Both hedgehog (Hh) and target of rapamycin complex 2 (TORC2) are central, evolutionarily conserved signaling pathways that regulate development and metabolism. In C. elegans, loss of the essential TORC2 component RICTOR (rict-1) causes delayed development, shortened lifespan, reduced brood, small size and increased fat. Here, we report that knockdown of both the hedgehog-related morphogen grd-1 and its patched-related receptor ptr-11 rescues delayed development in TORC2 loss-of-function mutants, and grd-1 and ptr-11 overexpression delays wild-type development to a similar level to that in TORC2 loss-of-function animals. These findings potentially indicate an unexpected role for grd-1 and ptr-11 in slowing developmental rate downstream of a nutrient-sensing pathway. Furthermore, we implicate the chronic stress transcription factor pqm-1 as a key transcriptional effector in this slowing of whole-organism growth by grd-1 and ptr-11. We propose that TORC2, grd-1 and ptr-11 may act linearly or converge on pqm-1 to delay organismal development.

Hedgehog (Hh) morphogens are highly conserved positive regulators of development found throughout vertebrates and invertebrates (Aspöck et al., 1999; Echelard et al., 1993; Nüsslein-Volhard and Wieschaus, 1980). Extensive study in organisms such as Drosophila melanogaster has revealed a canonical pathway wherein Hh proteins bind to Patched (Ptc) allowing shifts in gene expression via the Gli transcription factors (Ingham, 2022). However, these proteins remain relatively unexplored in the model organism Caenorhabditis elegans. In C. elegans, divergence from the canonical signaling pathway resulted in the loss of some Hh proteins, while expanding the Hh-related (Hh-r) and Patched-related (Ptr) protein families from only five members to over 80 members (Aspöck et al., 1999). Of these, only 14 have been mechanistically characterized and only two of these, wrt-10 and grl-21, are functionally associated with patched/patched-related receptors (Lin and Wang, 2017; Templeman et al., 2020). From molting to reproductive aging, all of the Hh-r proteins that have been studied serve important, non-redundant roles in C. elegans, e.g. Hh-r proteins such as qua-1 are indispensable for larval transition whereas others, such as wrt-10, govern aspects of healthspan downstream of conserved regulators such as CREB (Hao et al., 2006a,b; Templeman et al., 2020).

Activity of highly conserved, nutrient-sensing signaling pathways is integral to ensuring normal growth rate in C. elegans. For example, reduced target of rapamycin complex 2 (TORC2) signaling has pronounced effects on developmental rate (Jones et al., 2009; Soukas et al., 2009). Loss of function of the gene encoding the essential TORC2 subunit rictor extends time to adulthood at 20°C from 48 h to 72 h, reduces body size, lowers brood, increases fat and shortens lifespan (Jones et al., 2009; Soukas et al., 2009). This suggests that the kinase complex integrates nutritional signals to determine how the animal proceeds through development, via as yet uncharacterized pathways. Our previous work has shown that depletion of the essential dosage compensation complex (DCC) member dpy-21 downstream of the TORC2 effector kinase serum- and glucocorticoid-induced kinase 1 (SGK-1) was sufficient to rescue the delayed development, reduced brood and increased fat of rict-1 mutants – but not their reduced body size and shortened lifespan – via action of the histone methyltransferases SET-1 and SET-4 (Webster et al., 2013). However, the spectrum of effectors of TORC2 governance over developmental rate and healthy growth remains incompletely characterized.

In this study, we identify grd-1 and ptr-11 (hereafter, grd-1/ptr-11) as key components of a Hh-r to Ptr signaling relay that negatively regulates development downstream of TORC2. We find that, like many other Hh-r proteins, grd-1 expression is animated during molting transitions, and, surprisingly, grd-1 knockdown by RNAi leads to developmental acceleration in wild-type animals. Furthermore, grd-1 knockdown significantly rescues the slowed development of TORC2 mutants. We also identify ptr-11 as a likely recipient of grd-1 signaling. ptr-11 knockdown phenocopies the ability of grd-1 knockdown to accelerate growth in wild-type animals and to restore normal growth rate to TORC2 mutants. Importantly, augmented grd-1 expression is sufficient to delay development, and ptr-11 knockdown significantly rescues the delayed development of grd-1 overexpressor animals. Finally, we identify pqm-1 as a potential effector of the grd-1/ptr-11 signaling cascade. pqm-1 knockdown partially phenocopies grd-1/ptr-11 knockdown and pqm-1 target genes are upregulated in TORC2 loss-of-function mutants in a manner dependent upon both grd-1 and ptr-11. In aggregate, we propose that in the setting of a deficiency in TORC2 signaling, grd-1/ptr-11 may act downstream to upregulate pqm-1 activity and cause developmental delay in C. elegans.

Knockdown of the hedgehog-related morphogen grd-1 unexpectedly accelerates C. elegans development

Knockdown of Hh-r proteins in C. elegans has been reported to prompt developmental delay, arrest or defects (Cohen et al., 2021; Hao et al., 2006a,b; Zugasti et al., 2005). Aside from high-level examination of conserved domains and transcriptional analyses, the Groundhog (GRD) family is absent from previous investigations into Hh-r proteins (Aspöck et al., 1999; Bürglin, 1996; Hao et al., 2006a,b), therefore we sought to determine whether knockdown of these proteins affects worm development (Aspöck et al., 1999). We performed a small-scale screen of grd family RNAi on larval development to adulthood, as determined by the appearance of adult vulval morphology, finding that, although grd-7 knockdown does slow larval development, grd-1 knockdown accelerates development (Fig. 1A,B; Table S1 for tabular results and biological replicates). We confirmed that the Ahringer RNAi clone reduces grd-1 transcript levels by ∼90% and that an additional, non-overlapping, grd-1 RNAi clone we synthesized also accelerates development in wild-type animals (Fig. S1A,B).

Fig. 1.

Knockdown by RNAi of cyclically expressed grd-1 accelerates wild-type development. (A) Developmental screening of grd family members reveals that grd-1 RNAi uniquely and unexpectedly accelerates wild-type C. elegans development, as measured by the proportion of young adults (YAs) at 49 h (n=3, **P<0.05 by one-way ANOVA with two-stage Benjamini-Krieger-Yekutieli FDR-adjustment). Vector control=1.0. (B) Median developmental rate, assessed as time to adulthood, in wild-type animals is accelerated by ∼2 h on grd-1 RNAi (n≥100, ****P<0.0001 by Bonferroni corrected log-rank test). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Tabular data in biological triplicate can be found in Table S1. (C) Measurement of mRNA transcript levels for grd-1 and mlt-10 from 9 h to 39 h reveals that grd-1 is expressed cyclically with molting cycles. mlt-10 and grd-1 transcript levels were first normalized to act-1 mRNA levels and then compared with vector control at 9 h to determine fold change. Data are from three biological replicates. (D) grd-1p::GFP animals imaged from mid L3 to adult day 1 (AD1) show intestinal GFP expression that peaks at molting midpoints of 36 and 48 h, and is totally extinguished during day one of adulthood at 72 h (n>20, P<0.05 by one-way ANOVA with Dunnett's correction for multiple comparisons). Data are mean±s.e.m. (E) GO-term enrichment analysis of the top 100 genes contributing to principal component 1 (PC1) variance in RNA-sequencing of L3 animals following grd-1 knockdown shows strongest enrichment for cuticle-related genes and molting-associated factors (n=3, adjusted P<0.05, see Table S2 for differentially expressed genes and top 100 genes explaining PC1 variance).

Fig. 1.

Knockdown by RNAi of cyclically expressed grd-1 accelerates wild-type development. (A) Developmental screening of grd family members reveals that grd-1 RNAi uniquely and unexpectedly accelerates wild-type C. elegans development, as measured by the proportion of young adults (YAs) at 49 h (n=3, **P<0.05 by one-way ANOVA with two-stage Benjamini-Krieger-Yekutieli FDR-adjustment). Vector control=1.0. (B) Median developmental rate, assessed as time to adulthood, in wild-type animals is accelerated by ∼2 h on grd-1 RNAi (n≥100, ****P<0.0001 by Bonferroni corrected log-rank test). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Tabular data in biological triplicate can be found in Table S1. (C) Measurement of mRNA transcript levels for grd-1 and mlt-10 from 9 h to 39 h reveals that grd-1 is expressed cyclically with molting cycles. mlt-10 and grd-1 transcript levels were first normalized to act-1 mRNA levels and then compared with vector control at 9 h to determine fold change. Data are from three biological replicates. (D) grd-1p::GFP animals imaged from mid L3 to adult day 1 (AD1) show intestinal GFP expression that peaks at molting midpoints of 36 and 48 h, and is totally extinguished during day one of adulthood at 72 h (n>20, P<0.05 by one-way ANOVA with Dunnett's correction for multiple comparisons). Data are mean±s.e.m. (E) GO-term enrichment analysis of the top 100 genes contributing to principal component 1 (PC1) variance in RNA-sequencing of L3 animals following grd-1 knockdown shows strongest enrichment for cuticle-related genes and molting-associated factors (n=3, adjusted P<0.05, see Table S2 for differentially expressed genes and top 100 genes explaining PC1 variance).

Previous transcriptomic profiling of C. elegans development indicates cyclical expression of grd-1 mRNA (Hendriks et al., 2014). We confirm that grd-1 mRNA levels peak at molting, which is when peaks in mRNA encoding the cyclically expressed molting gene mlt-10 can be seen via qRT-PCR (Fig. 1C). A grd-1p::GFP promoter reporter confirms a significant increase in grd-1 expression during the L3/L4 molt and the L4/young adult (YA) molt that specifically occurs in the intestine (Fig. 1D). We also replicated previous reports of grd-1 expression in rectal epithelial cells (Aspöck et al., 1999) and further observe expression in other tissues, including head neurons, hypodermis, intestine and vulva (Fig. S1C). Only intestinal expression changes in intensity across developmental stages.

Having determined that grd-1 is necessary for normal developmental rate in wild-type animals and that it is cyclically expressed with molting, we performed an RNA-sequencing analysis of grd-1 RNAi versus vector at the L3 developmental stage in order to ascertain whether molting factors are relevant to the developmental acceleration caused by grd-1 knockdown. Indeed, the top 100 differentially expressed genes resulting from grd-1 knockdown are enriched for GO terms matching molting cycle and cuticle-related genes (Fig. 1E; Table S2).

C. elegans TORC2 mutant rict-1 is sensitized to grd-1 knockdown

Larval progression is gated by nutritional rheostats and heterochronic genes that tightly determine if and when the animal transitions from one larval stage to the next (Mata-Cabana et al., 2021; Moss, 2007). Based upon its developmental pattern of expression, we hypothesized that grd-1 may act downstream of major controllers of larval growth. Therefore, we assessed the effect of grd-1 RNAi on the development of several mutants in growth factor and/or nutrient sensing pathways, i.e. daf-2(e1370) (insulin-like receptor hypomorph), eat-2(ad465) (defective pharyngeal pumping which leads to caloric restriction), raga-1(ok386) (hypomorphic defects in mTOR complex 1 signaling), rsks-1(ok1255) (S6 Kinase) and rict-1(mg451) (mTOR complex 2 loss of function) (Fig. 2A-E; Table S1). As in wild type, grd-1 RNAi accelerates the L1 to YA development time of all the mutants by ∼2 h, except for rict-1 mutants, which matured ∼7 h faster (Fig. 2E). Moreover, the proportional acceleration in median time to adulthood is significantly greater in rict-1 mutants subjected to grd-1 RNAi relative to acceleration seen in wild type and other mutants assessed (Fig. 2F).

Fig. 2.

grd-1 knockdown disproportionately accelerates development in TORC2 mutant rict-1, in contrast to other nutrient-sensing pathways. (A-D) grd-1 RNAi accelerates daf-2(e1370), eat-2(ad465), raga-1(ok386) and rsks-1(ok1255) mutant developmental rates by ∼2 h, which is quantitatively comparable with wild type (n>50, *P<0.05, ***P<0.001, ****P<0.0001, by log-rank test). (E) grd-1 RNAi accelerates rict-1(mg451) mutant development by ∼7 h (Bonferroni P<0.0001 by log-rank test). (F) LogEC50 percentage difference in hypothetical midpoint times in transition to adulthood between the vector and grd-1 RNAi developmental curves for each mutant described in A-E shows that the difference between vector and grd-1 RNAi developmental curves for rict-1(mg451) mutants is significantly greater than for wild type and other mutants tested (n≥2, ****P<0.0001 by one-way ANOVA with Dunnett's correction for multiple comparisons). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Data are mean±s.e.m. Tabular data from a minimum of two biological replicates is shown in Table S1. For each replicate, assays were performed on plates seeded with the same grd-1 RNAi culture and all strains in each replicate were controlled against the same wild-type population, a representative of which is shown in Fig. 1B and summarized in Fig. 2F (wt bar). All control data are available in Table S1.

Fig. 2.

grd-1 knockdown disproportionately accelerates development in TORC2 mutant rict-1, in contrast to other nutrient-sensing pathways. (A-D) grd-1 RNAi accelerates daf-2(e1370), eat-2(ad465), raga-1(ok386) and rsks-1(ok1255) mutant developmental rates by ∼2 h, which is quantitatively comparable with wild type (n>50, *P<0.05, ***P<0.001, ****P<0.0001, by log-rank test). (E) grd-1 RNAi accelerates rict-1(mg451) mutant development by ∼7 h (Bonferroni P<0.0001 by log-rank test). (F) LogEC50 percentage difference in hypothetical midpoint times in transition to adulthood between the vector and grd-1 RNAi developmental curves for each mutant described in A-E shows that the difference between vector and grd-1 RNAi developmental curves for rict-1(mg451) mutants is significantly greater than for wild type and other mutants tested (n≥2, ****P<0.0001 by one-way ANOVA with Dunnett's correction for multiple comparisons). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Data are mean±s.e.m. Tabular data from a minimum of two biological replicates is shown in Table S1. For each replicate, assays were performed on plates seeded with the same grd-1 RNAi culture and all strains in each replicate were controlled against the same wild-type population, a representative of which is shown in Fig. 1B and summarized in Fig. 2F (wt bar). All control data are available in Table S1.

grd-1 knockdown rescues slowed growth in TORC2 pathway sgk-1 and sinh-1 loss-of-function mutants, and grd-1 overexpression is sufficient to slow growth

Previous work has identified the serine-threonine kinase SGK-1 as a major downstream effector of TORC2 in C. elegans and Saccharomyces cerevisiae (Aronova et al., 2008; Jones et al., 2009; Webster et al., 2013; Zhou et al., 2019). sgk-1 loss-of-function mutants phenocopy the slowed development, reduced brood, small body size and shortened lifespan of rict-1 mutants (Soukas et al., 2009; Webster et al., 2013; Zhou et al., 2019). We therefore tested whether grd-1 knockdown functions to accelerate rict-1 null development by increasing SGK-1 activity or by acting downstream of sgk-1. We find that sgk-1 null mutant development on grd-1 RNAi is accelerated by ∼7 h, similar to rict-1 mutants (Fig. 3A; Table S1). Further substantiating that grd-1 acts downstream of both rict-1 and sgk-1, grd-1 knockdown on a rict-1;sgk-1 double null mutant speeds up development by ∼7 h (Fig. 3B; Table S1). Slowed development caused by lowered TORC2 signaling in loss-of-function mutations in the essential TORC2 subunit sinh-1 (homolog of mTORC2 subunit mSin1) is similarly accelerated by grd-1 knockdown (Fig. 3C; Table S1). Finally, broader relevance of grd-1 to TORC2 biology is indicated by the fact that grd-1 RNAi also partially rescues the shortened lifespan, increased fat mass, small body size and reduced brood size of rict-1 mutants (Fig. S2A-D; Table S3) (Soukas et al., 2009).

Fig. 3.

grd-1 knockdown disproportionately accelerates development in multiple TORC2 signaling defective backgrounds and overexpression is sufficient to slow development. (A) Developmental rate of sgk-1(mg455) mutants is accelerated by ∼7 h by grd-1 RNAi (n>100, P<0.0001 by Bonferroni corrected log-rank test). (B) Developmental rate of rict-1(mg451);sgk-1(mg455) double mutants is accelerated by ∼7 h by grd-1 RNAi (n>50, P<0.0001 by Bonferroni corrected log-rank test). (C) Developmental rate of sinh-1(mg452) mutants is also accelerated by ∼7 h by grd-1 RNAi (n>50, P<0.0001 by Bonferroni corrected log-rank test). (D) grd-1 overexpression is sufficient to slow the developmental rate to a similar rate to the rict-1(mg451) mutant developmental rate (n>50, P<0.001 by Bonferroni corrected log-rank test). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Tabular data for biological triplicate analyses are shown in Table S1. The same wild-type controls are shown in B and C.

Fig. 3.

grd-1 knockdown disproportionately accelerates development in multiple TORC2 signaling defective backgrounds and overexpression is sufficient to slow development. (A) Developmental rate of sgk-1(mg455) mutants is accelerated by ∼7 h by grd-1 RNAi (n>100, P<0.0001 by Bonferroni corrected log-rank test). (B) Developmental rate of rict-1(mg451);sgk-1(mg455) double mutants is accelerated by ∼7 h by grd-1 RNAi (n>50, P<0.0001 by Bonferroni corrected log-rank test). (C) Developmental rate of sinh-1(mg452) mutants is also accelerated by ∼7 h by grd-1 RNAi (n>50, P<0.0001 by Bonferroni corrected log-rank test). (D) grd-1 overexpression is sufficient to slow the developmental rate to a similar rate to the rict-1(mg451) mutant developmental rate (n>50, P<0.001 by Bonferroni corrected log-rank test). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Tabular data for biological triplicate analyses are shown in Table S1. The same wild-type controls are shown in B and C.

If, as we hypothesize, grd-1 slows growth in response to inadequate TORC2/SGK signaling, increased grd-1 activity might be sufficient to slow development. In order to test this possibility, we generated transgenic C. elegans overexpressing grd-1 under the control of its native promoter. Indeed, grd-1 overexpression was sufficient to prompt slowing of developmental rate of wild-type animals to a degree similar to rict-1 mutants (Fig. 3D). We validated this result using CRISPR activation (CRISPRa) as an orthogonal method of increasing grd-1 expression; even a modest ∼2.5-fold increase in grd-1 transcript levels caused significant delay in wild-type C. elegans development (Fig. S3A,B). Although attempts were made at measuring GRD-1 protein levels via the overexpressor GFP fusion, we were unable to generate viable rict-1(mg451);grd-1::GFP and sgk-1(mg455);grd-1::GFP doubles, possibly owing to excessive GRD-1 activity from the combination of TORC2 loss of function in a GRD-1 overexpression background.

We have previously identified non-canonical activity of the dosage compensation complex (DCC) as being partially necessary for developmental delay downstream of TORC2 (Webster et al., 2013). This raised the possibility that grd-1 may be acting downstream of or in concert with the DCC. However, grd-1 transcript levels are unperturbed in both rict-1 mutants and DCC subunit dpy-21 RNAi-treated animals, suggesting that grd-1 is not transcriptionally regulated by either TORC2 or the DCC during larval development (Fig. S3C-E).

ptr-11 knockdown rescues development in TORC2 mutants and in grd-1 overexpressors

In order to probe for potential receptors acting downstream of grd-1, we performed a screen on the patched and patched-related receptor (ptc and ptr, respectively) gene families to identify phenocopiers of grd-1. Of the ptc and ptr family members tested, only ptr-11 RNAi accelerates development (Fig. 4A). Indeed, treatment of rict-1 mutants, rict-1;sgk-1 double mutants and sinh-1 mutants with ptr-11 RNAi produces quantitatively similar acceleration of growth rate as grd-1 RNAi (Fig. 4B,C, Fig. S4A; Table S1), suggesting that grd-1 and ptr-11 may function in a common genetic pathway downstream of TORC2/SGK-1 signaling. Consistent with this possibility, in slow-growing grd-1 overexpressors, ptr-11 RNAi accelerates development by ∼4 h compared with ∼1 h in wild-type animals, substantiating the notion that ptr-11 functions downstream of grd-1 (Fig. 4D; Table S1). Furthermore, similar to grd-1 overexpression, mild ∼1.7-fold induction of ptr-11 by CRISPRa causes developmental delay in wild-type worms (Fig. 4E,F).

Fig. 4.

ptr-11 operates downstream of grd-1 to negatively regulate growth and development. (A) Developmental screening of ptc/ptr family members reveals that ptr-11 RNAi accelerates wild-type C. elegans development (n=3, *P<0.05 by one-way ANOVA with two-stage Benjamini-Krieger-Yekutieli FDR-adjustment). Vector=1. (B) ptr-11 knockdown accelerates rict-1(mg451) development by ∼5 h (n>50, P<0.0001 by Bonferroni corrected log-rank test). (C) ptr-11 RNAi accelerates development of rict-1(mg451);sgk-1(mg455) mutants by ∼7 h (n>50, ****P<0.0001 by Bonferroni corrected log-rank test). (D) ptr-11 RNAi significantly rescues slowed development in grd-1 overexpression transgenics (grd-1oe, n>50, P<0.0001 by Bonferroni corrected log-rank test). (E) ptr-11 overexpression by CRISPRa delays development in wild-type worms (n=3, ****P<0.0001 by χ2 goodness of fit test). (F) ptr-11 overexpression by CRISPRa causes an ∼1.7-fold increase in ptr-11 expression, normalized to act-1 levels (n=3, *P<0.1 by Student's two-tailed t-test). Data are mean±s.e.m. Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Tabular data for biological triplicate analyses are shown in Table S1. The same wild-type vector control shown in B is also shown in C and Fig. S4A.

Fig. 4.

ptr-11 operates downstream of grd-1 to negatively regulate growth and development. (A) Developmental screening of ptc/ptr family members reveals that ptr-11 RNAi accelerates wild-type C. elegans development (n=3, *P<0.05 by one-way ANOVA with two-stage Benjamini-Krieger-Yekutieli FDR-adjustment). Vector=1. (B) ptr-11 knockdown accelerates rict-1(mg451) development by ∼5 h (n>50, P<0.0001 by Bonferroni corrected log-rank test). (C) ptr-11 RNAi accelerates development of rict-1(mg451);sgk-1(mg455) mutants by ∼7 h (n>50, ****P<0.0001 by Bonferroni corrected log-rank test). (D) ptr-11 RNAi significantly rescues slowed development in grd-1 overexpression transgenics (grd-1oe, n>50, P<0.0001 by Bonferroni corrected log-rank test). (E) ptr-11 overexpression by CRISPRa delays development in wild-type worms (n=3, ****P<0.0001 by χ2 goodness of fit test). (F) ptr-11 overexpression by CRISPRa causes an ∼1.7-fold increase in ptr-11 expression, normalized to act-1 levels (n=3, *P<0.1 by Student's two-tailed t-test). Data are mean±s.e.m. Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Tabular data for biological triplicate analyses are shown in Table S1. The same wild-type vector control shown in B is also shown in C and Fig. S4A.

Using an endogenously tagged ptr-11::GFP generated by CRISPR/Cas9 genome engineering, we observe ptr-11 expression in the hypodermis, head and tail neurons, dorsal and ventral nerve cords, and seam cells at both the L3 and L4 stages (Fig. S4B). As is the case for grd-1, previous transcriptomics analyses have shown that ptr-11 oscillates in expression throughout development (Hendriks et al., 2014), which we confirmed by qRT-PCR (Fig. S4C).

pqm-1 and its target genes are dysregulated in rict-1 mutants in a grd-1-dependent manner

In order to identify potential downstream effectors of grd-1/ptr-11 signaling, we returned to our RNA-sequencing results. Analysis of these data indicates that target genes of transcription factors PQM-1 and BLMP-1 are enriched after grd-1 knockdown (Fig. 5A; Table S2). Assessment of developmental rate of both wild-type and rict-1 animals with pqm-1 and blmp-1 RNAi indicates that only pqm-1 knockdown accelerates development (Fig. 5B; Fig. S5). From our RNA-sequencing data, we identified the six pqm-1 target genes that are most decreased by grd-1 knockdown and found that two of these, C49G7.7 and ugt-43, are upregulated in rict-1 loss-of-function mutants and confirmed to be downregulated by grd-1 RNAi by qRT-PCR (Fig. 5C). This suggests that PQM-1 activity is increased by TORC2 loss of function in a grd-1-dependent manner. In support of the conclusion that grd-1 drives PQM-1 activity, pqm-1 knockdown decreases ugt-43 expression in rict-1 mutants (Fig. 5D). These results indicate that PQM-1 targets are regulated in a TORC2-dependent manner during development.

Fig. 5.

Increased pqm-1 activity slows growth in rict-1 mutants in a grd-1- and ptr-11-dependent manner. (A) Analysis of the ratio of total modENCODE transcription factor-binding sites for differentially regulated transcripts in L3 animals after grd-1 knockdown reveals that PQM-1 and BLMP-1 are most positionally enriched (n=3, adjusted two-tailed binomial *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). (B) pqm-1 knockdown accelerates development of wild-type animals by ∼1 h and rict-1(mg451) mutant development by ∼4 h (n>100, ****P<0.0001 by Bonferroni corrected log-rank test). (C) Measuring transcript levels for six PQM-1 targets most downregulated by grd-1 RNAi reveals that both C49G7.7 and ugt-43 are upregulated in rict-1 animals at the L3 stage and significantly downregulated by grd-1 knockdown, normalized to act-1 levels (n=3, **P<0.01, ****P<0.0001, by two-way ANOVA with Tukey's correction for multiple comparisons). (D) pqm-1 knockdown significantly reduces ugt-43 mRNA transcript levels in rict-1(mg451) mutants, normalized to act-1 levels (n=3, *P<0.05, **P<0.01 by one-way ANOVA with Dunnett's correction for multiple comparisons). (E) pqm-1::GFP nuclear localization in the posterior intestine is significantly increased in rict-1(mg451) mutants relative to wild-type animals (n=10, three biological replicates, ****P<0.0001 by χ2 goodness of fit test). Representative images for weak, moderate and strong binning categories are shown (right). Scale bars: 70.7 µm. (F) ugt-43 mRNA transcript levels are increased in both rict-1(mg451) and grd-1oe animals in a ptr-11-dependent manner, i.e. reversed by ptr-11 RNAi, normalized to act-1 levels (n=3, *P<0.05, **P<0.01, ****P<0.0001, by one-way ANOVA with Dunnett's correction for multiple comparisons). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Tabular data are available for biological duplicate analyses in Table S1. Data are mean±s.e.m.

Fig. 5.

Increased pqm-1 activity slows growth in rict-1 mutants in a grd-1- and ptr-11-dependent manner. (A) Analysis of the ratio of total modENCODE transcription factor-binding sites for differentially regulated transcripts in L3 animals after grd-1 knockdown reveals that PQM-1 and BLMP-1 are most positionally enriched (n=3, adjusted two-tailed binomial *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). (B) pqm-1 knockdown accelerates development of wild-type animals by ∼1 h and rict-1(mg451) mutant development by ∼4 h (n>100, ****P<0.0001 by Bonferroni corrected log-rank test). (C) Measuring transcript levels for six PQM-1 targets most downregulated by grd-1 RNAi reveals that both C49G7.7 and ugt-43 are upregulated in rict-1 animals at the L3 stage and significantly downregulated by grd-1 knockdown, normalized to act-1 levels (n=3, **P<0.01, ****P<0.0001, by two-way ANOVA with Tukey's correction for multiple comparisons). (D) pqm-1 knockdown significantly reduces ugt-43 mRNA transcript levels in rict-1(mg451) mutants, normalized to act-1 levels (n=3, *P<0.05, **P<0.01 by one-way ANOVA with Dunnett's correction for multiple comparisons). (E) pqm-1::GFP nuclear localization in the posterior intestine is significantly increased in rict-1(mg451) mutants relative to wild-type animals (n=10, three biological replicates, ****P<0.0001 by χ2 goodness of fit test). Representative images for weak, moderate and strong binning categories are shown (right). Scale bars: 70.7 µm. (F) ugt-43 mRNA transcript levels are increased in both rict-1(mg451) and grd-1oe animals in a ptr-11-dependent manner, i.e. reversed by ptr-11 RNAi, normalized to act-1 levels (n=3, *P<0.05, **P<0.01, ****P<0.0001, by one-way ANOVA with Dunnett's correction for multiple comparisons). Dashed lines represent hypothetical midpoint times at which 50% of the population has reached young adulthood. Tabular data are available for biological duplicate analyses in Table S1. Data are mean±s.e.m.

To further elucidate a connection between rict-1 and pqm-1, we examined endogenously tagged pqm-1::GFP nuclear localization at the L3 stage in wild type, rict-1 loss of function mutants and grd-1 overexpressors (grd-1oe). PQM-1::GFP shows strong nuclear localization in both rict-1 mutants and grd-1oe animals compared with wild type (Fig. 5E). In support of a TORC2/GRD-1/PTR-11/PQM-1 signaling axis, increased PQM-1 activity read out as ugt-43 expression in rict-1 mutants and grd-1 overexpression transgenics is dependent upon ptr-11, as knockdown abrogates increased ugt-43 mRNA levels in both backgrounds (Fig. 5F).

Finally, we attempted to phenocopy grd-1, ptr-11 and pqm-1 RNAi with null alleles in these genes but were unable to recapitulate developmental rescue in rict-1(mg451) and grd-1oe animals (Fig. S6A-D). Furthermore, the pqm-1(ok485) allele does not phenocopy pqm-1 RNAi in decreasing high ugt-43 mRNA levels in rict-1(mg451) worms (Fig. S6E). However, we show that the non-overlapping grd-1 RNAi clone phenocopies the Ahringer grd-1 RNAi clone in rict-1(mg451) animals (Fig. S6F), and results with CRISPRa of grd-1 and ptr-11 are internally consistent with these genes that provoke developmental slowing (Fig. S3A,B, Fig. 4E,F).

Correctly integrating nutritional signals from the environment is paramount to ensuring optimal growth rate and development. Previous work by us and others indicates that TORC2 is crucial to the governance of growth, reproduction and lifespan, regulating these processes in a diet-dependent manner (Jones et al., 2009; Soukas et al., 2009). Defects in TORC2/SGK-1 signaling lead to slow growth, substantiating the important role of this complex in ensuring environmentally appropriate organismal growth. In this article, we propose that the grd-1/ptr-11 hedgehog signaling axis may act downstream or converge on downstream effectors of TORC2 signaling (Fig. 6). Based upon data presented here, we suggest that increased grd-1 activity signals through ptr-11 to slow growth by activating pqm-1 transcriptional responses. This work not only identifies a new cognate ligand-receptor pair of Hh-Ptr in grd-1/ptr-11 but is also the first indication that TORC2 may regulate Hh signaling to negatively affect whole-organism development, growth and metabolism. Although it remains a possibility that GRD-1 is regulated by a parallel mechanism and converges on downstream effectors of TORC2 signaling, our work suggests that GRD-1/PTR-11/PQM-1 signaling executes developmental slowing under reduced TORC2 signaling conditions (Fig. 6).

Fig. 6.

A schematic representation of the hypothesized role of the GRD-1/PTR-11/PQM-1 signaling relay that regulates larval growth rate. Although TORC2 signaling-deficient animals are sensitized to grd-1/ptr-11/pqm-1 knockdown, without a GRD-1 activity assay, it remains a possibility that GRD-1 is regulated by a parallel mechanism that may or may not be under direct TORC2 regulation. Created with BioRender.com.

Fig. 6.

A schematic representation of the hypothesized role of the GRD-1/PTR-11/PQM-1 signaling relay that regulates larval growth rate. Although TORC2 signaling-deficient animals are sensitized to grd-1/ptr-11/pqm-1 knockdown, without a GRD-1 activity assay, it remains a possibility that GRD-1 is regulated by a parallel mechanism that may or may not be under direct TORC2 regulation. Created with BioRender.com.

The study of developmental timing in C. elegans has most extensively explored heterochronic genes required for correct developmental event sequencing, such as lin-4, lin-14 and let-7 (Ambros and Horvitz, 1984; Ambros and Moss, 1994; Reinhart et al., 2000). By comparison, there have been fewer dissections of the specific mechanisms controlling developmental rate in C. elegans. Many such investigations have focused on pathways controlling developmental progression in the absence of food or certain nutrients, revealing crucial roles for IIS signaling, TORC1, lipid metabolism, the one-carbon cycle and micronutrients in dauer formation and larval arrest (Baugh and Sternberg, 2006; Galles et al., 2018; Long et al., 2002; Watson et al., 2014; Watts et al., 2018). However, our understanding of the role of TORC2 signaling in development remains largely incomplete, limited to the DCC, to a gut-neuronal axis linking TORC2 to TGF-β signaling, and to CDC-42 induced neuronal protrusions (Alan et al., 2013; O'Donnell et al., 2018; Webster et al., 2013). Here, our results indicate a mechanism by which the Hh-r morphogens grd-1 and ptr-11 may act downstream of TORC2 to control whole-organism development and growth. Although study of grd-1 and ptr-11 activity per se, is challenging, and given that neither grd-1 nor ptr-11 is obviously regulated at the RNA or protein level downstream of TORC2, we are still able to connect TORC2 inactivation to increased GRD-1 signaling by invoking the downstream activity of PQM-1. However, it remains an unanswered question whether TORC2 is specifically modifying GRD-1 activity or whether TORC2 downregulation produces a metabolic environment in which GRD-1 activity is increased. Disentangling these possibilities will require a robust GRD-1 activity assay. Both loss of TORC2 and grd-1 overexpression lead to increased PQM-1 activity, as measured both by increased nuclear localization of the transcription factor and increased PQM-1 target gene expression. These results suggest that, under conditions of lowered TORC2 signaling, activity of grd-1/ptr-11 is induced to slow development. Although we find that the effect of grd-1/ptr-11 knockdown acts downstream of the major TORC2 effector kinase SGK-1, it remains unclear how grd-1 activity is directly regulated. The lack of grd-1 transcriptional changes in rict-1 loss-of-function mutants suggests a post-transcriptional regulatory mechanism. Attempts to make an endogenously tagged mature GRD-1 protein were not successful and have proved challenging according previous reports (Aspöck et al., 1999), so additional work is needed to define the precise mechanisms of GRD-1 activation. Notably, our data do not show a transcriptional interaction between the DCC and grd-1, indicating that TORC2 may control development through these two arms in parallel or that grd-1/ptr-11 converge downstream of TORC2.

C. elegans has a much-expanded family of Hedgehog morphogens that are thought to share a common ancestor with other phyla (Aspöck et al., 1999). Furthermore, C. elegans possesses an expanded family of patched-related receptors but lacks several canonical hedgehog signaling components, such as smoothened and a truly orthologous Gli transcription factor (Zugasti et al., 2005). Hh-r morphogens and Ptr receptors have shared biological functions in controlling developmental progression, and have been shown to interact cell non-autonomously with one another as in the case of wrt-10/ptc-1 and grl-21/ptr-24 (Lin and Wang, 2017; Templeman et al., 2020).

Here, we provide only the third example of a Hh-r-Ptr pair that functions in tandem to regulate metabolism in C. elegans. Our findings complement previous reports indicating that Hh-r proteins control important parts of organismal homeostasis such as reproductive health downstream of CREB via wrt-10/ptr-2 signaling (Templeman et al., 2020). Based upon patterns of grd-1 promoter activity, we suggest that grd-1 is produced in the intestine in a cyclical fashion during molting and that, under conditions of lowered TORC2 signaling, grd-1 function is increased to put the brakes on development. When grd-1 levels are artificially increased by overexpressing the protein under its native promoter, worm development is slowed to near rict-1 null mutant levels. Given that the intestine is both the primary tissue where grd-1 is expressed and the principal tissue of action for TORC2 in regulation of growth and metabolism (Soukas et al., 2009), it seems plausible that TORC2 controls development by modulating grd-1 activity cell-autonomously in the intestine. Proof for this hypothesis will require a better understanding of precise events occurring downstream of GRD-1 activity. As it stands, it remains a possibility that a TORC2-deficient worm may have increased GRD-1 activity independently of direct TORC2 interaction. Like other Hh-r proteins, GRD-1 is predicted to be an extracellular protein, suggesting a cell non-autonomous role for the morphogen. We identify ptr-11 as the likely receptor for grd-1, given that its knockdown significantly restores developmental rate in TORC2 mutants and grd-1 overexpression transgenics. Our endogenous ptr-11::GFP fusion indicates cell surface expression in several tissues, including the hypodermis and seam cells, but not the intestine. Definitive determination of the respective sites of action of grd-1 and ptr-11 will require additional investigation, potentially through colocalization assays such as FRET or a yeast two hybrid system. In aggregate, these results suggest that TORC2 takes stock of growth environment status and, if conditions are favorable, grd-1 activity is tamped down. However, in response to unfavorable conditions, reduced TORC2/SGK-1 signaling directly or indirectly increases grd-1 activity, likely in the intestine, and grd-1 executes a program delaying organismal growth by relaying the signal of unfavorable conditions through ptr-11.

Moreover, we identify pqm-1 as a potential downstream effector of the grd-1/ptr-11 signaling relay. Globally, PQM-1 acts antagonistically to DAF-16 in IIS signaling mutants to regulate lifespan and development (Tepper et al., 2013). Additionally, PQM-1 has been previously shown to work downstream of TORC2 to mobilize fat from the intestine to the germline at the onset of adulthood (Dowen et al., 2016). Although pqm-1 loss-of-function mutations cause slight developmental delay (Tepper et al., 2013), larval knockdown by RNAi causes developmental acceleration that partially recapitulates grd-1/ptr-11 knockdown in both wild-type animals and TORC2 loss of function. Using both increased expression of the pqm-1 target gene ugt-43 and nuclear PQM-1::GFP localization as a barometer for increased pqm-1 activity in rict-1 and grd-1oe animals, we suggest that grd-1 is activated in rict-1 mutants, which in turn activates pqm-1 to effectuate growth delay in a ptr-11-dependent manner. That said, without a direct GRD-1 activity assay, it is possible that grd-1/ptr-11 are influencing pqm-1 in parallel with TORC2. Furthermore, we fail to recapitulate the RNAi data with putative loss-of-function alleles in grd-1, ptr-11 and pqm-1. It is possible, given reports of lethality from grd-1 null mutations, that pleiotropic roles of these genes prevent mutations from phenocopying post-embryonic inactivation by RNAi. Alternatively, compensation for chronic loss of these crucial factors mutes or negates changes seen with short-term inactivation, a possibility that we favor. In support of this theory, a non-Ahringer grd-1 RNAi clone phenocopies the Ahringer grd-1 RNAi clone in rict-1(mg451) worms. Taken with RNAi data from other members of the proposed pathway, as well as findings with CRISPRa, this implies that the phenotypes observed are unlikely to be RNAi artifacts. Conclusive proof will require an orthogonal conditional loss-of-function strategy that does not rely on protein degradation, given the extracellular and membrane-bound nature of GRD-1 and PTR-11, respectively. Overall, the data support the conclusion that a grd-1/ptr-11/pqm-1 relay governs growth rate, potentially downstream of TORC2. Defining whether TORC2 directly modulates grd-1 activity, definitive proof that grd-1/ptr-11 represent a ligand-receptor pair and how ptr-11 signaling increases pqm-1 activity will require further investigation.

In summary, we define a heretofore unappreciated coordination of the TORC2 and hedgehog pathways in a signaling axis that functions to put the brakes on development when reduced TORC2 signaling indicates unfavorable environmental conditions. Future work will focus on which aspects of the nutrient milieu are sensed by TORC2, how changes that prompt developmental slowing are communicated through the GRD-1/PTR-11/PQM-1 signaling relay, and whether those changes are communicated directly from TORC2 to GRD-1 or through an independent mechanism. Better understanding of this biology will provide information about how organisms govern growth rate through ancient and complex communication between diverse signaling networks.

Strains and maintenance

C. elegans animals were grown and maintained at 20°C on Nematode Growth Media (NGM) seeded with Escherichia coli OP50-1 as previously described (Soukas et al., 2009). The following strains were used: wild type N2 (Bristol), MGH266 rict-1(mg451), MGH300 sgk-1(mg455), CB1370 daf-2(e1370), DA465 eat-2(ad465), VC222 raga-1(ok386), MGH9 rsks-1(ok1255), MGH27 rict-1(mg451);sgk-1(mg455), MGH35 sinh-1(mg452), MGH629 alx88[ptr-11p::ptr-11::GFP::AID::3xFLAG], MGH531 alxIs41[grd-1p::grd-1::GFP::grd-1::grd-1 3'UTR], MIR249 risIs33[K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA+unc-119(+)], MGH563 alxEx127[grd-1p::GFP], SYS573 dev60[pqm-1p::GFP::pqm-1], MGH618 rict-1(mg451);dev60[pqm-1p::GFP::pqm-1], MGH634 alxIs41[grd-1p::grd-1::GFP::grd-1::grd-1 3'UTR];dev60[pqm-1p::GFP::pqm-1], MGH696 rict-1(mg451) II;grd-1(gk428716) X, MGH694 rict-1(mg451) II; ptr-11(gk489940) I, MGH627 rict-1(mg451) II;pqm-1(ok485) II and MGH695 alxIs41[grd-1p::grd-1::GFP::grd-1::grd-1 3'UTR myo-3p::mCherry];ptr-11(gk489940) I.

Animals were synchronized by hypochlorite bleach treatment of a population of gravid adults. Animals were collected in M9 medium, centrifuged at 3300 g for 1 min and resuspended in 6 ml 1.3% bleach, 250 mM NaOH for 1 min of vigorous shaking. Bleach solution exposure and the shaking step were repeated after one wash in M9. After the second bleach step, the pellet was resuspended in minimal M9 by gentle pipetting and washed in M9 four times. Eggs were resuspended in 12 ml M9 and the solution was left to rotate overnight for 23 h at 20°C.

RNA interference

RNA interference (RNAi) plates were prepared with standard NGM media mixed with 5 mM isopropyl-B-D-thiogalactopyranoside and 200 µg/ml carbenicillin. All RNAi clones (except for confirmatory clones, which were constructed to reduce concerns over off-target effects; cloning primers are shown below) were isolated from the genome wide E. coli HT115 Ahringer library (Horizon Discovery) and sequence verified before use. RNAi clones were obtained by seeding onto ampicillin/tetracycline treated Luria Broth (LB) plates. RNAi clones were grown overnight at 37°C with shaking for 18 h in LB with 200 µg/ml carbenicillin. Cultures were spun down at 3300 g for 15 min, pellets resuspended in one-tenth starting LB volume and dispensed onto RNAi plates no more than 48 h before adding worms. All assays not carried out on RNAi were performed on vector HT115 seeded plates. Cloning primers used to generate a unique grd-1 RNAi clone were: unique grd-1 RNAi clone F, GAAATAGATGCTGTGATGGAAG; unique grd-1 RNAi clone R, CGGTGTTCTTCCTATCTGTC.

Developmental timing assays

Synchronized L1 animals prepared as described above were dropped onto RNAi plates with vector RNAi control or RNAi directed against the gene of interest at 20°C. Time to adulthood was measuring by evaluating the appearance of the vulvar slit in hermaphrodite animals. Two or three biological replicates were performed for all conditions and data are available in Table S1.

Developmental screening was performed by evaluating the relative proportion of wild-type adults on treatment RNAi compared with vector RNAi at 49 h. Three biological replicates were pooled for analysis.

Brood size assay

Synchronized L1 animals were dropped onto RNAi plates with the appropriate RNAi clone. After having reached young adult (YA) stage, two hermaphrodites were transferred onto five plates with the corresponding RNAi clone for a total of ten adults per condition. Adults were transferred every day for 5 days. Brood was measured as the total amount of progeny on the plates after 3 days at 20°C.

Body fat mass measurement

At day one of adulthood, synchronous animals were collected in M9, washed once, centrifuged at 375 g for 1 min, and resuspended in 40% isopropanol for 3 min. Fixed worms were then stained with 3 µg/ml Nile Red in 40% isopropanol for 2 h. Animals were collected in M9 supplemented with 0.01% Triton-X100, mounted on glass slides and imaged in the GFP channel for 10 ms at 5× magnification (Pino et al., 2013). Body fat mass was measured as the fluorescence intensity relative to body area in pixels using ImageJ.

Body size measurement

Adult day one animals were mounted on 2% agarose pads in 2.5 mM levamisole and imaged by bright-field microscopy at 2.5×magnification. Body area in pixels was determined using ImageJ.

Longevity assay

Synchronous L1 animals were dropped onto the appropriate RNAi clones and allowed to grow to L4/YA stage. 40-60 worms were then transferred to four plates with the corresponding RNAi clone supplemented with 10-50 µM 5-fluorodeoxyuridine (FUDR) for a total of ∼200 adults per condition. Animals were scored as dead or alive by movement or response to gentle prodding every other day. Data were analyzed using OASIS2 software package (https://sbi.postech.ac.kr/oasis2/).

CRISPRa assay

Two grd-1 and ptr-11 guides were cloned into the L4440_BioBrick-sgRNA vector as previously described (Fischer et al., 2022). MIR249 [K03A1.5p::3xFLAG::SV40-NLS::dCas9::SV40-NLS::VP64::HA+unc-119(+)] worms were synchronized and assayed at 51 h for the ratio of L4s to YAs. Quantitative RT-PCR was performed to confirm an increase in grd-1 and ptr-11 transcript levels. Primers used to clone sgRNAs include: grd-1 guide 1 F, GTTCGGATTGAGTAGTGCAA; grd-1 guide 1 R, TTGCACTACTCAATCCGAAC; grd-1 guide 2 F, ACCGATTAGATCCAGGAAAG; grd-1 guide 2 R, CTTTCCTGGATCTAATCGGT; ptr-11 guide 1 F, TGTTTGGAAAAGGATTGAAG; ptr-11 guide 1 R, CTTCAATCCTTTTCCAAACA; ptr-11 guide 2 F, TGTATTGGGTAGGAGAGGGA; and ptr-11 guide 2 R, TCCCTCTCCTACCCAATACA.

Quantitative RT-PCR

Worms were collected in TRIzol Reagent (Invitrogen), flash frozen in liquid nitrogen and stored at −80°C before RNA isolation. Samples were lysed using metal beads and the Tissuelyser I system (Qiagen). RNA was isolated from lysate using Direct-zol RNA Miniprep kit (Zymo). cDNA samples were synthesized with the QuantiTect reverse transcription kit (Qiagen). Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was performed with the QuantiTect SYBR Green RT-PCR kit (Qiagen) in a Bio-Rad CFX96 RT-PCR thermocycler. Fold changes were determined via the 2−ΔΔCt method, as previously described (Livak and Schmittgen, 2001). All Ct counts were normalized to act-1 Ct counts. Primers used for qRT-PCR include: act-1 F, TGCTGATCGTATGCAGAAGG; act-1 R, TAGATCCTCCGATCCAGACG; mlt-10 F, GGCCTTGGCAGCCGTAAC; mlt-10 R, TAAGCTCCACGGATGAGGTC; grd-1 F, CCGCTCTGCTGATATAAACCACG; grd-1 R, TCATCGCAACATTCTACCGT; ptr-11 F, AGCCGCCTATCCGGTTTATT; ptr-11 R, GACACGGGTTTCATATCCAGC; C49G7.7 F, CGGAGATCGGGAAACCCTTT; C49G7.7 R, GGGCGGCAAGGAAAGTTAAA; F18E3.12 F, CAATTTCCACCACACCAGCC; F18E3.12 R, TGAGCGCAGTTGAAATCGTTG; ugt-43 F, AGTTACCGGTCATTCTCATTTAAAGTT; ugt-43 R, TGAGTGGTAAGAGAAGAGTCACA; C15B12.8 F, TTGTGACGATCCCAGGAAGC; C15B12.8 R, GTCCGGGGAGTTGGTGTATT; F33H12.7 F, TGGATTTTTGGAACACAAACGA; F33H12.7 R, CGCACCGGAAAGGTCTACTT; str-7 F, ACGCGTTTTTCGGTTTTATCCT; str-7 R, GAGGTGGAGGAACGTGTGAA.

Microscopy

All imaging, unless otherwise specified, was performed by mounting worms on 2% agarose pads in 2.5 mM levamisole using the Leica THUNDER Imager system. Imaging was performed within 5 min of sample preparation. Binning measurements were carried out with a minimum population of 10 worms per replicate. grd-1p::GFP activation was defined as intestinal expression.

Statistical analysis

All statistical analyses and representations were performed in either Prism 9 (Graphpad) or Bioconductor (R). LogEC50 for developmental curves was determined by fitting a variable slope sigmoidal dose-response curve to each curve. The difference between the vector and grd-1 RNAi curves was calculated using the percentage difference between the logEC50 of each curve.

RNA-sequencing analysis

L3 animals treated with empty vector (EV) control or grd-1 RNAi (grd-1) were collected in paired, biologically independent, triplicate experiments. RNA was collected and purified in the same way as described above for qRT-PCR. Total purified RNA samples were sent to Azenta (Genewiz) for quality control, library preparation and mRNA sequencing. Samples were first verified for RNA integrity scores greater than eight using an Agilent Tapestation 4200. Illumina library preparation was performed using polyA selection for mRNA species. Approximately 20 million paired-end, 150 bp reads were obtained per sample.

Read filtering and quasi-alignment were performed using custom UNIX/bash shell scripts on the Mass General Brigham ERISOne Scientific Computing Linux Cluster. Reads were analyzed for quality control using FastQC (www.bioinformatics.babraham.ac.uk/projects/fastqc/) and MultiQC (Ewels et al., 2016), and filtered for adapter contamination, truncated short reads or low-quality bases using BBDuk (Grigoriev et al., 2012). Trimmed cleaned reads were then quantified against the C. elegans reference transcriptome annotation (WBcel235, Ensembl Release 105) using Salmon, correcting for sequencing and GC content bias using the command parameters ‘--seqBias’ and ‘—gcBias’, respectively (Cunningham et al., 2022; Patro et al., 2017).

All statistical analysis and visualizations were performed using the R (www.r-project.org) Bioconductor (http://www.nature.com/nmeth/journal/v12/n2/abs/nmeth.3252.html) environment. Quasi-aligned transcript quantification files for each sample were collapsed into gene-level count matrices using R package tximport (Soneson et al., 2015), and paired differential expression was calculated using R package DESeq2 (Love et al., 2014) with a design formula of ‘∼Replicate+Treatment’, where ‘Replicate’ accounts for inter-replicate batch effect variation in the paired experimental samples. Genes were considered differentially expressed with a Benjamini-Hochberg False Discovery Rate (FDR) corrected P<0.05 and an absolute log2 transformed fold change of 1.5 (Benjamini and Hochberg, 1995).

The top 100 genes contributing to variation in principal component 1 (PC1 – explanatory for the divergence seen between EV and grd-1 RNAi) were extracted and assessed for Gene Ontology (GO) term pathway over-representation using R package clusterProfiler (Wu et al., 2021). To perform transcription factor target enrichment analyses, promoter sequences 1500 bases upstream and 500 bases downstream of the transcription start site of significantly upregulated and downregulated genes were extracted using R package TxDb.Celegans.UCSC.ens11.ensGene (https://bioconductor.org/packages/release/data/annotation/html/TxDb.Celegans.UCSC.ce11.ensGene.html). Transcription factor binding sites were retrieved from the modENCODE modMine v33 database (Contrino et al., 2012) and filtered for presence in the promoter sequences of the differentially expressed gene sets. Total binding-site ratios in both upregulated and downregulated genes were tallied (defined as the number of binding sites identified for a given transcription factor divided by all transcription factor binding sites identified) and visualized using Prism 9 (Graphpad). The significance of the enrichment in observed binding-site ratio versus expected ratio was calculated using a two-tailed exact binomial test with a 95% confidence level using R function binom_test() and FDR adjusted P values were obtained using R function p.adjust().

Figure construction

All figures were assembled using Adobe Illustrator, Prism 9 (Graphpad) and BioRender.

We thank Dr Christopher M. Webster, Dr Yuyao Zhang, Dr Sainan Li, Adebanjo Adedoja, Luke Murphy, Ashley Duke and Samuel Doernberg for their creative input. Core services were provided by NIH/NIDDK P30 DK135043 and NIH/NIDDK P30 DK040561. Some strains were provided by the CGC, which is funded by the NIH Office of Research Infrastructure Programs (P40OD010440) and by the National BioResource Project of Japan.

Author contributions

Conceptualization: S.W.E., A.A.S.; Methodology: S.W.E.; Validation: S.W.E.; Formal analysis: S.W.E., F.M.A., A.A.S.; Investigation: S.W.E., A.Y., F.M.A., J.F.R., Y.Z., L.C.; Writing - original draft: S.W.E., A.A.S.; Writing - review & editing: S.W.E., A.Y., F.M.A., A.A.S.; Visualization: S.W.E., F.M.A.; Supervision: A.A.S.; Funding acquisition: A.A.S.

Funding

This work was funded by the National Institutes of Health/National Institute on Aging (R01AG058256, R01AG69677 and R56AG078384 to A.A.S.) and a Weissman Family MGH Research Scholar Award (to A.A.S.). Deposited in PMC for release after 12 months.

Data availability

RNA-seq data have been deposited in GEO under accession number GSE211807.

Alan
,
J. K.
,
Struckhoff
,
E. C.
and
Lundquist
,
E. A.
(
2013
).
Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans
.
Small GTPases
4
,
208
-
220
.
Ambros
,
V.
and
Horvitz
,
H. R.
(
1984
).
Heterochronic mutants of the nematode Caenorhabditis elegans
.
Science
226
,
409
-
416
.
Ambros
,
V.
and
Moss
,
E. G.
(
1994
).
Heterochronic genes and the temporal control of C. elegans development
.
Trends Genet.
10
,
123
-
127
.
Aronova
,
S.
,
Wedaman
,
K.
,
Aronov
,
P. A.
,
Fontes
,
K.
,
Ramos
,
K.
,
Hammock
,
B. D.
and
Powers
,
T.
(
2008
).
Regulation of ceramide biosynthesis by TOR Complex 2
.
Cell Metab.
7
,
148
-
158
.
Aspöck
,
G.
,
Kagoshima
,
H.
,
Niklaus
,
G.
and
Bürglin
,
T. R.
(
1999
).
Caenorhabditis elegans has scores of hedgehogRelated genes: sequence and expression analysis
.
Genome Res.
9
,
909
-
923
.
Baugh
,
L. R.
and
Sternberg
,
P. W.
(
2006
).
DAF-16/FOXO regulates transcription of cki-1Cip/Kip and repression of lin-4 during C. elegans L1 Arrest
.
Curr. Biol.
16
,
780
-
785
.
Benjamini
,
Y.
and
Hochberg
,
Y.
(
1995
).
Controlling the false discovery rate: a practical and powerful approach to multiple testing
.
J. R. Stat. Soc. Ser. B (Methodol)
57
,
289
-
300
.
Bürglin
,
T. R.
(
1996
).
Warthog and Groundhog, novel families related to Hedgehog
.
Curr. Biol.
6
,
1047
-
1050
.
Cohen
,
J. D.
,
Cadena del Castillo
,
C. E.
,
Serra
,
N. D.
,
Kaech
,
A.
,
Spang
,
A.
and
Sundaram
,
M. V.
(
2021
).
The Caenorhabditis elegans Patched domain protein PTR-4 is required for proper organization of the precuticular apical extracellular matrix
.
Genetics
219
,
iyab132
.
Contrino
,
S.
,
Smith
,
R. N.
,
Butano
,
D.
,
Carr
,
A.
,
Hu
,
F.
,
Lyne
,
R.
,
Rutherford
,
K.
,
Kalderimis
,
A.
,
Sullivan
,
J.
,
Carbon
,
S.
et al. 
(
2012
).
modMine: flexible access to modENCODE data
.
Nucleic Acids Res.
40
,
D1082
-
D1088
.
Cunningham
,
F.
,
Allen
,
J. E.
,
Allen
,
J.
,
Alvarez-Jarreta
,
J.
,
Amode
,
M. R.
,
Armean
,
I. M.
,
Austine-Orimoloye
,
O.
,
Azov
,
A. G.
,
Barnes
,
I.
,
Bennett
,
R.
et al. 
(
2022
).
Ensembl 2022
.
Nucleic Acids Res.
50
,
D988
-
D995
.
Dowen
,
R. H.
,
Breen
,
P. C.
,
Tullius
,
T.
,
Conery
,
A. L.
and
Ruvkun
,
G.
(
2016
).
A microRNA program in the C. elegans hypodermis couples to intestinal mTORC2/PQM-1 signaling to modulate fat transport
.
Genes Dev.
30
,
1515
-
1528
.
Echelard
,
Y.
,
Epstein
,
D. J.
,
St-Jacques
,
B.
,
Shen
,
L.
,
Mohler
,
J.
,
Mcmahon
,
J. A.
and
Mcmahon
,
A. P.
(
1993
).
Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity
.
Cell
75
,
1417
-
1430
.
Ewels
,
P.
,
Magnusson
,
M.
,
Lundin
,
S.
and
Käller
,
M.
(
2016
).
MultiQC: summarize analysis results for multiple tools and samples in a single report
.
Bioinformatics
32
,
3047
-
3048
.
Fischer
,
F.
,
Benner
,
C.
,
Goyala
,
A.
,
Grigolon
,
G.
,
Vitiello
,
D.
,
Wu
,
J.
,
Zarse
,
K.
,
Ewald
,
C. Y.
and
Ristow
,
M.
(
2022
).
Ingestion of single guide RNAs induces gene overexpression and extends lifespan in Caenorhabditis elegans via CRISPR activation
.
J. Biol. Chem.
298
,
102085
.
Galles
,
C.
,
Prez
,
G. M.
,
Penkov
,
S.
,
Boland
,
S.
,
Porta
,
E. O. J.
,
Altabe
,
S. G.
,
Labadie
,
G. R.
,
Schmidt
,
U.
,
Knölker
,
H.-J.
,
Kurzchalia
,
T. V.
et al. 
(
2018
).
Endocannabinoids in Caenorhabditis elegans are essential for the mobilization of cholesterol from internal reserves
.
Sci. Rep.
8
,
6398
.
Grigoriev
,
I. V.
,
Nordberg
,
H.
,
Shabalov
,
I.
,
Aerts
,
A.
,
Cantor
,
M.
,
Goodstein
,
D.
,
Kuo
,
A.
,
Minovitsky
,
S.
,
Nikitin
,
R.
,
Ohm
,
R. A.
et al. 
(
2012
).
The Genome Portal of the Department of Energy Joint Genome Institute
.
Nucleic Acids Res.
40
,
D26
-
D32
.
Hao
,
L.
,
Johnsen
,
R.
,
Lauter
,
G.
,
Baillie
,
D.
and
Bürglin
,
T. R.
(
2006a
).
Comprehensive analysis of gene expression patterns of hedgehog-related genes
.
BMC Genomics
7
,
280
.
Hao
,
L.
,
Mukherjee
,
K.
,
Liegeois
,
S.
,
Baillie
,
D.
,
Labouesse
,
M.
and
Bürglin
,
T. R.
(
2006b
).
The hedgehog-related gene qua-1 is required for molting in Caenorhabditis elegans
.
Dev. Dyn.
235
,
1469
-
1481
.
Hendriks
,
G.-J.
,
Gaidatzis
,
D.
,
Aeschimann
,
F.
and
Großhans
,
H.
(
2014
).
Extensive oscillatory gene expression during C. elegans larval development
.
Mol. Cell
53
,
380
-
392
.
Ingham
,
P. W.
(
2022
).
Chapter one - Hedgehog signaling
.
Curr. Top. Dev. Biol.
149
,
1
-
58
.
Jones
,
K. T.
,
Greer
,
E. R.
,
Pearce
,
D.
and
Ashrafi
,
K.
(
2009
).
Rictor/TORC2 Regulates Caenorhabditis elegans Fat Storage, Body Size, and Development through sgk-1
.
PLoS Biol.
7
,
e1000060
.
Lin
,
C.-C. J.
and
Wang
,
M. C.
(
2017
).
Microbial metabolites regulate host lipid metabolism through NR5A–Hedgehog signalling
.
Nat. Cell Biol.
19
,
550
-
557
.
Livak
,
K. J.
and
Schmittgen
,
T. D.
(
2001
).
Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method
.
Methods
25
,
402
-
408
.
Long
,
X.
,
Spycher
,
C.
,
Han
,
Z. S.
,
Rose
,
A. M.
,
Müller
,
F.
and
Avruch
,
J.
(
2002
).
TOR deficiency in C. elegans causes developmental arrest and intestinal atrophy by inhibition of mRNA TRANSLATION
.
Curr. Biol.
12
,
1448
-
1461
.
Love
,
M. I.
,
Huber
,
W.
and
Anders
,
S.
(
2014
).
Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2
.
Genome Biol.
15
,
550
.
Mata-Cabana
,
A.
,
Perez-Nieto
,
C.
and
Olmedo
,
M.
(
2021
).
Nutritional control of postembryonic development progression and arrest in Caenorhabditis elegans
.
Adv. Genet.
107
,
33
-
87
.
Moss
,
E. G.
(
2007
).
Heterochronic genes and the nature of developmental time
.
Curr. Biol.
17
,
R425
-
R434
.
Nüsslein-Volhard
,
C.
and
Wieschaus
,
E.
(
1980
).
Mutations affecting segment number and polarity in Drosophila
.
Nature
287
,
795
-
801
.
O'Donnell
,
M. P.
,
Chao
,
P.-H.
,
Kammenga
,
J. E.
and
Sengupta
,
P.
(
2018
).
Rictor/TORC2 mediates gut-to-brain signaling in the regulation of phenotypic plasticity in C. elegans
.
PLoS Genet.
14
,
e1007213
.
Patro
,
R.
,
Duggal
,
G.
,
Love
,
M. I.
,
Irizarry
,
R. A.
and
Kingsford
,
C.
(
2017
).
Salmon provides fast and bias-aware quantification of transcript expression
.
Nat. Methods
14
,
417
-
419
.
Pino
,
E. C.
,
Webster
,
C. M.
,
Carr
,
C. E.
and
Soukas
,
A. A.
(
2013
).
Biochemical and high throughput microscopic assessment of fat mass in Caenorhabditis Elegans
.
J. Vis. Exp.
73
,
e50180
.
Reinhart
,
B. J.
,
Slack
,
F. J.
,
Basson
,
M.
,
Pasquinelli
,
A. E.
,
Bettinger
,
J. C.
,
Rougvie
,
A. E.
,
Horvitz
,
H. R.
and
Ruvkun
,
G.
(
2000
).
The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans
.
Nature
403
,
901
-
906
.
Soneson
,
C.
,
Love
,
M.
and
Robinson
,
M.
(
2015
).
Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences [version 1; peer review: 2 approved]
.
F1000Res.
4
,
1521
.
Soukas
,
A. A.
,
Kane
,
E. A.
,
Carr
,
C. E.
,
Melo
,
J. A.
and
Ruvkun
,
G.
(
2009
).
Rictor/TORC2 regulates fat metabolism, feeding, growth, and life span in Caenorhabditis elegans
.
Genes Dev.
23
,
496
-
511
.
Templeman
,
N. M.
,
Cota
,
V.
,
Keyes
,
W.
,
Kaletsky
,
R.
and
Murphy
,
C. T.
(
2020
).
CREB Non-autonomously controls reproductive aging through Hedgehog/Patched signaling
.
Dev. Cell
54
,
92
-
105.e5
.
Tepper
,
R. G.
,
Ashraf
,
J.
,
Kaletsky
,
R.
,
Kleemann
,
G.
,
Murphy
,
C. T.
and
Bussemaker
,
H. J.
(
2013
).
PQM-1 complements DAF-16 as a key transcriptional regulator of DAF-2-mediated development and longevity
.
Cell
154
,
676
-
690
.
Watson
,
E.
,
MacNeil
,
L. T.
,
Ritter
,
A. D.
,
Yilmaz
,
L. S.
,
Rosebrock
,
A. P.
,
Caudy
,
A. A.
and
Walhout
,
A. J. M.
(
2014
).
Interspecies systems biology uncovers metabolites affecting C.elegans gene expression and life history traits
.
Cell
156
,
759
-
770
.
Watts
,
J. S.
,
Morton
,
D. G.
,
Kemphues
,
K. J.
and
Watts
,
J. L.
(
2018
).
The biotin-ligating protein BPL-1 is critical for lipid biosynthesis and polarization of the Caenorhabditis elegans embryo
.
J. Biol. Chem.
293
,
610
-
622
.
Webster
,
C. M.
,
Wu
,
L.
,
Douglas
,
D.
and
Soukas
,
A. A.
(
2013
).
A non-canonical role for the C. elegans dosage compensation complex in growth and metabolic regulation downstream of TOR complex 2
.
Development
140
,
3601
-
3612
.
Wu
,
T.
,
Hu
,
E.
,
Xu
,
S.
,
Chen
,
M.
,
Guo
,
P.
,
Dai
,
Z.
,
Feng
,
T.
,
Zhou
,
L.
,
Tang
,
W.
,
Zhan
,
L.
et al. 
(
2021
).
clusterProfiler 4.0: a universal enrichment tool for interpreting omics data
.
Innovation
2
,
100141
.
Zhou
,
B.
,
Kreuzer
,
J.
,
Kumsta
,
C.
,
Wu
,
L.
,
Kamer
,
K. J.
,
Cedillo
,
L.
,
Zhang
,
Y.
,
Li
,
S.
,
Kacergis
,
M. C.
,
Webster
,
C. M.
et al. 
(
2019
).
Mitochondrial permeability uncouples elevated autophagy and lifespan extension
.
Cell
177
,
299
-
314.e16
.
Zugasti
,
O.
,
Rajan
,
J.
and
Kuwabara
,
P. E.
(
2005
).
The function and expansion of the Patched- and Hedgehog-related homologs in C. elegans
.
Genome Res.
15
,
1402
-
1410
.

Competing interests

The authors declare no competing or financial interests.