Evolutionarily conserved insulin/insulin-like growth factor (IGF) signaling (IIS) correlates nutrient levels to metabolism and growth, thereby playing crucial roles in development and adult fitness. In the fruit fly Drosophila, ImpL2, an ortholog of IGFBP7, binds to and inhibits the function of Drosophila insulin-like peptides. In this study, we isolated a temperature-sensitive mutation in the insulin receptor (InR) gene as a spontaneous revertant in ImpL2 null mutants. The p.Y902C missense mutation is located at the functionally conserved amino acid residue of the first fibronectin type III domain of InR. The hypomorphic InR mutant animals showed a temperature-dependent reduction in IIS and body size. The mutant animals also exhibited metabolic defects, such as increased triglyceride and carbohydrate levels. Metabolomic analysis further revealed that defects in InR caused dysregulation of amino acid and ribonucleotide metabolism. We also observed that InR mutant females produced tiny irregular-shaped embryos with reduced fecundity. In summary, this novel allele of InR is a valuable tool for the Drosophila genetic model of insulin resistance and type 2 diabetes.

The insulin/insulin-like growth factor (IGF) signaling (IIS) pathway is a key regulator of cellular growth and metabolism throughout the life cycle of several organisms. Dysregulation of IIS is linked to many human diseases including diabetes mellitus and cancer (Gallagher and LeRoith, 2020; Saltiel and Kahn, 2001). In addition, IIS regulates a wide variety of physiological phenomena including reproduction, aging, sleep and memory formation (Belfiore et al., 2017; Fontana et al., 2010; Nässel and Zandawala, 2020; Piper and Partridge, 2018; Tatar, 2021; Templeman and Murphy, 2018). The insulin receptor is a disulfide-linked (αβ)2 homodimer that consists of an extracellular ligand-binding α subunit and the membrane-spanning β subunit, which harbors the intracellular kinase domain (Belfiore et al., 2017). Binding of insulin to the extracellular region induces conformational changes, leading to an elevation of intrinsic tyrosine kinase signaling.

The functions and components of IIS are remarkably conserved in invertebrates, including in the fruit fly Drosophila (Teleman, 2010; Wu and Brown, 2006). Impairment of IIS in Drosophila causes growth and metabolic defects, including elevation of circulating carbohydrates, as observed in mammals (Chatterjee and Perrimon, 2021; Hietakangas and Cohen, 2009; Mattila and Hietakangas, 2017; Texada et al., 2020). Drosophila insulin-like peptides (Ilps), mainly derived from brain insulin-producing cells (IPCs), act as systemic ligands that stimulate insulin receptor (InR) in the peripheral tissues (Ikeya et al., 2002; Rulifson et al., 2002). The cellular components of the Drosophila IIS include the IRS homolog Chico, phosphoinositide 3-kinase (PI3K), the phosphatase PTEN, and the serine/threonine protein kinase Akt (also known as PKB). The domain structures in Drosophila InR highly correspond with those in the human insulin receptor (hInsR) and IGF1 receptor (hIGF1R) (Fernandez et al., 1995). Importantly, mammalian insulin binds to Drosophila InR and induces PI3K-Akt signaling, as revealed in ex vivo culture experiments (Musselman et al., 2011; Pasco and Léopold, 2012). In contrast, recombinant Ilp5 binds to and activates mammalian InsR (Sajid et al., 2011), further indicating the evolutionary conservation of ligand-receptor interactions.

Nutritional signals tightly regulate the production and secretion of Ilps in IPCs through systemic factors derived from the fat body, an organ equivalent to the mammalian liver and adipocyte (Droujinine and Perrimon, 2016; Koyama et al., 2020; Meschi and Delanoue, 2021). Moreover, the function of circulating Ilps is regulated by their binding proteins, ImpL2 and the decoy receptor SDR (Honegger et al., 2008; Okamoto et al., 2013). IIS, in turn, regulates the metabolism and storage of ingested fuels in the fat body to ensure appropriate growth of the organisms (Britton et al., 2002). As increased IIS activity continues to maintain anabolic pathways, thereby limiting the amounts of circulating nutrients, the lack of either ImpL2 or SDR causes lethality under unfavorable nutritional conditions. Thus, proper regulation of the IIS is crucial for adaptation to nutrient fluctuations.

Drosophila genetics has provided powerful approaches to unravel the normal functions of gene products in development and physiology. In addition to null alleles that completely lack the protein function, missense mutations that partially lack protein function are also informative, particularly for modeling congenital diseases in humans. In this study, we identified a novel temperature-sensitive point mutation in InR as a spontaneous revertant that suppresses constitutive elevation of IIS.

Isolation of a p.Y902C missense mutation in Drosophila InR

The secreted protein ImpL2 is an antagonist of Ilps and its mutation results in an increase in peripheral IIS and promotes body growth (Fig. 1A) (Honegger et al., 2008). Consistently, homozygous ImpL2Def20 and transheterozygous ImpL2Def20 mutations over deficiency lines led to large-sized adults in both males and females (Fig. 1B; Fig. S1A). Unexpectedly, however, we found that homozygous ImpL2Def42 mutants led to small-sized adults, whereas transheterozygotes of ImpL2Def42 over deficiency led to large-sized adults, suggesting that second site mutation(s) mask the ImpL2Def42 mutant phenotype regarding body growth. Because ImpL2 inhibits the function of Ilps, we speculated that second site mutation(s) might be involved in IIS on the same chromosome. We found that transheterozygotes of ImpL2Def42 with two InR mutants, InR05545 and InR93dj4, but not Akt mutants, showed severe growth defects (Fig. 1C; Fig. S1B), suggesting that a second site mutation is located in the InR gene locus. Given that both ImpL2Def20 and ImpL2Def42 mutants were generated by imprecise excision of the same P-element (Honegger et al., 2008), we compared the entire coding sequence of the InR gene between the ImpL2Def20 and ImpL2Def42 alleles and found that the ImpL2Def42 mutants, but not the ImpL2Def20 mutants, retained a missense mutation c.2705A>G (p.Tyr902Cys) (Fig. 1D; Table S1). Tyr902 is in the C-terminal end of the first fibronectin type III domain (FnIII-1) in the InR extracellular region. This amino acid residue is not perfectly identical but functionally conserved through evolution (Fig. 1E), suggesting that this residue is vital for InR function. Homozygotes in backcrossed lines, which harbor the Y902C missense mutation but not the deletion in the ImpL2 locus, always led to small-sized adults (see below). A Y902C mutant allele in InR, hereafter named InRY902C, was established after backcrossing with the control, w, seven times. Notably, a backcrossed ImpL2Def42 allele, which did not retain the InRY902C mutation, led to large-sized adults, as expected (Fig. S1C).

Fig. 1.

Isolation of a p.Y902C missense mutation in Drosophila InR. (A) Schematic of the insulin/IGF signaling (IIS) pathway and the function of ImpL2. (B,C) Adult male weights of the indicated genotypes. Relative size differences to the control flies are indicated. ImpL2, InR and Akt are located on the third chromosome. Results are presented as the mean±s.d.; one-way ANOVA with Dunnett's post hoc test; *P<0.05; **P<0.01; ***P<0.001. (D) Domain structure of InR. The red arrow indicates the position of Y902. Sanger sequencing of the identified mutation is shown on the bottom. SP, Signal peptide; L1 and L2, leucine-rich repeat domain 1 and 2; CR, cysteine-rich domain; FnIII-1, -2, -3, fibronectin type III domains 1, 2, 3; TM, transmembrane domain; TK, tyrosine kinase domain. (E) Amino acid sequence alignment of insulin receptor (InsR) and IGF1 receptor between species. Identical and similar residues between the sequences are indicated by asterisks and colons, respectively. Green arrows indicate β-strands according to the published structure (PDB code: 6sof). Hs, Homo sapiens; Mm, Mus musculus; Gg, Gallus gallus; Dm, Drosophila melanogaster; Ce, Caenorhabditis elegans. (F) Spatial location of F565 (Y902 in Drosophila) on the extracellular domain of the human InsR saturated with insulin ligands. Front (left) and orthogonal (right) views are shown. Subdomains are colored as in D. The backbone atoms of the F565 are shown in the stick model (red). Four molecules of insulin are depicted in red (Ins1, Ins1′) and blue (Ins2, Ins2′). αCT, C-terminal tail of insulin receptor α-subunit. (G) Close-up view of Ins2 and insulin binding site on the FnIII-1 domain. (H) Close-up of the FnIII-1 domain including F565. The backbone atoms of the surrounding amino acid residues to F565 and cysteine are shown in the stick model.

Fig. 1.

Isolation of a p.Y902C missense mutation in Drosophila InR. (A) Schematic of the insulin/IGF signaling (IIS) pathway and the function of ImpL2. (B,C) Adult male weights of the indicated genotypes. Relative size differences to the control flies are indicated. ImpL2, InR and Akt are located on the third chromosome. Results are presented as the mean±s.d.; one-way ANOVA with Dunnett's post hoc test; *P<0.05; **P<0.01; ***P<0.001. (D) Domain structure of InR. The red arrow indicates the position of Y902. Sanger sequencing of the identified mutation is shown on the bottom. SP, Signal peptide; L1 and L2, leucine-rich repeat domain 1 and 2; CR, cysteine-rich domain; FnIII-1, -2, -3, fibronectin type III domains 1, 2, 3; TM, transmembrane domain; TK, tyrosine kinase domain. (E) Amino acid sequence alignment of insulin receptor (InsR) and IGF1 receptor between species. Identical and similar residues between the sequences are indicated by asterisks and colons, respectively. Green arrows indicate β-strands according to the published structure (PDB code: 6sof). Hs, Homo sapiens; Mm, Mus musculus; Gg, Gallus gallus; Dm, Drosophila melanogaster; Ce, Caenorhabditis elegans. (F) Spatial location of F565 (Y902 in Drosophila) on the extracellular domain of the human InsR saturated with insulin ligands. Front (left) and orthogonal (right) views are shown. Subdomains are colored as in D. The backbone atoms of the F565 are shown in the stick model (red). Four molecules of insulin are depicted in red (Ins1, Ins1′) and blue (Ins2, Ins2′). αCT, C-terminal tail of insulin receptor α-subunit. (G) Close-up view of Ins2 and insulin binding site on the FnIII-1 domain. (H) Close-up of the FnIII-1 domain including F565. The backbone atoms of the surrounding amino acid residues to F565 and cysteine are shown in the stick model.

Subsequently, we performed sequence-based in silico prediction analysis to predict the effect of single amino acid variations on protein function and stability. Computational prediction with the program PROVEAN [Protein Variation Effect Analyzer; the J. Craig Venter Institute (JCVI)] predicts that a tyrosine to cysteine amino acid change at this position is ‘deleterious’ with a score of −6.735 (if the score is equal to or below −2.5, the variant is predicted to have a deleterious effect). The corresponding amino acids of Y902 of Drosophila InR are F565 in hInsR and Y580 in hIGF1R. Although no single nucleotide polymorphisms at these positions in human genes have been reported, missense mutations in these sites to cysteine were also predicted to be highly damaging in silico: PROVEAN score of −5.208 (in hInsR) and −4.302 (in hIGF1R). Thus, the Y902C mutation likely alters InR function.

In addition to insulin binding to the leucine-rich repeat (L1) domain, insulin independently binds to the FnIII-1 domain (Gutmann et al., 2020; Li et al., 2022; Uchikawa et al., 2019). To further understand the molecular nature of the Y902C mutation, we mapped it onto a three-dimensional structural model of hInsR (Fig. 1F). Y902 (F565 in hInsR) is located in the β-sheet that is laterally connected by two adjacent antiparallel strands (Fig. 1G). The side chain of F565 is located on the inside, but not on the surface, of the molecule and is in close proximity to the hydrophobic side chains of F506 and I585, both of which are functionally conserved in Drosophila (Fig. 1H; Fig. S2A). Thus, F565 is not directly involved in insulin binding and is thought to be important in stabilizing the overall secondary structure and conformational changes upon ligand binding.

It has been recently reported that the classical allele InRE19 has a missense mutation p.Val811Asp (Yamamoto et al., 2021), which is located at the N-terminal end of the FnIII-1 domain (Fig. S2A). Interestingly, the hydrophobic side chain of the corresponding F475 in hInsR (V811 in Drosophila InR) is also inside the molecule and placed close to F565. However, there was no direct interaction between these two side chains (Fig. 1G; Fig. S2B,C).

InRY902C mutants decrease IIS and body growth

To further characterize the InRY902C mutant phenotype on body growth and IIS, we examined body size. Pupal volume, adult weights and adult wing area in homozygous InRY902C mutants were significantly reduced in both males and females compared with the control w (Fig. 2A-C). Subsequently, we used InR05545, a strong hypomorphic allele of InR, in which homozygotes were lethal mainly at the second instar larvae (Bolukbasi et al., 2012; Fernandez et al., 1995). InR05545 has a P-element insertion upstream of the mature protein. Transheterozygotes of InR05545 with InRY902C (InR05545/Y902C) had severely reduced body size compared with InRY902C homozygotes (Fig. 2A-C), indicating that InRY902C is a weak hypomorphic allele. Next, we analyzed the expression levels of Foxo target genes. InR and 4E-BP (Thor) are upregulated by the reduction of IIS (Okamoto et al., 2013; Puig et al., 2003). Similarly, a Foxo target ilp6 is induced in the fat body upon starvation (Slaidina et al., 2009). We found that InR was expressed normally in InRY902C mutant larvae compared with control larvae under fed conditions (Fig. 2D), suggesting that the Y902C mutation does not compromise InR mRNA stability. InR05545/Y902C mutants show slightly but significantly increased InR expression levels, suggesting that IIS is decreased in InR05545/Y902C mutants. Consistent with the degree of body size reduction, the expression of 4E-BP and ilp6 increased in the InRY902C mutants and increased more significantly in the InR05545/Y902C mutants under fed conditions. Starvation further increased the expression of InR and 4E-BP in InR05545/Y902C mutant larvae. Furthermore, ilp2 and ilp5, major Ilps regulating body growth during the larval period, were significantly increased in the InRY902C and InR05545/Y902C mutants (Fig. 2D). Interestingly, starvation completely ceased this upregulation, suggesting that ilp2 and ilp5 are induced to compensate for the reduction of IIS in a nutrient-dependent manner.

Fig. 2.

InRY902C mutants decrease IIS and body growth. (A) Pupal volumes of the mixed-sex animals in the control and InR mutants. Relative size differences are indicated. (B) Adult weights of males and females in control and InR mutants. (C) Adult wing area in males and females of the indicated genotypes. (D) Relative expression levels of Foxo-target genes and Ilp genes in control and InR mutants under the indicated conditions as determined by qRT-PCR. F, early third instar larvae grown under fed condition; S, early third instar larvae fasted for 24 h. (E) pAkt levels in the fat body dissected from the early second instar larvae of the indicated genotypes. The dissected fat bodies were cultured for 30 min in the presence or absence of 0.1µM insulin. Samples were stained with anti-pAkt antibody. (F) Quantification of pAkt staining at the cell-cell boundaries. For appropriate panels, results are presented as the mean±s.d. (B,D); n=6 (D); one-way ANOVA with Dunnett's post hoc test (A-C), unpaired two-tailed Student's t-test with Bonferroni correction (D), Kruskal–Wallis test followed by Dunn's post hoc test (F); *P<0.05, **P<0.01, ***P<0.001; n.s., not significant. Scale bar: 10 µm (E).

Fig. 2.

InRY902C mutants decrease IIS and body growth. (A) Pupal volumes of the mixed-sex animals in the control and InR mutants. Relative size differences are indicated. (B) Adult weights of males and females in control and InR mutants. (C) Adult wing area in males and females of the indicated genotypes. (D) Relative expression levels of Foxo-target genes and Ilp genes in control and InR mutants under the indicated conditions as determined by qRT-PCR. F, early third instar larvae grown under fed condition; S, early third instar larvae fasted for 24 h. (E) pAkt levels in the fat body dissected from the early second instar larvae of the indicated genotypes. The dissected fat bodies were cultured for 30 min in the presence or absence of 0.1µM insulin. Samples were stained with anti-pAkt antibody. (F) Quantification of pAkt staining at the cell-cell boundaries. For appropriate panels, results are presented as the mean±s.d. (B,D); n=6 (D); one-way ANOVA with Dunnett's post hoc test (A-C), unpaired two-tailed Student's t-test with Bonferroni correction (D), Kruskal–Wallis test followed by Dunn's post hoc test (F); *P<0.05, **P<0.01, ***P<0.001; n.s., not significant. Scale bar: 10 µm (E).

Given that InRY902C mutants responded to starvation, we next examined whether InRY902C could activate IIS in response to Ilps. To this end, we incubated the larval fat body with bovine insulin under in vitro organ culture conditions and analyzed pAkt levels by immunostaining. We found that insulin stimulation increased pAkt signals at the plasma membrane in the control fat body, whereas those in the nucleus did not change (Fig. 2E,F). Similarly, insulin strongly increased pAkt signals in InRY902C mutant, but not in homozygous InR05545 mutant, fat body cells. From these results, we concluded that the InR Y902C mutation attenuates IIS but retains the binding ability to Ilps to induce PI3K-Akt signaling to some degree.

InRY902C mutants display temperature-sensitive growth defects

Missense mutations are sometimes associated with temperature sensitivity. We observed that the InRY902C mutation is a temperature-sensitive allele in which the mutant phenotype became severe at high temperatures (29°C) and, in turn, lost or reversed at low temperatures (18°C). The pupariation timing in InRY902C mutants was slightly delayed compared with that in the control larvae at 25°C (Fig. 3A). However, at 29°C, InRY902C mutants displayed a significant delay in the pupariation timing by ∼5 days and produced small-sized adults (Fig. 3A-D). Further analysis of adult wings revealed that the reduction in wing area in the InRY902C mutants was caused by a reduction in both cell size and cell number (Fig. 3E; Fig. S3A). Moreover, InRY902C mutants successfully underwent pupariation, but half of them failed to eclose at 29°C (Fig. 3F,G; Fig. S3B). At 18°C, the timing of pupariation and adult weights of InRY902C flies were indistinguishable from those of control flies (Fig. 3A,D). In contrast, the pupal volume and adult wing area in InRY902C were larger than those in the control at 18°C (Fig. 3B,E). The increase in the wing size of the InRY902C mutants at 18°C was caused solely by the increase in cell number but not by cell size (Fig. 3E; Fig. S3A). Together, these results indicate that InRY902C is a temperature-sensitive allele.

Fig. 3.

InRY902C mutants display temperature-sensitive growth defects. (A) Differences in the timing of pupariation in control and InR mutants. A defined number of newly hatched larvae were placed in a vial and cultured at the indicated temperature conditions. (B) Pupal volumes of the mixed-sex animals in the control and InR mutants grown at the indicated temperature. Relative size differences are indicated. (C) Adult male flies in control and InR mutants. (D) Adult weights of males and females in control and InR mutants grown at the indicated temperature. (E) Wing area, cell size and cell number in males and females of the indicated genotypes. n=13-25. See also Fig. S3A. (F) The survival rates of control and InR mutants. A defined number of newly hatched larvae (35-40 larvae) were placed in a vial, and the survival rate was determined by counting the pupae. (G) Eclosion rate at 29°C. (H) Relative gene expression levels of IPC-derived Ilp genes in control and InR mutants at the early third instar larvae grown at 29°C. (I) Relative gene expression levels of Foxo-target genes in control and InR mutants at the indicated conditions. The average values of control fed larvae at 25°C were set to 1. For appropriate panels, results are presented as the mean±s.e.m. (A) or the mean±s.d. (D,E,H,I); n=6 (H), n=3 (I); unpaired two-tailed Student's t-test (B,D,G-I); *P<0.05, **P<0.01, ***P<0.001; n.s., not significant.

Fig. 3.

InRY902C mutants display temperature-sensitive growth defects. (A) Differences in the timing of pupariation in control and InR mutants. A defined number of newly hatched larvae were placed in a vial and cultured at the indicated temperature conditions. (B) Pupal volumes of the mixed-sex animals in the control and InR mutants grown at the indicated temperature. Relative size differences are indicated. (C) Adult male flies in control and InR mutants. (D) Adult weights of males and females in control and InR mutants grown at the indicated temperature. (E) Wing area, cell size and cell number in males and females of the indicated genotypes. n=13-25. See also Fig. S3A. (F) The survival rates of control and InR mutants. A defined number of newly hatched larvae (35-40 larvae) were placed in a vial, and the survival rate was determined by counting the pupae. (G) Eclosion rate at 29°C. (H) Relative gene expression levels of IPC-derived Ilp genes in control and InR mutants at the early third instar larvae grown at 29°C. (I) Relative gene expression levels of Foxo-target genes in control and InR mutants at the indicated conditions. The average values of control fed larvae at 25°C were set to 1. For appropriate panels, results are presented as the mean±s.e.m. (A) or the mean±s.d. (D,E,H,I); n=6 (H), n=3 (I); unpaired two-tailed Student's t-test (B,D,G-I); *P<0.05, **P<0.01, ***P<0.001; n.s., not significant.

Developmental delay and growth defects observed in the InRY902C mutants at high temperatures imply a substantial reduction in IIS. To confirm the reduction in IIS, we next analyzed temperature-dependent expression changes in Ilp genes and Foxo-target genes. As expected, ilp2, ilp3 and ilp5 were strongly upregulated in InRY902C mutant larvae grown at 29°C (Fig. 3H) compared with those grown at 25°C (Fig. 2D). Moreover, InRY902C mutants showed a greatly increased expression of InR, 4E-BP and ilp6 at 29°C (Fig. 3I). The expression levels of these genes did not change between rearing temperatures in control larvae. Thus, the observed growth defects in the InRY902C mutants were caused by further reduction of IIS at high temperatures. Notably, a day of starvation at 29°C further increased InR and 4E-BP expression in InRY902C mutants, indicating that InRY902C mutants maintain a certain IIS to sustain larval development even at high temperatures. Interestingly, InR and ilp6 expression was reduced in InRY902C mutants compared with that in control larvae at 18°C. The relative upregulation in the IIS may explain the increased pupal volume and wing size at low temperatures.

InR mutants cause broad abnormalities in metabolite levels

Downregulation of IIS causes metabolic defects, such as increased stored triglycerides (TAG) and circulating sugars (Teleman, 2010). Consistent with previous observations, both InRY902C and InR05545/Y902C mutants showed increased amounts of TAG, glycogen, trehalose and glucose in the late third instar larvae (Fig. 4A). To further understand the metabolic defects in InR mutants, a widely targeted metabolomic analysis was conducted using liquid chromatography with tandem mass spectrometry (LC-MS/MS). A principal component analysis (PCA) of 122 water-soluble metabolites revealed that the level of IIS depended on genotype and temperature according to the PC1 axis (Fig. 4B; Table S2). These results suggested that homozygous InRY902C mutants grown at 29°C were metabolically similar to InR05545/Y902C mutants grown at 25°C, which is largely consistent with the degree of body size reduction (Figs 2B and 3D). The rearing temperature itself had a significant impact on the metabolic states in control larvae (Fig. S4A). Nevertheless, high temperatures caused a clear separation between the control and mutant larvae compared with the low-temperature condition (Fig. S4B). Notably, the positive loading for the metabolites that contributed maximally to PC1 included several glycolytic and TCA cycle metabolites (Fig. 4C; Table S3). In addition, the polyol pathway metabolites, sorbitol and fructose, were also increased in InR mutants (Fig. 4C,D; Table S3), suggesting that excess glucose in circulation is converted to fructose via the polyol pathway. Moreover, glucogenic amino acids, such as alanine, serine, proline and glutamine, significantly increased according to the reduction in IIS. These results suggested that mutations in InR lead to a substantial increase in glucose-related metabolic pathways.

Fig. 4.

InR mutants cause broad abnormalities in metabolite levels. (A) Changes in the amounts of protein, TAG, glycogen, trehalose and glucose in control and InR mutants at the late third instar larvae grown at 25°C. (B) PCA of metabolites in control and InR mutants at the late third instar larvae grown at the indicated temperature. Ellipses of clusters show the 95% confidence regions for each sample group. YC, InRY902C mutants; PZ/YC, InR05545/Y902C mutants. See also Tables S2 and S3. (C) Heatmaps of selected metabolites in control and InR mutants at the indicated genotype and temperature. The color code represents the row z-score. Red and blue indicate increases and decreases in metabolite levels compared with median levels, respectively. Unpaired two-tailed Welch's t-test (*P<0.05). (D) Relative changes in selected metabolite levels in control and InR mutants. For appropriate panels, results are presented as the mean±s.d. (A,D); n=3 (A–D); one-way ANOVA with Dunnett's post hoc test (A), unpaired two-tailed Welch's t-test (D); *P<0.05; **P<0.01; ***P<0.001 (A,D); n.s., not significant.

Fig. 4.

InR mutants cause broad abnormalities in metabolite levels. (A) Changes in the amounts of protein, TAG, glycogen, trehalose and glucose in control and InR mutants at the late third instar larvae grown at 25°C. (B) PCA of metabolites in control and InR mutants at the late third instar larvae grown at the indicated temperature. Ellipses of clusters show the 95% confidence regions for each sample group. YC, InRY902C mutants; PZ/YC, InR05545/Y902C mutants. See also Tables S2 and S3. (C) Heatmaps of selected metabolites in control and InR mutants at the indicated genotype and temperature. The color code represents the row z-score. Red and blue indicate increases and decreases in metabolite levels compared with median levels, respectively. Unpaired two-tailed Welch's t-test (*P<0.05). (D) Relative changes in selected metabolite levels in control and InR mutants. For appropriate panels, results are presented as the mean±s.d. (A,D); n=3 (A–D); one-way ANOVA with Dunnett's post hoc test (A), unpaired two-tailed Welch's t-test (D); *P<0.05; **P<0.01; ***P<0.001 (A,D); n.s., not significant.

In contrast, negative loadings contributed to the PC1 enriched ribonucleotides, particularly pyrimidine diphosphate (CDP and UDP) and triphosphate (CTP and UTP) (Table S3). These pyrimidine ribonucleotides were significantly reduced according to the reduction in IIS (Fig. 4D; Fig. S4C), suggesting that IIS directly or indirectly affected pyrimidine ribonucleotide levels. In contrast, ATP levels increased according to the reduction in the IIS (Fig. 4D). These results imply that growth defects in InR mutants cannot be attributed to a reduction in ATP levels. Overall, our metabolomics data demonstrate that a reduction in IIS leads to widespread effects on metabolic pathways, including amino acids and nucleotides.

InR mutants partly phenocopy metabolic abnormalities caused by a high sugar diet

It has been reported that a high sugar diet (HSD) induces insulin resistance in Drosophila larvae (Musselman et al., 2011; Pasco and Léopold, 2012). Therefore, we compared the growth and metabolic phenotypes in control and InRY902C mutant larvae that were fed an HSD at 25°C (Fig. 5A). Feeding HSD decreased the larval growth rate in control animals compared with those fed a normal diet (ND), resulting in small-sized pupae (Fig. 5B). Interestingly, pupal volume in InRY902C mutants did not differ between ND and HSD, suggesting that InRY902C mutants were largely insensitive to HSD in terms of body growth.

Fig. 5.

Metabolic response of InRY902C mutants to a high-sugar diet. (A) An experimental scheme for the metabolomics analysis. ND, normal diet; HSD, high-sugar diet. (B) Pupal volumes of the mixed-sex animals in control and InR mutants grown on the indicated diet at 25°C. (C) PCA of metabolites in control and InR mutants at the late third instar larvae. Ellipses of clusters show the 95% confidence regions for each sample group. YC, InRY902C mutants. See also Table S4. (D) Volcano plots showing P-values versus fold change (FC) from the metabolomics data. Glc, glucose; Sor, sorbitol; Fru, fructose; Lac, lactate; Tre, trehalose; GlcN-6P, glucosamine 6-phosphate; Ala, alanine; 3PG, 3-phosphoglycerate; 6PG, 6-phosphogluconate; 3HB, 3-hydroxybutyrate; Kyn, kynurenine; V, vitamin; AC, acylcarnitine. (E) Heatmaps of selected metabolites in control and InR mutants. The color code represents the row z-score. Red and blue indicate increases and decreases in metabolite levels compared with median levels, respectively. Unpaired two-tailed Welch's t-test (*P<0.05). (F) Relative changes in selected metabolite levels in control and InR mutants. Results are presented as the mean±s.d.; unpaired two-tailed Welch's t-test; *P<0.05; **P<0.01; ***P<0.001; n.s., not significant.

Fig. 5.

Metabolic response of InRY902C mutants to a high-sugar diet. (A) An experimental scheme for the metabolomics analysis. ND, normal diet; HSD, high-sugar diet. (B) Pupal volumes of the mixed-sex animals in control and InR mutants grown on the indicated diet at 25°C. (C) PCA of metabolites in control and InR mutants at the late third instar larvae. Ellipses of clusters show the 95% confidence regions for each sample group. YC, InRY902C mutants. See also Table S4. (D) Volcano plots showing P-values versus fold change (FC) from the metabolomics data. Glc, glucose; Sor, sorbitol; Fru, fructose; Lac, lactate; Tre, trehalose; GlcN-6P, glucosamine 6-phosphate; Ala, alanine; 3PG, 3-phosphoglycerate; 6PG, 6-phosphogluconate; 3HB, 3-hydroxybutyrate; Kyn, kynurenine; V, vitamin; AC, acylcarnitine. (E) Heatmaps of selected metabolites in control and InR mutants. The color code represents the row z-score. Red and blue indicate increases and decreases in metabolite levels compared with median levels, respectively. Unpaired two-tailed Welch's t-test (*P<0.05). (F) Relative changes in selected metabolite levels in control and InR mutants. Results are presented as the mean±s.d.; unpaired two-tailed Welch's t-test; *P<0.05; **P<0.01; ***P<0.001; n.s., not significant.

We further examined the metabolic profiles in control and InRY902C mutant larvae fed either ND or HSD at the late third instar (Table S4). PCA revealed that HSD caused a clear metabolic shift in control larvae but not in InRY902C mutant larvae (Fig. 5C). A volcano plot further indicated that fewer significant changes occurred in InRY902C mutants fed an HSD compared with control larvae (Fig. 5D). Many metabolites involved in glycolysis and the TCA cycle were increased by HSD in control larvae (Fig. 5E,F), whereas InRY902C mutants did not show a further elevation in many of those metabolites. In contrast, the polyol pathway metabolites, sorbitol and fructose, were significantly increased in both control and InR mutants under HSD (Fig. 5D-F). Unexpectedly, HSD-fed control larvae showed metabolic states different from those of InRY902C mutants with respect to amino acids and the ketone body 3-hydroxybutyrate. HSD increased the levels of 3-hydroxybutyrate, many glucogenic amino acids and branched-chain amino acids (BCAAs) in control larvae. In contrast, InRY902C mutants showed no increase in BCAAs, even when fed HSD (Fig. 5E,F). Moreover, InRY902C mutants did not show further increases in glucogenic amino acids when fed HSD. Interestingly, several vitamin Bs significantly decreased in InRY902C mutants that were fed HSD (Fig. 5D), suggesting that HSD-induced metabolic stress leads to higher consumption of vitamin Bs in InRY902C mutants, presumably through carbohydrate oxidation and energy release. Together, these results suggested that InRY902C mutants are less sensitive to HSD and partly phenocopy the metabolic abnormalities caused by HSD.

InRY902C mutants show reduced fecundity and produce irregular-shaped small embryos

To further demonstrate the advantage of temperature-sensitive mutations in InR, we next analyzed fecundity after a temperature shift (Fig. 6A). Strong InR mutants have been reported to be sterile because of defects in vitellogenesis (Richard et al., 2005; Tatar et al., 2001). Similarly, chico heterozygous females have reduced fecundity, and homozygous null mutants are sterile (Böhni et al., 1999; Clancy et al., 2001). Consistent with these previous studies, we found that the average number of deposited eggs was significantly decreased in InRY902C mutant females at 25°C (Fig. 6B), although InRY902C mutants could be maintained in homozygotes. When small-sized adult females grown at 25°C were kept for 4 days at either 18°C or 29°C, fecundity further decreased. To exclude the possible effect of body size reduction on egg production capacity, we raised InRY902C mutants at 18°C until the adult stage and then assessed fecundity. When normal-sized InRY902C mutant females grown at 18°C were maintained for 4 days at 29°C, fecundity significantly decreased (Fig. 6C). Under these conditions, normal-sized InRY902C mutant females laid eggs comparable with those of control flies at 18°C and 25°C. These results supported the idea that the IIS plays a crucial role in egg production, irrespective of body size.

Fig. 6.

InRY902C mutants reduce fecundity and produce irregular-shaped tiny embryos. (A) An experimental scheme of temperature shift for fecundity assay. (B,C) Number of eggs laid by a female per day. Fecundity was assessed as the number of eggs laid daily during 5 days at the indicated temperature. Mated females were used 4 days after temperature shift. n=15 (B), n=10 (C, control) or 15 (C, InRY902C mutants). (D) Embryo volumes in control and InR mutants at the indicated temperature conditions. Females grown up at 25°C were used. (E) Embryo length, width and aspect ratio (length per width). (F) Inter-individual variation in embryo volume, aspect ratio, embryo length and width for each genotype and temperature condition. The graphs indicate the variance shown in D and E. Two-sided Mann–Whitney U-test (B,C), unpaired two-tailed Student's t-test (D,E), F-test (F); *P<0.05; **P<0.01; ***P<0.001; n.s., not significant.

Fig. 6.

InRY902C mutants reduce fecundity and produce irregular-shaped tiny embryos. (A) An experimental scheme of temperature shift for fecundity assay. (B,C) Number of eggs laid by a female per day. Fecundity was assessed as the number of eggs laid daily during 5 days at the indicated temperature. Mated females were used 4 days after temperature shift. n=15 (B), n=10 (C, control) or 15 (C, InRY902C mutants). (D) Embryo volumes in control and InR mutants at the indicated temperature conditions. Females grown up at 25°C were used. (E) Embryo length, width and aspect ratio (length per width). (F) Inter-individual variation in embryo volume, aspect ratio, embryo length and width for each genotype and temperature condition. The graphs indicate the variance shown in D and E. Two-sided Mann–Whitney U-test (B,C), unpaired two-tailed Student's t-test (D,E), F-test (F); *P<0.05; **P<0.01; ***P<0.001; n.s., not significant.

Because IIS in the ovaries regulates yolk protein uptake (Richard et al., 2005), we analyzed embryo size in InRY902C mutants grown at 25°C. We found that the embryo volume decreased in InRY902C mutants at 25°C and more significantly at 29°C compared with those in control flies (Fig. 6D). Furthermore, both embryo length and width decreased at 25°C and 29°C, whereas the aspect ratio (length/width) did not change (Fig. 6E), suggesting that embryo size was proportionally reduced by the systemic reduction in IIS. Importantly, the reduction in embryo size was not a result of body size reduction because small-sized InRY902C mutants produced normal-sized embryos when adult flies were kept at 18°C (Fig. 6D,E). Given that these flies produced fewer eggs (Fig. 6B), body size reduction per se appears to result in a reduction in egg number at the expense of producing normal-sized eggs. We further noticed that inter-individual variation in the aspect ratio significantly increased in InRY902C mutants, particularly at 29°C (Fig. 6F). This increase was mainly due to the increase in egg length variation compared with width variation. Taken together, these results suggested that IIS affects egg morphology.

In this study, we isolated a novel missense mutation in InR as a revertant. Homozygous InRY902C mutants developed into adults with mild growth defects and produced subsequent generations at 25°C, albeit with reduced fecundity. We showed that homozygous InRY902C mutants displayed several phenotypic features that have been shown previously in IIS mutants and HSD-induced type 2 diabetes (T2D) models. These include upregulation of Ilp gene expression, increased lipid and carbohydrate contents, and decreases in adult wing size owing to cell size and cell number reduction (Böhni et al., 1999; Brogiolo et al., 2001; Grönke et al., 2010; Ikeya et al., 2002; Musselman et al., 2011; Pasco and Léopold, 2012; Rulifson et al., 2002; Tatar et al., 2001).

Given that InRY902C suppresses the Imp-L2Def42 mutant phenotype in body growth, it appears that a spontaneously occurring Y902C mutation in InR is fixed in the population during maintenance as an intergenic suppressor mutation. Consistent with this idea, homozygotes of the original Imp-L2Def42 stock with the InRY902C mutation were healthy compared with homozygotes of the backcrossed Imp-L2Def42 stock under our maintenance conditions. These results imply that suppressor mutations may occur in individuals with constitutively elevated IIS levels. In many studies on ImpL2, homozygous mutants of Imp-L2Def20 or transheterozygous mutants of Imp-L2Def20 over Imp-L2Def42 have been used (Figueroa-Clarevega and Bilder, 2015; Honegger et al., 2008; Kwon et al., 2015; Owusu-Ansah et al., 2013; Sarraf-Zadeh et al., 2013). However, some studies have used Imp-L2Def42 homozygotes for phenotypic analyses (Kapali et al., 2022; Lee et al., 2018). Therefore, it may be worthwhile to re-evaluate the phenotypes of Imp-L2Def42 homozygous mutants.

Drosophila is a powerful genetic model system for studying obesity and diabetes (Chatterjee and Perrimon, 2021). However, in contrast to the genetic models of obesity, useful models of T2D are relatively limited. Instead, the HSD approach has been widely used to disrupt carbohydrate metabolism and induce insulin resistance in Drosophila. This may be because many of the available mutants in the components of IIS, including InR, cause a severe phenotype in body growth and larval lethality in homozygotes (Brogiolo et al., 2001; Chen et al., 1996; Fernandez et al., 1995; Tatar et al., 2001). Heterozygous InR mutants reduce InR kinase activity and exhibit increased Ilp secretion, similar to diabetic hyperinsulinemia (Park et al., 2014; Tatar et al., 2001). However, unlike HSD-induced T2D models, metabolic changes such as elevated lipid stores and circulating sugars are not observed in the heterozygous mutants. Consistently, we found that heterozygous InR mutants (InR05545/+) showed mild defects in body growth but did not exhibit metabolic abnormalities. Therefore, it is worth investigating and comparing the effects of HSD and the genetic disruption of IIS using phenotypic and metabolomic approaches. To this end, we first conducted a comparative metabolomics analysis and found a strong correlation between IIS downregulation and metabolic defects. InR mutants showed significantly increased polyol pathway metabolites: sorbitol and fructose. The polyol pathway is a two-step process in which glucose is reduced to sorbitol by aldose reductase and then converted to fructose by sorbitol dehydrogenase (Sodh). In humans, increased flux of glucose into the polyol pathway leads to diabetic complications through oxidative and osmotic stresses (Brownlee, 2001; Jannapureddy et al., 2021; Tang et al., 2012). Consistently, increased intracellular sorbitol levels owing to the loss of Sodh cause age-dependent synaptic degeneration and motor impairment in Drosophila (Cortese et al., 2020). Therefore, it would be interesting to further examine tissue-specific oxidative and osmotic stresses caused by abnormal polyol metabolites in InR mutants.

We also showed that insulin resistance caused by HSD and a genetic mutation in InR exhibit similar metabolic abnormalities in glycolysis and the TCA cycle. However, these two conditions have different effects on the metabolism of ketone bodies and BCAAs. In humans, dysregulation of amino acid metabolism appears to be an early event in the progression to more severe insulin resistance and T2D (Mahendran et al., 2013; Morze et al., 2022). Insulin resistance is correlated with increased levels of ketone bodies and serum amino acids, including BCAAs, alanine and glutamate. Although we did not detect increased leucine and isoleucine levels in the InR mutants, HSD-fed control larvae showed apparent increases in these amino acids. Further studies will be required to explore the mechanistic basis underlying the amino acid changes between HSD-induced T2D models and InR mutants. Nevertheless, Drosophila InR mutants partly phenocopy perturbations in amino acid homeostasis observed in obese and insulin-resistant mammals. Further molecular characterization may expand the applicable models of insulin resistance and diabetic complications, for which Drosophila genetic models of T2D could be employed to genetically dissect the disease mechanisms.

We also found that IIS controls egg size and shape, in addition to fecundity. During oogenesis, IIS regulates germline stem cell proliferation, cyst growth, epithelial cell cycle progression, border cell migration and vitellogenesis (Ghiglione et al., 2018; Jouandin et al., 2014; LaFever and Drummond-Barbosa, 2005; Richard et al., 2005; Sharma et al., 2018; Tatar et al., 2001). The reduction in embryo volume observed in the InRY902C mutants may be caused by a reduction in yolk protein uptake. However, defects in vitellogenesis selectively reduce egg length but not width (Andersen and Horne-Badovinac, 2016). Thus, the reduced egg volume in InRY902C mutants cannot solely be attributed to the reduction in vitellogenesis. During oogenesis, spherical egg chambers within the ovary elongate along the anterior-posterior axis to create an elliptical egg shape. This elongation is thought to occur by the constraining force of the follicular epithelium (Cetera et al., 2014; Haigo and Bilder, 2011). Egg elongation in InRY902C mutants may be incomplete because IIS is required for stretch-induced follicle cell proliferation in the egg chambers (Borreguero-Muñoz et al., 2019). Another force that promotes elongation is the contraction of the muscle sheaths that surround the developing egg chambers (Andersen and Horne-Badovinac, 2016; Valer et al., 2022). Owing to its pleiotropic functions, it is reasonable to assume that the IIS in multiple tissues plays a role in generating a normal egg shape.

In humans, defects in the INSR gene cause a broad spectrum of congenital diseases associated with insulin resistance (Ardon et al., 2014; Hosoe et al., 2017). Disease-associated missense mutations have been mapped to the entire coding region of INSR, including the extracellular FnIII domain. The severity of the disease varies considerably and is generally correlated with the function of INSR; it can result in infant mortality, such as leprechaunism, or manifest only later in adult life, such as in insulin-resistant diabetes mellitus. Structural analysis revealed that insulin binding induces a large conformational change in hInsR (Gutmann et al., 2020; Li et al., 2022; Uchikawa et al., 2019). Binding of multiple insulin molecules to two distinct sites on each hInsR dimer breaks the auto-inhibited state and induces overall conformational changes, resulting in trans-autophosphorylation and activation. Y902C mutation in Drosophila InR may form an aberrant disulfide bond leading to misfolding of the extracellular domain. However, given the relatively mild defects in IIS and insulin responsiveness, the Y902C mutation likely affects insulin-binding affinity or conformational changes upon ligand binding for full activation, particularly at high temperatures. In contrast, the Y902C mutation may facilitate insulin binding and/or autophosphorylation at low temperatures, which explains the larger wing size. Interestingly, the InRE19 allele, having V811D mutation in the FnIII-1 domain, also shows a temperature-sensitive growth and metabolic phenotype (Shingleton et al., 2005; Yamamoto et al., 2021). Further biochemical and structural analyses will advance our understanding of the underlying temperature-sensitive characteristics caused by a missense mutation in the FnIII-1 domain.

In summary, given the nature of the temperature-sensitive allele, InRY902C mutants will be a useful tool for further understanding IIS-related physiological phenomena in Drosophila. Detailed molecular and metabolic analyses of Drosophila may facilitate a better understanding of disease susceptibility, including adult-onset diabetes and age-related physiological decline.

Drosophila strains

The following Drosophila melanogaster strains were used: w1118 (used as a control), Imp-L2Def20 and Imp-L2Def42 (Honegger et al., 2008). The following stocks were obtained from the Bloomington Drosophila Stock Center (BDSC): InR93Dj-4 (BDSC9554), P{PZ}InR05545 (BDSC11661), P{PZ}Akt04226 (BDSC11627), Df(3L)GN19 (BDSC416) and Df(3L)BSC370 (BDSC24394). ImpL2Def20 and ImpL2Def42 were used in w background.

Isolation of InRY902C mutants

Genomic DNA was extracted from homozygous Imp-L2Def20 and Imp-L2Def42 stocks, and the coding regions of the N-terminal and C-terminal portions of InR were separately amplified by PCR using the following primers: InR-Ex_F1 (GGAATTCATGTTCAATATGCCACGGGGAG) and InR-Ex_R (GGTCGACCTTGTGCAGGTAACAGACATAG), InR-Ex_F2 (GGCGCAGACTCGAATGGAAAC) and InR-cyto_R (CCTCGAGCGCCTCCCTTCCGATGAATC). The amplified PCR products were used for Sanger sequencing and compared with the reference sequences. Detected missense mutations were further checked using the Drosophila Genetic Reference Panel (DGRP2) inbred lines derived from a natural population (Mackay et al., 2012). A summary of missense mutations is listed in Table S1. We used the amino acid numbering of the reference sequence in the FlyBase ID, FBgn0283499 (NP_001138093.1).

To isolate the InRY902C allele, Imp-L2Def42 mutant males were crossed with w virgin females, and the resulting F1 heterozygous males were backcrossed with w virgin females. Around ten F2 females were singly crossed with w males and used for genotyping to identify females carrying the deletion in the Imp-L2 locus and InRY902C mutation. Single InRY902C-positive, Imp-L2Def42-negative F3 females were further crossed with w males. This process was repeated seven times in total, after which the InRY902C allele was re-isolated by crossing to a chromosome III balancer strain that crossed into a w background. Similarly, a single InRY902C-negative, Imp-L2Def42-positive F3 female was crossed with w males to generate the backcrossed Imp-L2Def42 allele. Imp-L2Def42 genotyping was performed using the primers ImpL2-Def_F1 (GATCTATCATCGTCCAACGTTGGG) and ImpL2-Def_R1 (AGTCATAAGTGCTTCTTGGGCTGC). InRY902C genotyping was performed using the primers: InR_F1 (GGCGCAGACTCGAATGGAAAC) and InR_R1 (GTTGGAGGACAAGTCTTCTTCGTC). Amplified PCR products were used for Sanger sequencing.

Fly food

The animals were reared on fly food (ND) that contained 8 g agar, 100 g glucose, 45 g dry yeast, 40 g corn flour, 4 ml propionic acid and 0.45 g butylparaben (in ethanol) per liter (1× recipe). Yeast paste was not added to the fly tubes in any of the experiments. All the experiments were conducted under non-crowded conditions at 25°C, unless otherwise indicated. Developmental staging was performed as previously described (Okamoto and Nishimura, 2015; Yamada et al., 2020). For the transient starvation experiments, staged larvae were washed in phosphate buffered saline (PBS) to remove all traces of food and transferred to a vial containing an agar-only diet for defined time periods.

Quantification of body and wing size

Adult flies, pupae and embryos were photographed using a Zeiss Stemi 2000-C stereomicroscope equipped with a Canon PowerShot G15 digital camera. Length and width were measured manually in ImageJ, and the volumes of pupae and embryos were determined using the formula 4/3π(L/2)(l/2)2, where L is the length and l is the width. Given that the sex ratios of InRY902C mutants at the wandering stage and newly eclosed adults were almost equal, an equal ratio of sexes were assumed to exist in the pupal populations. The weights of adult flies were measured in 1.5 ml tubes using an analytical balance (XS104, Mettler-Toledo Co.).

Adult wings were dissected from each fly using micro-forceps and mounted on a glass slide using 25% glycerol/25% isopropanol. Digital images were acquired using a Zeiss Primo Star microscope equipped with an AxioCam ERc. The wing area was manually traced and measured using either ImageJ or AxioVision software (Zeiss). Cell size and cell number in the adult wing were measured as previously described (Matsushita and Nishimura, 2020). Cell density was manually analyzed by counting the number of wing hairs in a 0.01 mm2 area at the third posterior cell of the wing, and cell size and approximate cell number per wing were calculated.

Fecundity

Three virgin females of each genotype raised at either 25°C or 18°C were placed with three control males raised at 25°C in triplicate. Mated females were used for the experiments 4 days after the temperature shift. Fecundity was assessed as the number of eggs laid daily during the following 5 days.

Sequence alignment

Amino acid sequence alignment was performed using the ClustalW program with default parameters (https://www.genome.jp/tools-bin/clustalw). The following published reference sequences were used: HsInsR, NP_000199.2; MmInsR, NP_034698.2; GgInsR, XP_040509734.1; HsIGF1R, NP_000866.1; MmIGF1R, NP_034643.2; GgIGF1R, NP_990363.1; DmInR, NP_001138093.1; DmSDR, NP_001287331.1; CeDaf-2, NP_497650.4.

Computational prediction and structural analysis of missense mutations

In silico prediction analysis was performed using PROVEAN (http://provean.jcvi.org/seq_submit.php) (Choi et al., 2012). If the score is equal to or below a predefined threshold (−2.5), the protein variant is predicted to have a ‘deleterious’ effect. If the score is above the threshold, the variant is predicted to have a ‘neutral’ effect.

Molecular graphics images were prepared using PyMOL version 2.5.2 (https://pymol.org/2/). The mutated residue of Drosophila InR was mapped onto the three-dimensional structure of the extracellular domain of human InsR [Protein Data Bank (PDB) code: 6sof] (Gutmann et al., 2020).

Immunohistochemistry

For insulin stimulation, the dissected fat bodies of the early second instar larvae were incubated in Schneider's Drosophila medium (Sigma-Aldrich) supplemented with 0.1 µM bovine insulin (Sigma-Aldrich) for 30 min at room temperature. The samples were fixed for 10 min in 3.7% formaldehyde in PBS containing 0.2% Triton X-100 and processed as previously described (Okamoto and Nishimura, 2015). The following primary and secondary antibodies were used: rabbit anti-pAkt-S505 antibody (1/200, 4054, Cell Signaling Technology) and Alexa Fluor 555-conjugated goat anti-rabbit IgG antibody (1/500, A-21428, Thermo Fisher Scientific). The nuclei were stained with Hoechst 33342 (Thermo Fisher Scientific). Images were acquired with a Zeiss LSM800 confocal microscope and were processed using Fiji and Photoshop CS6 (Adobe Systems). Single confocal sections are shown. For quantification of pAkt signals, mean fluorescence intensity at the cell-cell boundaries was manually analyzed using Fiji.

qRT-PCR analysis

qRT-PCR analysis was performed as previously described (Okamoto et al., 2013; Okamoto and Nishimura, 2015). Total RNA was prepared using the RNeasy mini kit with an RNase-Free DNase Set (Qiagen), and reverse transcription was performed using PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed on an ABI PRISM 7500 or StepOnePlus Real-Time PCR system (Thermo Fisher Scientific) using TB Green Premix Ex TaqII (Takara Bio). Transcript levels of the target mRNA were normalized to rp49 (RpL32) levels in the same samples. The primers used in this study are listed in Table S5. Notably, the primer set of InR targets the 5′ region upstream of the P-element insertion of InR05545.

Measurements of metabolite levels

TAG, trehalose, glycogen and glucose levels were measured as previously described (Nishimura, 2020; Yamada et al., 2020). In brief, samples were homogenized using a pellet pestle in 100 µl of cold PBS containing 0.1% Triton X-100, immediately heat-inactivated at 80°C for 10 min and then cooled to room temperature. The homogenate samples were used to determine the TAG and glycogen levels, and the cleared samples after centrifugation at 12,000 rpm (13,000 g) for 10 min at room temperature were used to determine the trehalose, glucose and protein levels.

To determine TAG levels, the homogenate was mixed with triglyceride reagent (Sigma-Aldrich), incubated at 37°C for at least 30 min, and then cleared by centrifugation. The supernatant was used for the measurement of TAG by using the free glycerol reagent (Sigma-Aldrich). A triolein equivalent glycerol standard (Sigma-Aldrich) was used as the standard. The amount of TAG per fly was normalized to the total protein level per fly, as described below.

To determine sugar levels, the samples were incubated with PBS containing amyloglucosidase (Roche) or bacterially produced recombinant His-tagged Drosophila cTreh (Yoshida et al., 2016) at 37°C overnight. The sample was incubated with PBS without enzymes in parallel to determine glucose levels. The amount of glucose was determined using a glucose assay kit (Sigma-Aldrich) with a serial dilution of glucose as the standard. The trehalose and glycogen concentrations in each sample were determined by subtracting the values of free glucose in the untreated samples. The amounts of trehalose, glycogen and glucose were normalized to the total protein levels.

To determine total protein levels in larval samples, the homogenates were mixed with two volumes of 0.2 N NaOH, vortexed for 10 min at room temperature and heated at 95°C for 15 min to solubilize proteins. The cleared samples after centrifugation at 12,000 rpm (13,000 g) for 10 min at room temperature were used to quantify protein using a BCA protein assay kit (Thermo Fisher Scientific).

Metabolite extraction and a widely targeted metabolomics profile

Widely targeted metabolomics analysis was performed as previously described (Nishimura, 2020; Yamada et al., 2020). In brief, frozen samples in 1.5 ml plastic tubes were homogenized in 300 µl cold methanol with a 3 mm diameter zirconia bead using a freeze crusher (Tokken Inc.) at 41.6 Hz for 2 min. The homogenates were mixed with 200 µl of methanol, 200 µl of H2O and 200 µl of CHCl3 and vortexed for 20 min at room temperature. The samples were then centrifuged at 15,000 rpm (20,000 g) for 15 min at 4°C. The insoluble pellets were used to quantify the total protein using a BCA protein assay kit (Thermo Fisher Scientific). The supernatant was mixed with 350 µl of H2O, vortexed for 10 min at room temperature and centrifuged at 15,000 rpm for 15 min at 4°C. The aqueous phase was collected and dried down using a vacuum concentrator. The samples were re-dissolved in 2 mM ammonium bicarbonate (pH 8.0) and analyzed by LC-MS/MS.

Chromatographic separations in an Acquity UPLC H-Class System (Waters) were carried out under reverse-phase conditions using an Acquity UPLC HSS T3 column (100 mm×2.1 mm, 1.8 µm particles, Waters) and under hydrophilic interaction liquid chromatography conditions using an Acquity UPLC BEH Amide column (100 mm×2.1 mm, 1.8 µm particles, Waters). Ionized compounds were detected using a Xevo TQD triple quadrupole mass spectrometer coupled with an electrospray ionization source (Waters). The peak area of a target metabolite was analyzed using MassLynx 4.1 software (Waters). The metabolite signals were normalized to the total protein level of the corresponding sample after subtracting the values from the blank sample. P-values were calculated using unpaired two-tailed Welch's t-test in Microsoft Excel. Further statistical analyses, including PCA, were performed in MetaboAnalyst 5.0 (https://www.metaboanalyst.ca/home.xhtml) (Pang et al., 2022). The data were normalized to the median per sample.

Statistical analysis

Experiments were replicated at least twice using independently reared populations to ensure reproducibility. Alternatively, samples were collected from populations that were independently reared. The experiments were not randomized, and the investigators were not blinded to the fly genotypes during the experiments. The sample sizes were chosen based on the number of independent experiments required for statistical significance and technical feasibility. The sample size for each experiment is indicated in the figures and figure legends. Statistical tests were performed using Microsoft Excel or GraphPad Prism 7. The statistical tests used are described in the figure legends. Statistical significance is presented as follows, except in Figs 4C, 5E, and Fig. S4C: *P<0.05, **P<0.01, ***P<0.001; n.s., not significant. Source data are provided in Table S6.

We thank Hugo Stocker for fly stocks and discussions, the Bloomington Drosophila Stock Center for fly stocks, members of fly laboratories at RIKEN BDR for their valuable support and discussions, Ryota Matsushita and Masayuki Tobo for technical assistance, and the genome resource and analysis unit at RIKEN BDR for their assistance with Sanger sequencing. We are grateful to Naoki Okamoto and Yuto Yoshinari for their comments on the manuscript.

Author contributions

Conceptualization: K.B., T.N.; Methodology: K.B., T.N.; Validation: K.B., T.N.; Formal analysis: K.B., T.N.; Investigation: K.B., T.N.; Data curation: K.B., T.N.; Writing - original draft: T.N.; Writing - review & editing: K.B.; Visualization: T.N.; Supervision: T.N.; Project administration: T.N.; Funding acquisition: T.N.

Funding

This work was supported by the Japan Society for the Promotion of Science (JSPS) [KAKENHI grants 17H03658 and 21H02495 to T.N.].

Andersen
,
D.
and
Horne-Badovinac
,
S.
(
2016
).
Influence of ovarian muscle contraction and oocyte growth on egg chamber elongation in Drosophila
.
Development
143
,
1375
-
1387
.
Ardon
,
O.
,
Procter
,
M.
,
Tvrdik
,
T.
,
Longo
,
N.
and
Mao
,
R.
(
2014
).
Sequencing analysis of insulin receptor defects and detection of two novel mutations in INSR gene
.
Mol. Genet. Metab. Rep.
1
,
71
-
84
.
Belfiore
,
A.
,
Malaguarnera
,
R.
,
Vella
,
V.
,
Lawrence
,
M. C.
,
Sciacca
,
L.
,
Frasca
,
F.
,
Morrione
,
A.
and
Vigneri
,
R.
(
2017
).
Insulin receptor isoforms in physiology and disease: an updated view
.
Endocr. Rev.
38
,
379
-
431
.
Böhni
,
R.
,
Riesgo-Escovar
,
J.
,
Oldham
,
S.
,
Brogiolo
,
W.
,
Stocker
,
H.
,
Andruss
,
B. F.
,
Beckingham
,
K.
and
Hafen
,
E.
(
1999
).
Autonomous control of cell and organ size by CHICO, a Drosophila homolog of vertebrate IRS1-4
.
Cell
97
,
865
-
875
.
Bolukbasi
,
E.
,
Vass
,
S.
,
Cobbe
,
N.
,
Nelson
,
B.
,
Simossis
,
V.
,
Dunbar
,
D. R.
and
Heck
,
M. M. S.
(
2012
).
Drosophila poly suggests a novel role for the Elongator complex in insulin receptor-target of rapamycin signalling
.
Open Biol.
2
,
110031
.
Borreguero-Muñoz
,
N.
,
Fletcher
,
G. C.
,
Aguilar-Aragon
,
M.
,
Elbediwy
,
A.
,
Vincent-Mistiaen
,
Z. I.
and
Thompson
,
B. J.
(
2019
).
The Hippo pathway integrates PI3K-Akt signals with mechanical and polarity cues to control tissue growth
.
PLoS Biol.
17
,
e3000509
.
Britton
,
J. S.
,
Lockwood
,
W. K.
,
Li
,
L.
,
Cohen
,
S. M.
and
Edgar
,
B. A.
(
2002
).
Drosophila's insulin/PI3-kinase pathway coordinates cellular metabolism with nutritional conditions
.
Dev. Cell
2
,
239
-
249
.
Brogiolo
,
W.
,
Stocker
,
H.
,
Ikeya
,
T.
,
Rintelen
,
F.
,
Fernandez
,
R.
and
Hafen
,
E.
(
2001
).
An evolutionarily conserved function of the Drosophila insulin receptor and insulin-like peptides in growth control
.
Curr. Biol.
11
,
213
-
221
.
Brownlee
,
M.
(
2001
).
Biochemistry and molecular cell biology of diabetic complications
.
Nature
414
,
813
-
820
.
Cetera
,
M.
,
Ramirez-San Juan
,
G. R.
,
Oakes
,
P. W.
,
Lewellyn
,
L.
,
Fairchild
,
M. J.
,
Tanentzapf
,
G.
,
Gardel
,
M. L.
and
Horne-Badovinac
,
S.
(
2014
).
Epithelial rotation promotes the global alignment of contractile actin bundles during Drosophila egg chamber elongation
.
Nat. Commun.
5
,
5511
.
Chatterjee
,
N.
and
Perrimon
,
N.
(
2021
).
What fuels the fly: Energy metabolism in Drosophila and its application to the study of obesity and diabetes
.
Sci. Adv.
7
,
eabg4336
.
Chen
,
C.
,
Jack
,
J.
and
Garofalo
,
R. S.
(
1996
).
The Drosophila insulin receptor is required for normal growth
.
Endocrinology
137
,
846
-
856
.
Choi
,
Y.
,
Sims
,
G. E.
,
Murphy
,
S.
,
Miller
,
J. R.
and
Chan
,
A. P.
(
2012
).
Predicting the functional effect of amino acid substitutions and indels
.
PLoS ONE
7
,
e46688
.
Clancy
,
D. J.
,
Gems
,
D.
,
Harshman
,
L. G.
,
Oldham
,
S.
,
Stocker
,
H.
,
Hafen
,
E.
,
Leevers
,
S. J.
and
Partridge
,
L.
(
2001
).
Extension of life-span by loss of CHICO, a Drosophila insulin receptor substrate protein
.
Science
292
,
104
-
106
.
Cortese
,
A.
,
Zhu
,
Y.
,
Rebelo
,
A. P.
,
Negri
,
S.
,
Courel
,
S.
,
Abreu
,
L.
,
Bacon
,
C. J.
,
Bai
,
Y.
,
Bis-Brewer
,
D. M.
,
Bugiardini
,
E.
et al. 
(
2020
).
Biallelic mutations in SORD cause a common and potentially treatable hereditary neuropathy with implications for diabetes
.
Nat. Genet.
52
,
473
-
481
.
Droujinine
,
I. A.
and
Perrimon
,
N.
(
2016
).
Interorgan Communication Pathways in Physiology: Focus on Drosophila
.
Annu. Rev. Genet.
50
,
539
-
570
.
Fernandez
,
R.
,
Tabarini
,
D.
,
Azpiazu
,
N.
,
Frasch
,
M.
and
Schlessinger
,
J.
(
1995
).
The Drosophila insulin receptor homolog: a gene essential for embryonic development encodes two receptor isoforms with different signaling potential
.
EMBO J.
14
,
3373
-
3384
.
Figueroa-Clarevega
,
A.
and
Bilder
,
D.
(
2015
).
Malignant Drosophila tumors interrupt insulin signaling to induce cachexia-like wasting
.
Dev. Cell
33
,
47
-
55
.
Fontana
,
L.
,
Partridge
,
L.
and
Longo
,
V. D.
(
2010
).
Extending healthy life span--from yeast to humans
.
Science
328
,
321
-
326
.
Gallagher
,
E. J.
and
LeRoith
,
D.
(
2020
).
Hyperinsulinaemia in cancer
.
Nat. Rev. Cancer
20
,
629
-
644
.
Ghiglione
,
C.
,
Jouandin
,
P.
,
Cérézo
,
D.
and
Noselli
,
S.
(
2018
).
The Drosophila insulin pathway controls Profilin expression and dynamic actin-rich protrusions during collective cell migration
.
Development
145
,
dev161117
.
Grönke
,
S.
,
Clarke
,
D.-F.
,
Broughton
,
S.
,
Andrews
,
T. D.
and
Partridge
,
L.
(
2010
).
Molecular evolution and functional characterization of Drosophila insulin-like peptides
.
PLoS Genet.
6
,
e1000857
.
Gutmann
,
T.
,
Schafer
,
I. B.
,
Poojari
,
C.
,
Brankatschk
,
B.
,
Vattulainen
,
I.
,
Strauss
,
M.
and
Coskun
,
U.
(
2020
).
Cryo-EM structure of the complete and ligand-saturated insulin receptor ectodomain
.
J. Cell Biol.
219
,
e201907210
.
Haigo
,
S. L.
and
Bilder
,
D.
(
2011
).
Global tissue revolutions in a morphogenetic movement controlling elongation
.
Science
331
,
1071
-
1074
.
Hietakangas
,
V.
and
Cohen
,
S. M.
(
2009
).
Regulation of tissue growth through nutrient sensing
.
Annu. Rev. Genet.
43
,
389
-
410
.
Honegger
,
B.
,
Galic
,
M.
,
Köhler
,
K.
,
Wittwer
,
F.
,
Brogiolo
,
W.
,
Hafen
,
E.
and
Stocker
,
H.
(
2008
).
Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance
.
J. Biol.
7
,
10
.
Hosoe
,
J.
,
Kadowaki
,
H.
,
Miya
,
F.
,
Aizu
,
K.
,
Kawamura
,
T.
,
Miyata
,
I.
,
Satomura
,
K.
,
Ito
,
T.
,
Hara
,
K.
,
Tanaka
,
M.
et al. 
(
2017
).
Structural basis and genotype-phenotype correlations of INSR mutations causing severe insulin resistance
.
Diabetes
66
,
2713
-
2723
.
Ikeya
,
T.
,
Galic
,
M.
,
Belawat
,
P.
,
Nairz
,
K.
and
Hafen
,
E.
(
2002
).
Nutrient-dependent expression of insulin-like peptides from neuroendocrine cells in the CNS contributes to growth regulation in Drosophila
.
Curr. Biol.
12
,
1293
-
1300
.
Jannapureddy
,
S.
,
Sharma
,
M.
,
Yepuri
,
G.
,
Schmidt
,
A. M.
and
Ramasamy
,
R.
(
2021
).
Aldose reductase: an emerging target for development of interventions for diabetic cardiovascular complications
.
Front. Endocrinol. (Lausanne)
12
,
636267
.
Jouandin
,
P.
,
Ghiglione
,
C.
and
Noselli
,
S.
(
2014
).
Starvation induces FoxO-dependent mitotic-to-endocycle switch pausing during Drosophila oogenesis
.
Development
141
,
3013
-
3021
.
Kapali
,
G. P.
,
Callier
,
V.
,
Gascoigne
,
S. J. L.
,
Harrison
,
J. F.
and
Shingleton
,
A. W.
(
2022
).
The steroid hormone ecdysone regulates growth rate in response to oxygen availability
.
Sci. Rep.
12
,
4730
.
Koyama
,
T.
,
Texada
,
M. J.
,
Halberg
,
K. A.
and
Rewitz
,
K.
(
2020
).
Metabolism and growth adaptation to environmental conditions in Drosophila
.
Cell. Mol. Life Sci.
77
,
4523
-
4551
.
Kwon
,
Y.
,
Song
,
W.
,
Droujinine
,
I. A.
,
Hu
,
Y.
,
Asara
,
J. M.
and
Perrimon
,
N.
(
2015
).
Systemic organ wasting induced by localized expression of the secreted insulin/IGF antagonist ImpL2
.
Dev. Cell
33
,
36
-
46
.
LaFever
,
L.
and
Drummond-Barbosa
,
D.
(
2005
).
Direct control of germline stem cell division and cyst growth by neural insulin in Drosophila
.
Science
309
,
1071
-
1073
.
Lee
,
G. J.
,
Han
,
G.
,
Yun
,
H. M.
,
Lim
,
J. J.
,
Noh
,
S.
,
Lee
,
J.
and
Hyun
,
S.
(
2018
).
Steroid signaling mediates nutritional regulation of juvenile body growth via IGF-binding protein in Drosophila
.
Proc. Natl. Acad. Sci. USA
115
,
5992
-
5997
.
Li
,
J.
,
Park
,
J.
,
Mayer
,
J. P.
,
Webb
,
K. J.
,
Uchikawa
,
E.
,
Wu
,
J.
,
Liu
,
S.
,
Zhang
,
X.
,
Stowell
,
M. H. B.
,
Choi
,
E.
et al. 
(
2022
).
Synergistic activation of the insulin receptor via two distinct sites
.
Nat. Struct. Mol. Biol.
29
,
357
-
368
.
Mackay
,
T. F. C.
,
Richards
,
S.
,
Stone
,
E. A.
,
Barbadilla
,
A.
,
Ayroles
,
J. F.
,
Zhu
,
D.
,
Casillas
,
S.
,
Han
,
Y.
,
Magwire
,
M. M.
,
Cridland
,
J. M.
et al. 
(
2012
).
The Drosophila melanogaster genetic reference panel
.
Nature
482
,
173
-
178
.
Mahendran
,
Y.
,
Vangipurapu
,
J.
,
Cederberg
,
H.
,
Stančáková
,
A.
,
Pihlajamäki
,
J.
,
Soininen
,
P.
,
Kangas
,
A. J.
,
Paananen
,
J.
,
Civelek
,
M.
,
Saleem
,
N. K.
et al. 
(
2013
).
Association of ketone body levels with hyperglycemia and type 2 diabetes in 9,398 Finnish men
.
Diabetes
62
,
3618
-
3626
.
Matsushita
,
R.
and
Nishimura
,
T.
(
2020
).
Trehalose metabolism confers developmental robustness and stability in Drosophila by regulating glucose homeostasis
.
Commun. Biol.
3
,
170
.
Mattila
,
J.
and
Hietakangas
,
V.
(
2017
).
Regulation of carbohydrate energy metabolism in Drosophila melanogaster
.
Genetics
207
,
1231
-
1253
.
Meschi
,
E.
and
Delanoue
,
R.
(
2021
).
Adipokine and fat body in flies: connecting organs
.
Mol. Cell. Endocrinol.
533
,
111339
.
Morze
,
J.
,
Wittenbecher
,
C.
,
Schwingshackl
,
L.
,
Danielewicz
,
A.
,
Rynkiewicz
,
A.
,
Hu
,
F. B.
and
Guasch-Ferré
,
M.
(
2022
).
Metabolomics and type 2 diabetes risk: an updated systematic review and meta-analysis of prospective cohort studies
.
Diabetes Care
45
,
1013
-
1024
.
Musselman
,
L. P.
,
Fink
,
J. L.
,
Narzinski
,
K.
,
Ramachandran
,
P. V.
,
Hathiramani
,
S. S.
,
Cagan
,
R. L.
and
Baranski
,
T. J.
(
2011
).
A high-sugar diet produces obesity and insulin resistance in wild-type Drosophila
.
Dis. Model. Mech.
4
,
842
-
849
.
Nässel
,
D. R.
and
Zandawala
,
M.
(
2020
).
Hormonal axes in Drosophila: regulation of hormone release and multiplicity of actions
.
Cell Tissue Res.
382
,
233
-
266
.
Nishimura
,
T.
(
2020
).
Feedforward regulation of glucose metabolism by steroid hormones drives a developmental transition in Drosophila
.
Curr. Biol.
30
,
3624
-
3632.e3625
.
Okamoto
,
N.
and
Nishimura
,
T.
(
2015
).
Signaling from glia and cholinergic neurons controls nutrient-dependent production of an insulin-like peptide for Drosophila body growth
.
Dev. Cell
35
,
295
-
310
.
Okamoto
,
N.
,
Nakamori
,
R.
,
Murai
,
T.
,
Yamauchi
,
Y.
,
Masuda
,
A.
and
Nishimura
,
T.
(
2013
).
A secreted decoy of InR antagonizes insulin/IGF signaling to restrict body growth in Drosophila
.
Genes Dev.
27
,
87
-
97
.
Owusu-Ansah
,
E.
,
Song
,
W.
and
Perrimon
,
N.
(
2013
).
Muscle mitohormesis promotes longevity via systemic repression of insulin signaling
.
Cell
155
,
699
-
712
.
Pang
,
Z.
,
Zhou
,
G.
,
Ewald
,
J.
,
Chang
,
L.
,
Hacariz
,
O.
,
Basu
,
N.
and
Xia
,
J.
(
2022
).
Using MetaboAnalyst 5.0 for LC-HRMS spectra processing, multi-omics integration and covariate adjustment of global metabolomics data
.
Nat. Protoc.
17
,
1735
-
1761
.
Park
,
S.
,
Alfa
,
R. W.
,
Topper
,
S. M.
,
Kim
,
G. E. S.
,
Kockel
,
L.
and
Kim
,
S. K.
(
2014
).
A genetic strategy to measure circulating Drosophila insulin reveals genes regulating insulin production and secretion
.
PLoS Genet.
10
,
e1004555
.
Pasco
,
M. Y.
and
Léopold
,
P.
(
2012
).
High sugar-induced insulin resistance in Drosophila relies on the lipocalin Neural Lazarillo
.
PLoS One
7
,
e36583
.
Piper
,
M. D. W.
and
Partridge
,
L.
(
2018
).
Drosophila as a model for ageing
.
Biochim. Biophys. Acta Mol. Basis Dis.
1864
,
2707
-
2717
.
Puig
,
O.
,
Marr
,
M. T.
,
Ruhf
,
M. L.
and
Tjian
,
R.
(
2003
).
Control of cell number by Drosophila FOXO: downstream and feedback regulation of the insulin receptor pathway
.
Genes Dev.
17
,
2006
-
2020
.
Richard
,
D. S.
,
Rybczynski
,
R.
,
Wilson
,
T. G.
,
Wang
,
Y.
,
Wayne
,
M. L.
,
Zhou
,
Y.
,
Partridge
,
L.
and
Harshman
,
L. G.
(
2005
).
Insulin signaling is necessary for vitellogenesis in Drosophila melanogaster independent of the roles of juvenile hormone and ecdysteroids: female sterility of the chico1 insulin signaling mutation is autonomous to the ovary
.
J. Insect Physiol.
51
,
455
-
464
.
Rulifson
,
E. J.
,
Kim
,
S. K.
and
Nusse
,
R.
(
2002
).
Ablation of insulin-producing neurons in flies: growth and diabetic phenotypes
.
Science
296
,
1118
-
1120
.
Sajid
,
W.
,
Kulahin
,
N.
,
Schluckebier
,
G.
,
Ribel
,
U.
,
Henderson
,
H. R.
,
Tatar
,
M.
,
Hansen
,
B. F.
,
Svendsen
,
A. M.
,
Kiselyov
,
V. V.
,
Nørgaard
,
P.
et al. 
(
2011
).
Structural and biological properties of the Drosophila insulin-like peptide 5 show evolutionary conservation
.
J. Biol. Chem.
286
,
661
-
673
.
Saltiel
,
A. R.
and
Kahn
,
C. R.
(
2001
).
Insulin signalling and the regulation of glucose and lipid metabolism
.
Nature
414
,
799
-
806
.
Sarraf-Zadeh
,
L.
,
Christen
,
S.
,
Sauer
,
U.
,
Cognigni
,
P.
,
Miguel-Aliaga
,
I.
,
Stocker
,
H.
,
Köhler
,
K.
and
Hafen
,
E.
(
2013
).
Local requirement of the Drosophila insulin binding protein imp-L2 in coordinating developmental progression with nutritional conditions
.
Dev. Biol.
381
,
97
-
106
.
Sharma
,
A.
,
Halder
,
S.
,
Felix
,
M.
,
Nisaa
,
K.
,
Deshpande
,
G.
and
Prasad
,
M.
(
2018
).
Insulin signaling modulates border cell movement in Drosophila oogenesis
.
Development
145
,
dev166165
.
Shingleton
,
A. W.
,
Das
,
J.
,
Vinicius
,
L.
and
Stern
,
D. L.
(
2005
).
The temporal requirements for insulin signaling during development in Drosophila
.
PLoS Biol.
3
,
e289
.
Slaidina
,
M.
,
Delanoue
,
R.
,
Gronke
,
S.
,
Partridge
,
L.
and
Léopold
,
P.
(
2009
).
A Drosophila insulin-like peptide promotes growth during nonfeeding states
.
Dev. Cell
17
,
874
-
884
.
Tang
,
W. H.
,
Martin
,
K. A.
and
Hwa
,
J.
(
2012
).
Aldose reductase, oxidative stress, and diabetic mellitus
.
Front. Pharmacol.
3
,
87
.
Tatar
,
M.
(
2021
).
Aging regulated through a stability model of insulin/insulin growth factor receptor function
.
Front. Endocrinol. (Lausanne)
12
,
649880
.
Tatar
,
M.
,
Kopelman
,
A.
,
Epstein
,
D.
,
Tu
,
M.-P.
,
Yin
,
C.-M.
and
Garofalo
,
R. S.
(
2001
).
A mutant Drosophila insulin receptor homolog that extends life-span and impairs neuroendocrine function
.
Science
292
,
107
-
110
.
Teleman
,
A. A.
(
2010
).
Molecular mechanisms of metabolic regulation by insulin in Drosophila
.
Biochem. J.
425
,
13
-
26
.
Templeman
,
N. M.
and
Murphy
,
C. T.
(
2018
).
Regulation of reproduction and longevity by nutrient-sensing pathways
.
J. Cell Biol.
217
,
93
-
106
.
Texada
,
M. J.
,
Koyama
,
T.
and
Rewitz
,
K.
(
2020
).
Regulation of body size and growth control
.
Genetics
216
,
269
-
313
.
Uchikawa
,
E.
,
Choi
,
E.
,
Shang
,
G.
,
Yu
,
H.
and
Bai
,
X.-C.
(
2019
).
Activation mechanism of the insulin receptor revealed by cryo-EM structure of the fully liganded receptor-ligand complex
.
eLife
8
,
e48630
.
Valer
,
F. B.
,
Spegiorim
,
G. C.
,
Espreafico
,
E. M.
and
Ramos
,
R. G. P.
(
2022
).
The IRM cell adhesion molecules Hibris, Kin of irre and Roughest control egg morphology by modulating ovarian muscle contraction in Drosophila
.
J. Insect Physiol.
136
,
104344
.
Wu
,
Q.
and
Brown
,
M. R.
(
2006
).
Signaling and function of insulin-like peptides in insects
.
Annu. Rev. Entomol.
51
,
1
-
24
.
Yamada
,
T.
,
Hironaka
,
K.-I.
,
Habara
,
O.
,
Morishita
,
Y.
and
Nishimura
,
T.
(
2020
).
A developmental checkpoint directs metabolic remodelling as a strategy against starvation in Drosophila
.
Nat Metab
2
,
1096
-
1112
.
Yamamoto
,
R.
,
Palmer
,
M.
,
Koski
,
H.
,
Curtis-Joseph
,
N.
and
Tatar
,
M.
(
2021
).
Aging modulated by the Drosophila insulin receptor through distinct structure-defined mechanisms
.
Genetics
217
,
iyaa037
.
Yoshida
,
M.
,
Matsuda
,
H.
,
Kubo
,
H.
and
Nishimura
,
T.
(
2016
).
Molecular characterization of Tps1 and Treh genes in Drosophila and their role in body water homeostasis
.
Sci. Rep.
6
,
30582
.

Competing interests

The authors declare no competing or financial interests.

Supplementary information