/6::Dre/+::rox/+ mice.

Validation of labelling of NPY-expressing GABAergic neurons and precise deletion of Rbfox3 in brains of engineered mice

Neuropeptide Y (NPY) is a 36-amino acid neuropeptide that is abundant in the brain and spinal cord (Danger et al., 1990; Wahlestedt et al., 1989; Wettstein et al., 1995). NPY is highly expressed in the basal ganglia, nucleus accumbens and amygdala, and moderately expressed in the hypothalamus, hippocampus, septal nuclei, cortex and periaqueductal grey matter (Danger et al., 1990; Wahlestedt et al., 1989; Wettstein et al., 1995). NPY is released from neurons, binds to NPY receptors, and is a molecular marker for distinct classes of GABAergic neurons and long projection cells in the brainstem (Silveira et al., 2020; Thorsell and Ehlers, 2006). In mice, the expression of Npy in the central nervous system (CNS) begins around embryonic day 11.5 (Yue et al., 2014). NPY-Cre mice are widely used for labelling NPY-expressing GABAergic neurons in the nervous system (Goswamee et al., 2021; Lee et al., 2022; Milstein et al., 2015; Tokarska and Silberberg, 2022). However, NPY-Cre mice showed undesirable expression of Cre recombinase in hippocampal dentate granule cells and excitatory neurons, as seen in NPY-Cre::Ai14 mice (Fig. 2B). Dlx5/6 is expressed in differentiating and migrating forebrain GABAergic neurons during embryonic development in Dlx5/6-Flp transgenic mice (Monory et al., 2006). The Dlx5/6 transgene was designed with the intergenic enhancer regions between the mouse Dlx5 and Dlx6 locus together with a β-globin basal promoter. Generation of NPY-Dre (NPY-Cre::Dlx5/6-Flp::Dre) mice solved this problem of undesirable expression as demonstrated in Fig. 2C. Furthermore, NPY-Dre mice showed high labelling efficiency and specificity of tdTomato+ cells to NPY-expressing GABAergic neurons (Fig. S2) and Cre+Flp+ cells (Fig. S3). Moreover, successful deletion of Rbfox3 in NPY-expressing GABAergic neurons was exhibited in the hippocampus (Fig. 2D-F) and cortex (Fig. S4A-C) of NPY-Dre-Rbfox3rox/rox (NPY-Cre::Dlx5/6-Flp::Dre::Rbfox3rox/rox) mice compared with their controls. Reduced density of tdTomato+ cells was observed in the hippocampus of NPY-Dre-Rbfox3rox/rox mice compared with their controls (Fig. 2G). No cellular toxicity was observed in the hippocampus of NPY-Dre mice using terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assays (Fig. S5B).

Fig. 2.

Precise labelling of NPY-expressing GABAergic neurons and Rbfox3 deletion within given cell types in mouse hippocampus. (A) Left: Schematic of the diverse interneuron populations in the hippocampal dentate gyrus. GC, granule cell; GL, granule layer; ML, molecular layer; nNOS, neuronal nitric oxide synthase; PV, parvalbumin; SOM, somatostatin; VIP, vasoactive intestinal polypeptide. Right: Overlap of NPY-Cre and Dlx5/6-Flp indicates NPY-expressing GABAergic neurons. (B-E) Representative images of 40-µm-thick hippocampal sections from mice at postnatal day 49 counterstained with DAPI (blue): (B) NPY-Cre::Ai14 and (C) NPY-Dre (NPY-Cre::Dlx5/6-Flp::Dre) (NPY immunofluorescence indicated in green); (D) NPY-Dre::Rbfox3+/+ and (E) NPY-Dre::Rbfox3rox/rox (RBFOX3 immunofluorescence indicated in green). Cells in red are positive for tdTomato. Boxed regions are enlarged on the right. Yellow arrows indicate cells with undesirable expression; white arrows indicate cells with expected or intersectional expression. Scale bars: 100 µm. (F,G) Bar graphs showing the ratio of RBFOX3+/tdTomato+ cells (F) and density of tdTomato+ cells (G) counted in hippocampal regions of NPY-Dre::Rbfox3rox/rox (KO) and their corresponding control (WT) mice. **P<0.01, ***P<0.001 (two-tailed Student's t-test, n=6 hippocampal sections/mice, 1 mouse/group). Data are mean+s.e.m.

Fig. 2.

Precise labelling of NPY-expressing GABAergic neurons and Rbfox3 deletion within given cell types in mouse hippocampus. (A) Left: Schematic of the diverse interneuron populations in the hippocampal dentate gyrus. GC, granule cell; GL, granule layer; ML, molecular layer; nNOS, neuronal nitric oxide synthase; PV, parvalbumin; SOM, somatostatin; VIP, vasoactive intestinal polypeptide. Right: Overlap of NPY-Cre and Dlx5/6-Flp indicates NPY-expressing GABAergic neurons. (B-E) Representative images of 40-µm-thick hippocampal sections from mice at postnatal day 49 counterstained with DAPI (blue): (B) NPY-Cre::Ai14 and (C) NPY-Dre (NPY-Cre::Dlx5/6-Flp::Dre) (NPY immunofluorescence indicated in green); (D) NPY-Dre::Rbfox3+/+ and (E) NPY-Dre::Rbfox3rox/rox (RBFOX3 immunofluorescence indicated in green). Cells in red are positive for tdTomato. Boxed regions are enlarged on the right. Yellow arrows indicate cells with undesirable expression; white arrows indicate cells with expected or intersectional expression. Scale bars: 100 µm. (F,G) Bar graphs showing the ratio of RBFOX3+/tdTomato+ cells (F) and density of tdTomato+ cells (G) counted in hippocampal regions of NPY-Dre::Rbfox3rox/rox (KO) and their corresponding control (WT) mice. **P<0.01, ***P<0.001 (two-tailed Student's t-test, n=6 hippocampal sections/mice, 1 mouse/group). Data are mean+s.e.m.

Validation of labelling of CR-expressing GABAergic neurons and precise deletion of Rbfox3 in brains from our engineered mice

Calretinin (CR; also known as calbindin 2, Calb2) is a calcium-binding protein that is highly expressed in the brain, particularly in adult cerebellum and frontal lobe (Yue et al., 2014). It is predominantly expressed in a subset of GABAergic neurons and transiently expressed in glutamatergic neurons during development (Camillo et al., 2014). Expression of Cr in the mouse CNS begins around embryonic day 11.5 (Yue et al., 2014). CR-Cre mice have undesirable expression of Cre recombinase in hippocampal dentate granule cells owing to transient expression in the early postmitotic stage of granule cell development (Brandt et al., 2003), which was demonstrated with immunostaining of the hippocampus from CR-Cre::Ai14 mice (Fig. 3B). Generation of CR-Dre (CR-Cre::Dlx5/6-Flp::Dre) mice successfully eliminated this problem of undesirable expression (Fig. 3C). Moreover, CR-Dre mice showed high labelling efficiency and specificity of tdTomato+ cells to CR-expressing GABAergic neurons (Fig. S6). Furthermore, successful deletion of Rbfox3 in CR-expressing GABAergic neurons was demonstrated in the hippocampus (Fig. 3D-F) and cortex (Fig. S7) of CR-Dre-Rbfox3rox/rox (CR-Cre::Dlx5/6-Flp::Dre::Rbfox3rox/rox) mice compared with their controls. CR is highly expressed in the excitatory mossy cells of ventral hippocampus (Fredes et al., 2021). Generation of CR-Dre (CR-Cre::Dlx5/6-Flp::Dre) mice successfully targeted CR-expressing GABAergic neurons of the ventral hippocampus (Fig. S8). In addition, successful deletion of Rbfox3 in CR-expressing GABAergic neurons of the ventral hippocampus was demonstrated in CR-Dre-Rbfox3rox/rox (CR-Cre::Dlx5/6-Flp::Dre::Rbfox3rox/rox) mice compared with their controls (Fig. S8B,C). Reduced density of tdTomato+ cells was observed in the hippocampus of CR-Dre-Rbfox3rox/rox mice compared with their controls (Fig. 3G). No cellular toxicity was observed in the hippocampus of CR-Dre mice using TUNEL assays (Fig. S5C).

Fig. 3.

Precise labelling of CR-expressing GABAergic neurons with Rbfox3 deletion in given cell types in mouse hippocampus. (A) Left: Schematic of the diverse interneuron populations in the hippocampal dentate gyrus. GC, granule cell; GL, granule layer; ML, molecular layer; nNOS, neuronal nitric oxide synthase; PV, parvalbumin; SOM, somatostatin; VIP, vasoactive intestinal polypeptide. Right: Overlap of CR-Cre and Dlx5/6-Flp indicates CR-expressing GABAergic neurons. (B-E) Representative images of 40-µm-thick hippocampal sections from mice at postnatal day 49 counterstained with DAPI (blue): (B) CR-Cre::Ai14 and (C) CR-Dre (CR-Cre::Dlx5/6-Flp::Dre) (immunostained for CR, green); (D) CR-Dre-Rbfox3+/+ and (E) CR-Dre-Rbfox3rox/rox (immunostained for RBFOX3, green). Cells in red are positive for tdTomato. Boxed regions are enlarged on the right. Yellow arrows indicate cells with undesirable expression; white arrows indicate cells with expected or intersectional expression. Scale bars: 100 µm. (F,G) Bar graphs showing the ratio of RBFOX3+/tdTomato+ cells (F) and density of tdTomato+ cells (G) counted in hippocampal regions of CR-Dre::Rbfox3rox/rox (KO) and their corresponding control (WT) mice. *P<0.05, **P<0.01 (two-tailed Student's t-test, or Mann–Whitney rank sum test, n=6 hippocampal sections/mice, 1 mouse/group). Data are mean+s.e.m.

Fig. 3.

Precise labelling of CR-expressing GABAergic neurons with Rbfox3 deletion in given cell types in mouse hippocampus. (A) Left: Schematic of the diverse interneuron populations in the hippocampal dentate gyrus. GC, granule cell; GL, granule layer; ML, molecular layer; nNOS, neuronal nitric oxide synthase; PV, parvalbumin; SOM, somatostatin; VIP, vasoactive intestinal polypeptide. Right: Overlap of CR-Cre and Dlx5/6-Flp indicates CR-expressing GABAergic neurons. (B-E) Representative images of 40-µm-thick hippocampal sections from mice at postnatal day 49 counterstained with DAPI (blue): (B) CR-Cre::Ai14 and (C) CR-Dre (CR-Cre::Dlx5/6-Flp::Dre) (immunostained for CR, green); (D) CR-Dre-Rbfox3+/+ and (E) CR-Dre-Rbfox3rox/rox (immunostained for RBFOX3, green). Cells in red are positive for tdTomato. Boxed regions are enlarged on the right. Yellow arrows indicate cells with undesirable expression; white arrows indicate cells with expected or intersectional expression. Scale bars: 100 µm. (F,G) Bar graphs showing the ratio of RBFOX3+/tdTomato+ cells (F) and density of tdTomato+ cells (G) counted in hippocampal regions of CR-Dre::Rbfox3rox/rox (KO) and their corresponding control (WT) mice. *P<0.05, **P<0.01 (two-tailed Student's t-test, or Mann–Whitney rank sum test, n=6 hippocampal sections/mice, 1 mouse/group). Data are mean+s.e.m.

Validation of labelling of CCK-expressing GABAergic neurons and precise deletion of Rbfox3 in brains from our engineered mice

Cholecystokinin (CCK) is one of the most abundant neuropeptides in the CNS and is particularly concentrated in the cerebral cortex, hippocampus, basal ganglia, hypothalamus and periaqueductal grey matter (Raiteri et al., 1993). Cck is expressed in GABAergic and glutamatergic neurons (Calvigioni et al., 2017; Deng et al., 2010; Whissell et al., 2015). Expression of Cck expression in mouse CNS begins around embryonic day 11.5 (Yue et al., 2014). CCK-Cre mice exhibit undesirable expression in hippocampal dentate granule cells and excitatory neurons (Taniguchi et al., 2011), as also shown in CCK-Cre::Ai14 mice immunostained for CCK (Fig. 4B). Generation of CCK-Dre (CCK-Cre::Dlx5/6-Flp::Dre) mice eliminated undesirable expression in the dentate granule cells (Fig. 4C). Moreover, CCK-Dre mice showed high labelling efficiency and specificity of tdTomato+ cells to CCK-expressing GABAergic neurons (Fig. S9). In addition, successful deletion of Rbfox3 in CCK-expressing GABAergic neurons was demonstrated in the hippocampus (Fig. 4D-F) and cortex (Fig. S10) of CCK-Dre-Rbfox3rox/rox (CCK-Cre::Dlx5/6-Flp::Dre::Rbfox3rox/rox) mice compared with their controls. Increased density of tdTomato+ cells was observed in the hippocampus of CCK-Dre-Rbfox3rox/rox mice compared with their controls (Fig. 4G). No cellular toxicity was observed in the hippocampus of CCK-Dre mice using TUNEL assays (Fig. S5D).

Fig. 4.

Precise labelling of CCK-expressing GABAergic neurons and Rbfox3 deletion within given cell types in mouse hippocampus. (A) Left: Schematic of the diverse interneuron populations in the hippocampal dentate gyrus. GC, granule cell; GL, granule layer; ML, molecular layer; nNOS, neuronal nitric oxide synthase; PV, parvalbumin; SOM, somatostatin; VIP, vasoactive intestinal polypeptide. Right: Overlap of CCK-Cre and Dlx5/6-Flp indicates CCK-expressing GABAergic neurons. (B-E) Representative images of 40-µm-thick hippocampal sections from mice at postnatal day 49 counterstained with DAPI (blue): (B) CCK-Cre::Ai14 and (C) CCK-Dre (CCK-Cre::Dlx5/6-Flp::Dre) (immunostained for CCK, green); (D) CCK-Dre-Rbfox3 +/+ and (E) CCK-Dre-Rbfox3rox/rox (immunostained for RBFOX3, green). Cells in red are positive for tdTomato. Boxed regions are enlarged on the right. Yellow arrows indicate cells with undesirable expression; white arrows indicate cells with expected or intersectional expression. Scale bars: 100 µm. (F,G) Bar graphs showing the ratio of RBFOX3+/tdTomato+ cells (F) and density of tdTomato+ cells (G) counted in hippocampal regions of CCK-Dre::Rbfox3rox/rox (KO) and their corresponding control (WT) mice. **P<0.01, ***P<0.001 (two-tailed Student's t-test, or Mann–Whitney rank sum test, n=6 hippocampal sections/mice, 1 mouse/group). Data are mean+s.e.m.

Fig. 4.

Precise labelling of CCK-expressing GABAergic neurons and Rbfox3 deletion within given cell types in mouse hippocampus. (A) Left: Schematic of the diverse interneuron populations in the hippocampal dentate gyrus. GC, granule cell; GL, granule layer; ML, molecular layer; nNOS, neuronal nitric oxide synthase; PV, parvalbumin; SOM, somatostatin; VIP, vasoactive intestinal polypeptide. Right: Overlap of CCK-Cre and Dlx5/6-Flp indicates CCK-expressing GABAergic neurons. (B-E) Representative images of 40-µm-thick hippocampal sections from mice at postnatal day 49 counterstained with DAPI (blue): (B) CCK-Cre::Ai14 and (C) CCK-Dre (CCK-Cre::Dlx5/6-Flp::Dre) (immunostained for CCK, green); (D) CCK-Dre-Rbfox3 +/+ and (E) CCK-Dre-Rbfox3rox/rox (immunostained for RBFOX3, green). Cells in red are positive for tdTomato. Boxed regions are enlarged on the right. Yellow arrows indicate cells with undesirable expression; white arrows indicate cells with expected or intersectional expression. Scale bars: 100 µm. (F,G) Bar graphs showing the ratio of RBFOX3+/tdTomato+ cells (F) and density of tdTomato+ cells (G) counted in hippocampal regions of CCK-Dre::Rbfox3rox/rox (KO) and their corresponding control (WT) mice. **P<0.01, ***P<0.001 (two-tailed Student's t-test, or Mann–Whitney rank sum test, n=6 hippocampal sections/mice, 1 mouse/group). Data are mean+s.e.m.

Currently, mice generated with an intersectional approach that allows for simultaneous labelling of cell type and deletion of a target gene within given cell types are unavailable commercially or from another research lab. To our knowledge, our lab is the first to use an intersectional approach for the generation of mice engineered with a target gene deleted in a cell type-specific manner in vivo. This approach eliminates the problem of undesirable expression and lack of precise cell type-specific markers in the brain that can occur with Cre mice. In addition, these mice also have had the target gene (Rbfox3) deleted within specific cell subtypes. Thus, the engineered mice described in this study provide innovative advantages for simultaneous cell type-specific labelling and genetic knockout in vivo.

An intersectional genetic approach was applied to cell labelling, ablation and lineage tracing, increasing our understanding of cell fate and heterogeneity. The enhanced precision of lineage tracing with an intersectional approach has been previously verified (He et al., 2017), and intersectional labelling has recently been applied in the field of neuroscience. Using an intersectional approach, cell fate over time was revealed in midbrain progenitor cells (Petese et al., 2022) and distinct subsets were identified in midbrain dopaminergic neurons (Tolve et al., 2021). An intersectional approach has also been used to examine subtypes of serotonin neurons in raphe nuclei (Ren et al., 2019) and subtype-specific organization of GABAergic neuronal inputs was revealed with a combination of intersectional labelling and rabies viral monosynaptic tracing (Yetman et al., 2019).

Second-order sensorimotor loops controlling vibrissa movements were identified with a combination of intersectional labelling, classical tracing and electrophysiological recordings (Bellavance et al., 2017). An intersectional approach has been used to identify a subpopulation of noradrenergic neurons (Plummer et al., 2015) as well as major classes and lineages of GABAergic neurons in cerebral cortex (He et al., 2016). An intersectional approach greatly improved the specificity and performance of neural sensors and effectors (Madisen et al., 2015). Labelling of heterogenous retinal ganglion cells was performed with an intersectional approach (Sajgo et al., 2014). Lineage tracing with an intersectional approach has also been applied to other fields, such as metabolism (Han et al., 2021). Our approach adds new value to this concept of intersectional genetic approach: simultaneous genetic knockout in additional to labelling of specific cell subtypes.

In the field of neurobiology, NPY-Cre, CR-Cre and CCK-Cre mice have been widely used for labelling NPY-, CR- and CCK-expressing GABAergic neurons in brain and manipulating their neuroactivity in vivo when investigating neural circuits. The use of an intersectional genetic approach to develop three engineered mice provides increased fidelity of cell type labelling, which is crucial in neurobiology research because of the heterogeneous cell types in brain. Furthermore, the ability to finely target cell types for gene deletion is another important issue in the field of neurobiology when there is a need to investigate the causal relationship between target genes and their corresponding functional readouts more definitively. Our intersectional Dre knock-in mice with Rbfox3rox/rox mice can resolve the problematic issues resulting from the use of Cre mice lines and has the potential to provide an alternative platform for other Cre mice lines.

There is a fourth SSR system, the Vika-vox system, which has recently been shown to have a high efficacy and specificity in mice (Karimova et al., 2018). In the future, adding the Vika-vox system could also be employed to facilitate more precise cell type-specific labelling and genome engineering in our mouse lines. It will also be important to develop more cell type-specific Flp, Dre and Vika mice for more combinatory choices in intersectional genetic approaches because the current mouse library is composed predominantly of cell type-specific Cre mice. Recently, a suite of new Dre mice was developed, which expands the ability to perform intersectional genetic targeting (Han et al., 2021). In short, reliable and diverse reporter mice would facilitate the best use and application of our Dre-rox mice in the future.

It would also be of interest for future studies to pursue functional comparisons between Cre Rbfox3 conditional knockout mice, Dre Rbfox3 conditional knockout mice and Rbfox3 conventional knockout mice at the molecular, cellular, circuitry and behavioural levels. Such comparisons would strengthen the value of our Dre mice.

There are some limitations and practicalities to consider with our approach. For example, generating customized rox mice for specific candidate genes and breeding mice carrying homozygous rox sites in addition to Cre, Flp and Dre sequences requires extra efforts that were time consuming, labour intensive and expensive. Moreover, our approach cannot be applied to cellular subtypes for which an overlap of more than two genetic markers is required for specificity. Because there are more choices from Cre driver mouse lines than for Flp driver mouse lines, it might be possible to generate new Flp driver mouse lines to fulfil specific needs.

Combined genetic and viral methods have been used to target specific cell types in mouse brain (He et al., 2016). Our Dre::Rbfox3rox/rox mice, which allow for cell type-specific labelling and genome editing, could be used in combination with adeno-associated virus (AAV)-carrying cell type-specific Cre and Flp to provide temporal and spatial resolution, respectively. Such application in the future would increase the feasibility, convenience and versatility of using our engineered mice.

Mice

Dre knock-in mice were generated by introducing a DreO cassette containing two STOP and tdTomato sequences into intron 1 of Gt(ROSA)26Sor (Fig. 1A) (Madisen et al., 2015). Specifically, the targeting vector containing sequences of left and right arms of ROSA26, two STOP, tdTomato, DreO, PGK-Neo and PGK-DTA was electroporated into embryonic stem cells (ESCs; C57BL/6N, JM8A3 strain) (Fig. S1). The original targeting vector was obtained from Addgene [Ai65(RCFL-tdT), #61577]. ESCs were cultured and positively selected by Neo and negatively selected by DTA. The target ESC clones were identified by Southern blot analysis (WT: 11.5 kb; targeted: 8.73 kb) (Fig. S1). One targeted ESC clone was microinjected into blastocysts (C57BL/6N strain) and transplanted into the uterus of pseudopregnant female mice. Three agouti chimeras were obtained; one was bred with B6 mice. Five out of 40 offspring (N1 generation) were agouti and their genotypes were verified with PCR using primers shown in Fig. 1A,B.

Rbfox3rox/rox mice were generated by introducing two rox sites into the upstream of exon 7 and the downstream of exon 9 of Rbfox3, respectively with a CRISPR/Cas9 approach (Fig. 1C). Specifically, 5′ rox ssODN and 3′ rox ssODN and their corresponding sgRNAs and Cas9 were sequentially electroporated into zygotes. Edited zygotes (C57BL/6J strain) were transplanted into the uterus of pseudopregnant female mice. Three males and two females out of 19 F0 founders were identified and verified by PCR and TA cloning (Fig. 1E,F). Cis/trans testing was performed by their N1 generation after mating founders with B6 mice. The length of the rox flanking region is 4140 bp. Rbfox3 5′ sgRNA: 5′-AGTTTCTGGGTTCTAGAACG-3′. Rbfox3 3′ sgRNA: 5′-AATGACCCACCACTGCACGG-3′. Rbfox3 5′rox ssODN-SpeI (sense): 5′-TAACAGAGCCCAAGTGTCAAGTTTCTGGGTTCTAGAACTAGTTAACTTTAAATAATGCCAATTATTTAAAGTTAACGAGGTAAAGGGTTCCCCTCCTCTCAGAACCTGCAGACAAGGGTCCTATA-3′. Rbfox3 3′rox ssODN-SpeI (antisense): 5′-AGCCCATCTCGGAGGATAAGGGCAGCTGGGATGTGGTTCATCCTCCCTCCGTAACTTTAAATAATTGGCATTATTTAAAGTTAACTAGTTGCAGTGGTGGGTCATTGTGTTGTTTACGGATGGCA-3′. Male NPY-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/+ mice were mated to female NPY-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/+ mice to obtain NPY-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/rox mice and corresponding controls. Male CR-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/+ mice were mated to female CR-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/+ mice to obtain CR-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/rox mice and corresponding controls. Male CCK-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/+ mice were mated to female CCK-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/+ mice to obtain CCK-Cre/+::Dlx5/6-Flp/+::Dre/+::Rbfox3rox/rox mice and corresponding controls. NPY-Cre mice (stock number 027851), and CR-Cre mice (stock number 010774) were purchased from The Jackson Laboratory. CCK-Cre mice (The Jackson Laboratory, stock number 012706) and Dlx5/6-Flp mice (The Jackson Laboratory, stock number 010815) were provided by the laboratory of C.-C.L. Mice were group-housed in ventilated cages, provided with food (PicoLab® Rodent Diet 20, 5053) and water ad libitum and maintained on a 12-h light/dark cycle (lights off at 20:00 h). The National Taiwan University College of Medicine and the College of Public Health Institutional Animal Care and Use Committee (IACUC) approved all procedures. Our animal facility has earned Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) accreditation. All experiments were performed in accordance with the approved guidelines.

Genotyping

PCR was run with SuperRed PCR Master Mix (TE-SR01, Biotools Co.) in a C1000 Touch Thermal Cycler (Bio-Rad). Detailed information regarding primer sequences, PCR product sizes and PCR cycling conditions are summarized in Table S1. To validate the 5′- and 3′-rox sites in Rbfox3rox/rox mice, the amplified PCR product was cloned with the TOPO TA cloning Kit (Invitrogen, 450071).

TUNEL assay

Cellular toxicity was examined with the Elabscience®One-step TUNEL In Situ Apoptosis Kit (Elabscience, E-CK-A320), according to the manufacturer's manual. Briefly, brain tissue was fixed in 4% paraformaldehyde and 40 µm coronal frozen sections were collected. Brain sections were treated with DNase I for a positive control. DAPI was used as a marker of cell nuclei. Fluorescent images were acquired using a Zeiss LSM 880 confocal microscope (Carl Zeiss).

Immunofluorescence staining

Mouse brains were perfused with 4% paraformaldehyde and sectioned coronally at a thickness of 40 µm from the hippocampus of postnatal day 49 mice. Details of immunofluorescence staining was conducted using methods previously described (Lin et al., 2016a; Wang et al., 2015). Information regarding primary and secondary antibodies are summarized in Table S2. In short, coronal sections were incubated with primary antibody at 4°C overnight, and then incubated with a corresponding secondary antibody and DAPI (1:50,000, Invitrogen, D-1306) for 2 h at room temperature. Images were acquired using a Zeiss LSM 880 confocal microscope (Carl Zeiss).

We thank the technical services provided by the ‘Transgenic Mouse Model Core Facility of the National Core Facility for Biopharmaceuticals, National Science and Technology Council, Taiwan’ and the ‘Gene Knockout Mouse Core Laboratory of the National Taiwan University Center of Genomic Medicine’ for generating Dre knock-in mice and Rbfox3rox/rox mice. We also thank the staff of the imaging core and the biomedical resource core at the First Core Labs, National Taiwan University College of Medicine, for technical assistance.

Author contributions

Conceptualization: H.-S.H.; Methodology: D.-F.H., H.-S.H.; Validation: D.-F.H., T.-Y.Y.; Investigation: H.-S.H.; Resources: C.-C.L.; Data curation: H.-S.H.; Writing - original draft: H.-S.H.; Supervision: H.-S.H.; Project administration: H.-S.H.; Funding acquisition: C.-W.L., C.-H.Y., H.-S.H.

Funding

This work was funded by the Ministry of Science and Technology (now the National Science and Technology Council), Taiwan (MOST 107-2628-B-002-004-MY3, MOST 110-2314-B-002−158 and MOST 111-2314-B-002−256-MY2 to H-S.H.; MOST 106-2314-B-002-125-MY3 to C-H.Y.; MOST 109-2314-B-002-066-MY3 to C-W.L.), and the National Health Research Institutes, Miaoli, Taiwan (Career Development Grant NHRI-EX103-10316NC and Innovative Research Grant NHRI-EX108-10802NI to H-S.H.).

Data availability

All relevant data can be found within the article and its supplementary information.

Anastassiadis
,
K.
,
Fu
,
J.
,
Patsch
,
C.
,
Hu
,
S.
,
Weidlich
,
S.
,
Duerschke
,
K.
,
Buchholz
,
F.
,
Edenhofer
,
F.
and
Stewart
,
A. F.
(
2009
).
Dre recombinase, like Cre, is a highly efficient site-specific recombinase in E. coli, mammalian cells and mice
.
Dis. Model. Mech.
2
,
508
-
515
.
Awatramani
,
R.
,
Soriano
,
P.
,
Rodriguez
,
C.
,
Mai
,
J. J.
and
Dymecki
,
S. M.
(
2003
).
Cryptic boundaries in roof plate and choroid plexus identified by intersectional gene activation
.
Nat. Genet.
35
,
70
-
75
.
Bellavance
,
M. A.
,
Takatoh
,
J.
,
Lu
,
J.
,
Demers
,
M.
,
Kleinfeld
,
D.
,
Wang
,
F.
and
Deschenes
,
M.
(
2017
).
Parallel inhibitory and excitatory trigemino-facial feedback circuitry for reflexive vibrissa movement
.
Neuron
95
,
722
-
723
.
Brandt
,
M. D.
,
Jessberger
,
S.
,
Steiner
,
B.
,
Kronenberg
,
G.
,
Reuter
,
K.
,
Bick-Sander
,
A.
,
Von Der Behrens
,
W.
and
Kempermann
,
G.
(
2003
).
Transient calretinin expression defines early postmitotic step of neuronal differentiation in adult hippocampal neurogenesis of mice
.
Mol. Cell. Neurosci.
24
,
603
-
613
.
Calvigioni
,
D.
,
Mate
,
Z.
,
Fuzik
,
J.
,
Girach
,
F.
,
Zhang
,
M. D.
,
Varro
,
A.
,
Beiersdorf
,
J.
,
Schwindling
,
C.
,
Yanagawa
,
Y.
,
Dockray
,
G. J.
et al. 
(
2017
).
Functional differentiation of cholecystokinin-containing interneurons destined for the cerebral cortex
.
Cereb. Cortex
27
,
2453
-
2468
.
Camillo
,
D.
,
Levelt
,
C. N.
and
Heimel
,
J. A.
(
2014
).
Lack of functional specialization of neurons in the mouse primary visual cortex that have expressed calretinin
.
Front. Neuroanat.
8
,
89
.
Danger
,
J. M.
,
Tonon
,
M. C.
,
Jenks
,
B. G.
,
Saint-Pierre
,
S.
,
Martel
,
J. C.
,
Fasolo
,
A.
,
Breton
,
B.
,
Quirion
,
R.
,
Pelletier
,
G.
and
Vaudry
,
H.
(
1990
).
Neuropeptide Y: localization in the central nervous system and neuroendocrine functions
.
Fundam. Clin. Pharmacol.
4
,
307
-
340
.
Darmanis
,
S.
,
Sloan
,
S. A.
,
Zhang
,
Y.
,
Enge
,
M.
,
Caneda
,
C.
,
Shuer
,
L. M.
,
Hayden Gephart
,
M. G.
,
Barres
,
B. A.
and
Quake
,
S. R.
(
2015
).
A survey of human brain transcriptome diversity at the single cell level
.
Proc. Natl. Acad. Sci. USA
112
,
7285
-
7290
.
Deng
,
P. Y.
,
Xiao
,
Z.
,
Jha
,
A.
,
Ramonet
,
D.
,
Matsui
,
T.
,
Leitges
,
M.
,
Shin
,
H. S.
,
Porter
,
J. E.
,
Geiger
,
J. D.
and
Lei
,
S.
(
2010
).
Cholecystokinin facilitates glutamate release by increasing the number of readily releasable vesicles and releasing probability
.
J. Neurosci.
30
,
5136
-
5148
.
Fredes
,
F.
,
Silva
,
M. A.
,
Koppensteiner
,
P.
,
Kobayashi
,
K.
,
Joesch
,
M.
and
Shigemoto
,
R.
(
2021
).
Ventro-dorsal hippocampal pathway gates novelty-induced contextual memory formation
.
Curr. Biol.
31
,
25
-
38.e5
.
Goswamee
,
P.
,
Leggett
,
E.
and
Mcquiston
,
A. R.
(
2021
).
Nucleus reuniens afferents in hippocampus modulate CA1 network function via monosynaptic excitation and polysynaptic inhibition
.
Front. Cell Neurosci.
15
,
660897
.
Han
,
X.
,
Zhang
,
Z.
,
He
,
L.
,
Zhu
,
H.
,
Li
,
Y.
,
Pu
,
W.
,
Han
,
M.
,
Zhao
,
H.
,
Liu
,
K.
,
Li
,
Y.
et al. 
(
2021
).
A suite of new Dre recombinase drivers markedly expands the ability to perform intersectional genetic targeting
.
Cell Stem Cell
28
,
1160
-
1176.e7
.
He
,
M.
,
Tucciarone
,
J.
,
Lee
,
S.
,
Nigro
,
M. J.
,
Kim
,
Y.
,
Levine
,
J. M.
,
Kelly
,
S. M.
,
Krugikov
,
I.
,
Wu
,
P.
,
Chen
,
Y.
et al. 
(
2016
).
Strategies and tools for combinatorial targeting of GABAergic neurons in mouse cerebral cortex
.
Neuron
92
,
555
.
He
,
L.
,
Li
,
Y.
,
Li
,
Y.
,
Pu
,
W.
,
Huang
,
X.
,
Tian
,
X.
,
Wang
,
Y.
,
Zhang
,
H.
,
Liu
,
Q.
,
Zhang
,
L.
et al. 
(
2017
).
Enhancing the precision of genetic lineage tracing using dual recombinases
.
Nat. Med.
23
,
1488
-
1498
.
Huang
,
D. F.
,
Lee
,
C. Y.
,
Chou
,
M. Y.
,
Yang
,
T. Y.
,
Cao
,
X.
,
Hsiao
,
Y. H.
,
Wu
,
R. N.
,
Lien
,
C. C.
,
Huang
,
Y. S.
,
Huang
,
H. P.
et al. 
(
2022
).
Neuronal splicing regulator RBFOX3 mediates seizures via regulating Vamp1 expression preferentially in NPY-expressing GABAergic neurons
.
Proc. Natl. Acad. Sci. USA
119
,
e2203632119
.
Jung
,
H.
,
Kim
,
S. W.
,
Kim
,
M.
,
Hong
,
J.
,
Yu
,
D.
,
Kim
,
J. H.
,
Lee
,
Y.
,
Kim
,
S.
,
Woo
,
D.
,
Shin
,
H. S.
et al. 
(
2019
).
Noninvasive optical activation of Flp recombinase for genetic manipulation in deep mouse brain regions
.
Nat. Commun.
10
,
314
.
Karimova
,
M.
,
Baker
,
O.
,
Camgoz
,
A.
,
Naumann
,
R.
,
Buchholz
,
F.
and
Anastassiadis
,
K.
(
2018
).
A single reporter mouse line for Vika, Flp, Dre, and Cre-recombination
.
Sci. Rep.
8
,
14453
.
Lee
,
H.
,
Graham
,
R. D.
,
Melikyan
,
D.
,
Smith
,
B.
,
Mirzakhalili
,
E.
,
Lempka
,
S. F.
and
Duan
,
B.
(
2022
).
Molecular determinants of mechanical itch sensitization in chronic itch
.
Front. Mol. Neurosci.
15
,
937890
.
Leshan
,
R. L.
,
Greenwald-Yarnell
,
M.
,
Patterson
,
C. M.
,
Gonzalez
,
I. E.
and
Myers
,
M. G.
, Jr.
(
2012
).
Leptin action through hypothalamic nitric oxide synthase-1-expressing neurons controls energy balance
.
Nat. Med.
18
,
820
-
823
.
Li
,
H.
,
Zhang
,
Q.
,
Gu
,
Y.
,
Wu
,
Y.
,
Wang
,
Y.
,
Wang
,
L.
,
Feng
,
S.
,
Hu
,
Y.
,
Zheng
,
Y.
,
Li
,
Y.
et al. 
(
2020
).
Efficient photoactivatable Dre recombinase for cell type-specific spatiotemporal control of genome engineering in the mouse
.
Proc. Natl. Acad. Sci. USA
117
,
33426
-
33435
.
Lin
,
C. Y.
,
Huang
,
S. C.
,
Tung
,
C. C.
,
Chou
,
C. H.
,
Gau
,
S. S.
and
Huang
,
H. S.
(
2016a
).
Analysis of genome-wide monoallelic expression patterns in three major cell types of mouse visual cortex using laser capture microdissection
.
PLoS One
11
,
e0163663
.
Lin
,
Y. S.
,
Wang
,
H. Y.
,
Huang
,
D. F.
,
Hsieh
,
P. F.
,
Lin
,
M. Y.
,
Chou
,
C. H.
,
Wu
,
I. J.
,
Huang
,
G. J.
,
Gau
,
S. S.
and
Huang
,
H. S.
(
2016b
).
Neuronal splicing regulator RBFOX3 (NeuN) regulates adult hippocampal neurogenesis and synaptogenesis
.
PLoS One
11
,
e0164164
.
Lin
,
Y. S.
,
Kuo
,
K. T.
,
Chen
,
S. K.
and
Huang
,
H. S.
(
2018
).
RBFOX3/NeuN is dispensable for visual function
.
PLoS One
13
,
e0192355
.
Liu
,
K.
,
Tang
,
M.
,
Jin
,
H.
,
Liu
,
Q.
,
He
,
L.
,
Zhu
,
H.
,
Liu
,
X.
,
Han
,
X.
,
Li
,
Y.
,
Zhang
,
L.
et al. 
(
2020
).
Triple-cell lineage tracing by a dual reporter on a single allele
.
J. Biol. Chem.
295
,
690
-
700
.
Madisen
,
L.
,
Garner
,
A. R.
,
Shimaoka
,
D.
,
Chuong
,
A. S.
,
Klapoetke
,
N. C.
,
Li
,
L.
,
Van Der Bourg
,
A.
,
Niino
,
Y.
,
Egolf
,
L.
,
Monetti
,
C.
et al. 
(
2015
).
Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance
.
Neuron
85
,
942
-
958
.
Milstein
,
A. D.
,
Bloss
,
E. B.
,
Apostolides
,
P. F.
,
Vaidya
,
S. P.
,
Dilly
,
G. A.
,
Zemelman
,
B. V.
and
Magee
,
J. C.
(
2015
).
Inhibitory Gating of Input Comparison in the CA1 Microcircuit
.
Neuron
87
,
1274
-
1289
.
Monory
,
K.
,
Massa
,
F.
,
Egertova
,
M.
,
Eder
,
M.
,
Blaudzun
,
H.
,
Westenbroek
,
R.
,
Kelsch
,
W.
,
Jacob
,
W.
,
Marsch
,
R.
,
Ekker
,
M.
et al. 
(
2006
).
The endocannabinoid system controls key epileptogenic circuits in the hippocampus
.
Neuron
51
,
455
-
466
.
Petese
,
A.
,
Fries
,
F. L.
,
Broske
,
B.
,
Stumm
,
R.
and
Blaess
,
S.
(
2022
).
Lineage analysis of Cxcr4-expressing cells in the developing midbrain suggests that progressive competence restriction in dopaminergic progenitor cells contributes to the establishment of dopaminergic neuronal diversity
.
eNeuro
9
,
ENEURO.0052-22.2022
.
Plummer
,
N. W.
,
Evsyukova
,
I. Y.
,
Robertson
,
S. D.
,
De Marchena
,
J.
,
Tucker
,
C. J.
and
Jensen
,
P.
(
2015
).
Expanding the power of recombinase-based labeling to uncover cellular diversity
.
Development
142
,
4385
-
4393
.
Raiteri
,
M.
,
Paudice
,
P.
and
Vallebuona
,
F.
(
1993
).
Release of cholecystokinin in the central nervous system
.
Neurochem. Int.
22
,
519
-
527
.
Ren
,
J.
,
Isakova
,
A.
,
Friedmann
,
D.
,
Zeng
,
J.
,
Grutzner
,
S. M.
,
Pun
,
A.
,
Zhao
,
G. Q.
,
Kolluru
,
S. S.
,
Wang
,
R.
,
Lin
,
R.
et al. 
(
2019
).
Single-cell transcriptomes and whole-brain projections of serotonin neurons in the mouse dorsal and median raphe nuclei
.
eLife
8
,
e49424
.
Sajgo
,
S.
,
Ghinia
,
M. G.
,
Shi
,
M.
,
Liu
,
P.
,
Dong
,
L.
,
Parmhans
,
N.
,
Popescu
,
O.
and
Badea
,
T. C.
(
2014
).
Dre - Cre sequential recombination provides new tools for retinal ganglion cell labeling and manipulation in mice
.
PLoS One
9
,
e91435
.
Silveira
,
M. A.
,
Anair
,
J. D.
,
Beebe
,
N. L.
,
Mirjalili
,
P.
,
Schofield
,
B. R.
and
Roberts
,
M. T.
(
2020
).
Neuropeptide Y expression defines a novel class of GABAergic projection neuron in the inferior colliculus
.
J. Neurosci.
40
,
4685
-
4699
.
Taniguchi
,
H.
,
He
,
M.
,
Wu
,
P.
,
Kim
,
S.
,
Paik
,
R.
,
Sugino
,
K.
,
Kvitsiani
,
D.
,
Fu
,
Y.
,
Lu
,
J.
,
Lin
,
Y.
et al. 
(
2011
).
A resource of Cre driver lines for genetic targeting of GABAergic neurons in cerebral cortex
.
Neuron
71
,
995
-
1013
.
Thorsell
,
A.
and
Ehlers
,
C. L.
(
2006
).
Neuropeptide Y in Brain Function
. In
Handbook of Neurochemistry and Molecular Neurobiology: Neuroactive Proteins and Peptides
(ed.
A.
Lajtha
and
R.
Lim
), pp.
523
-
543
.
Boston, MA
:
Springer US
.
Tokarska
,
A.
and
Silberberg
,
G.
(
2022
).
GABAergic interneurons expressing the alpha2 nicotinic receptor subunit are functionally integrated in the striatal microcircuit
.
Cell Rep.
39
,
110842
.
Tolve
,
M.
,
Ulusoy
,
A.
,
Patikas
,
N.
,
Islam
,
K. U. S.
,
Bodea
,
G. O.
,
Ozturk
,
E.
,
Broske
,
B.
,
Mentani
,
A.
,
Wagener
,
A.
,
Van Loo
,
K. M. J.
et al. 
(
2021
).
The transcription factor BCL11A defines distinct subsets of midbrain dopaminergic neurons
.
Cell Rep.
36
,
109697
.
Vinsland
,
E.
and
Linnarsson
,
S.
(
2022
).
Single-cell RNA-sequencing of mammalian brain development: insights and future directions
.
Development
149
,
dev200180
.
Wahlestedt
,
C.
,
Ekman
,
R.
and
Widerlov
,
E.
(
1989
).
Neuropeptide Y (NPY) and the central nervous system: distribution effects and possible relationship to neurological and psychiatric disorders
.
Prog. Neuropsychopharmacol. Biol. Psychiatry
13
,
31
-
54
.
Wang
,
H. Y.
,
Hsieh
,
P. F.
,
Huang
,
D. F.
,
Chin
,
P. S.
,
Chou
,
C. H.
,
Tung
,
C. C.
,
Chen
,
S. Y.
,
Lee
,
L. J.
,
Gau
,
S. S.
and
Huang
,
H. S.
(
2015
).
RBFOX3/NeuN is required for hippocampal circuit balance and function
.
Sci. Rep.
5
,
17383
.
Wettstein
,
J. G.
,
Earley
,
B.
and
Junien
,
J. L.
(
1995
).
Central nervous system pharmacology of neuropeptide Y
.
Pharmacol. Ther.
65
,
397
-
414
.
Whissell
,
P. D.
,
Cajanding
,
J. D.
,
Fogel
,
N.
and
Kim
,
J. C.
(
2015
).
Comparative density of CCK- and PV-GABA cells within the cortex and hippocampus
.
Front. Neuroanat.
9
,
124
.
Yetman
,
M. J.
,
Washburn
,
E.
,
Hyun
,
J. H.
,
Osakada
,
F.
,
Hayano
,
Y.
,
Zeng
,
H.
,
Callaway
,
E. M.
,
Kwon
,
H. B.
and
Taniguchi
,
H.
(
2019
).
Intersectional monosynaptic tracing for dissecting subtype-specific organization of GABAergic interneuron inputs
.
Nat. Neurosci.
22
,
492
-
502
.
Yue
,
F.
,
Cheng
,
Y.
,
Breschi
,
A.
,
Vierstra
,
J.
,
Wu
,
W.
,
Ryba
,
T.
,
Sandstrom
,
R.
,
Ma
,
Z.
,
Davis
,
C.
,
Pope
,
B. D.
et al. 
(
2014
).
A comparative encyclopedia of DNA elements in the mouse genome
.
Nature
515
,
355
-
364
.

Competing interests

The authors declare no competing or financial interests.

Supplementary information